ID: 900241243

View in Genome Browser
Species Human (GRCh38)
Location 1:1618555-1618577
Sequence TGCCCAGGGGATGGGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 339}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900241231_900241243 1 Left 900241231 1:1618531-1618553 CCCCACATCACCTGCTCCCAGGC 0: 1
1: 0
2: 0
3: 51
4: 417
Right 900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 339
900241228_900241243 12 Left 900241228 1:1618520-1618542 CCAAGCGCCAGCCCCACATCACC 0: 1
1: 0
2: 3
3: 42
4: 362
Right 900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 339
900241232_900241243 0 Left 900241232 1:1618532-1618554 CCCACATCACCTGCTCCCAGGCC 0: 1
1: 0
2: 0
3: 49
4: 404
Right 900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 339
900241235_900241243 -9 Left 900241235 1:1618541-1618563 CCTGCTCCCAGGCCTGCCCAGGG 0: 1
1: 0
2: 8
3: 127
4: 873
Right 900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 339
900241233_900241243 -1 Left 900241233 1:1618533-1618555 CCACATCACCTGCTCCCAGGCCT 0: 1
1: 1
2: 1
3: 57
4: 581
Right 900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 339
900241229_900241243 5 Left 900241229 1:1618527-1618549 CCAGCCCCACATCACCTGCTCCC 0: 1
1: 1
2: 5
3: 85
4: 759
Right 900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900241243 Original CRISPR TGCCCAGGGGATGGGTCCTG TGG Intronic
900129686 1:1082087-1082109 TGCCCTGGCGCTGAGTCCTGGGG - Exonic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900327147 1:2113940-2113962 TCCCCAGGGCATGGATGCTGTGG - Intronic
900413410 1:2523984-2524006 GGCAGAGGGGATGGGGCCTGTGG - Intronic
900765482 1:4502164-4502186 GGTCCAGGGGGTGGGTGCTGGGG - Intergenic
901011865 1:6206754-6206776 GGCCCGGGGGATGGGGTCTGGGG - Intronic
901274325 1:7979309-7979331 TGGCCAGGGGCGGGGGCCTGGGG - Intronic
901394451 1:8970926-8970948 GGTTCAGGGGCTGGGTCCTGCGG - Exonic
901445500 1:9305572-9305594 GGCCCAGGGTGTGGGTGCTGGGG + Intronic
902583242 1:17422628-17422650 TGCCTTGGGGATGGGGCGTGGGG - Intronic
902809279 1:18879243-18879265 TGGCCAGGGGAGGGGTCCCTGGG + Intronic
902818246 1:18928187-18928209 TCCCCAGGGGGTGGGGCTTGGGG - Intronic
903685752 1:25130745-25130767 TGACCAGGGCAGGGGTCCAGTGG - Intergenic
904089937 1:27937708-27937730 GGCCCAGGGAATGAGTCCTAAGG + Intronic
904797625 1:33069354-33069376 TGCCCTGGGGCTGGGTGCAGTGG + Intronic
905007582 1:34722361-34722383 AGCTCAGAGTATGGGTCCTGCGG - Intronic
905344291 1:37300980-37301002 TGCCCTGGGGCTGAGCCCTGTGG + Intergenic
905363406 1:37435553-37435575 TGCCCAGGAGTTGGCTCCAGAGG + Intergenic
905365520 1:37449119-37449141 ACCCCTGGGCATGGGTCCTGGGG + Intergenic
905664268 1:39753144-39753166 TGGCCAGGGGCTGTGTCCAGCGG + Intronic
905923622 1:41734729-41734751 TGCCCCGGGGCTGGCTGCTGTGG - Intronic
906544787 1:46613344-46613366 TGTCCAGGGGCTCGGACCTGAGG + Exonic
907008314 1:50938434-50938456 TTTCCAGGGGATGGATCCTGGGG - Intronic
907318464 1:53587781-53587803 TGCCCCCTGGCTGGGTCCTGGGG - Intronic
907493726 1:54827411-54827433 TGTCCAGGGGGAGAGTCCTGCGG - Intronic
907820563 1:57963704-57963726 TTCCCAGGGGATGATTACTGGGG - Intronic
908106896 1:60854428-60854450 GGCCCAGTGGATGGGGCTTGGGG - Intergenic
909189840 1:72538379-72538401 TCCCCAGTGGGTAGGTCCTGTGG + Intergenic
909534837 1:76725014-76725036 TGCCATGGGGATGTTTCCTGGGG - Intergenic
911256514 1:95639258-95639280 TGGCCAGGGGCTGGGTGCAGTGG + Intergenic
914303075 1:146393299-146393321 TGCGCAGTGGTAGGGTCCTGGGG - Intergenic
914958657 1:152187230-152187252 TGCCCAGTGAATAGGTCCTAGGG + Intergenic
915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG + Exonic
918264572 1:182829631-182829653 TGCCCAGAGGAAGAGTCCTTTGG - Exonic
918494714 1:185121877-185121899 TGCCCACTGCATGGGTGCTGGGG - Intronic
920251939 1:204627760-204627782 AGCCCAGGAGATGGGTGCAGGGG - Intronic
921368316 1:214396024-214396046 TGCACCGGGTATGGGGCCTGTGG - Intronic
922722448 1:227905828-227905850 TTCCCTGGGGAAGGGCCCTGTGG + Intergenic
1062922355 10:1289739-1289761 CCCCCAGGGGCTGGATCCTGTGG - Intronic
1063125086 10:3130001-3130023 TCCCAAGGGGACGGGCCCTGAGG - Intronic
1064312518 10:14224054-14224076 TGCTCAGGCGAGGAGTCCTGTGG + Intronic
1064560612 10:16591908-16591930 TAAACAGGGGATGGGACCTGGGG + Exonic
1067031932 10:42884171-42884193 TGGCCTGGGGAAGGGGCCTGGGG + Intergenic
1067257179 10:44652805-44652827 TCCTCTGGGGATGTGTCCTGTGG - Intergenic
1069908843 10:71747923-71747945 TGCCCAGGGAATGGGCCAGGTGG + Exonic
1069992327 10:72323286-72323308 TGGCCAGGGGCTGGGTCCTGCGG - Intergenic
1073008982 10:100345882-100345904 TTCCCAGGGGAAGGATCCTAGGG + Intergenic
1074366164 10:112859136-112859158 AGCCCAGGGGCTGGTTGCTGAGG + Intergenic
1075513123 10:123088142-123088164 AGCCCAGTGCATGGGTCATGGGG + Intergenic
1075520909 10:123143053-123143075 AGCCCTGCGGCTGGGTCCTGCGG - Intergenic
1075721953 10:124592622-124592644 TGCCCAGGAGGTGGGAGCTGTGG + Intronic
1076182748 10:128423172-128423194 TGGCCAGGGGCTGGGTAGTGGGG + Intergenic
1076667518 10:132101681-132101703 TGGCCCGGGGCTCGGTCCTGGGG + Intergenic
1076668208 10:132104762-132104784 TGCCCAGGGGTAGGGTGCTCCGG - Exonic
1076745205 10:132509529-132509551 TGCCCAGGGGCTGGGTCAAGTGG + Intergenic
1076924358 10:133474919-133474941 TGCCCAGGGCAGAGGTGCTGGGG + Intergenic
1076931957 10:133537332-133537354 TGCCAAAGGGAAGGGTCTTGGGG - Intronic
1077153776 11:1082626-1082648 TGCCCAGGGTCTGGGGCATGGGG + Intergenic
1077311235 11:1889915-1889937 GGACCAGGGGCTGGGCCCTGGGG + Exonic
1077365285 11:2159070-2159092 TGCCCAAGGCATGGGTTCTGAGG + Intronic
1077507865 11:2940461-2940483 TGCCCAGGGTCTGGGTTCTGAGG + Intergenic
1078094699 11:8289644-8289666 GGCCCAGGGGAGGGGGGCTGGGG + Intergenic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1078932713 11:15925055-15925077 TGCCCTGGGGAAAGGTCGTGGGG - Intergenic
1081869639 11:46377457-46377479 TGCTCAGGTGGTGGGTCCGGGGG - Intronic
1083027641 11:59564031-59564053 TGCCCAGGGGTGGGGTGCAGTGG - Intergenic
1083864912 11:65448512-65448534 AGGGCAGGGGATGGGTCATGGGG - Intergenic
1083998688 11:66284494-66284516 TGCCCAGGGGATCGGGCTTGGGG - Intronic
1084190710 11:67497487-67497509 TGCCCAGGGTAGGGGTGATGGGG + Intronic
1084385653 11:68841543-68841565 TCCCCAGGGGATTGGGTCTGAGG - Intronic
1084664546 11:70569402-70569424 TGAGCAGGGCCTGGGTCCTGAGG + Intronic
1084934998 11:72582195-72582217 TGCCCAGGGCATGTGACCTCAGG - Intronic
1085274576 11:75290081-75290103 TGCCCAGGGGCAAGCTCCTGCGG + Intronic
1085351252 11:75799227-75799249 TGGGGAGGGGCTGGGTCCTGTGG + Intronic
1089134994 11:116241901-116241923 GGGCAAGGGTATGGGTCCTGGGG - Intergenic
1089396050 11:118136807-118136829 TGGCCAGGGGAGGGGGTCTGTGG - Exonic
1089443329 11:118533290-118533312 TGCCCTGTGGTTGGGTCTTGTGG + Intronic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089603086 11:119626950-119626972 TGGCCTGGGGATGGGGCCAGGGG + Intronic
1091281270 11:134383153-134383175 AACCCATGGGATGGGTCCTGGGG - Intronic
1091318589 11:134633468-134633490 TGCCCAGTGCATAGGGCCTGGGG + Intergenic
1091329942 11:134724516-134724538 TGCACAGGGGATGGGTTTTCTGG + Intergenic
1091463265 12:662094-662116 TGGTCAGGGGAGGGCTCCTGGGG + Intronic
1091664462 12:2409356-2409378 TTCCCAGAGGATGGGTCCCTAGG - Intronic
1091829000 12:3535967-3535989 AGCACAGGGGATAGGTCTTGGGG - Intronic
1092139346 12:6172016-6172038 TGCCGAGGGGATGGGCTCCGAGG - Intergenic
1092547953 12:9467905-9467927 TGCCCAGAGGAGGGATCTTGAGG - Intergenic
1092996797 12:13958617-13958639 TGCCCACGGGATGAGACATGTGG - Intronic
1093264262 12:16983072-16983094 TGTCAAGTGGATGGGTCATGGGG - Intergenic
1093771554 12:23023549-23023571 TGCCAAGGAGCTGGGTCCTTAGG + Intergenic
1094476297 12:30843285-30843307 TGCATAGGGCCTGGGTCCTGCGG - Intergenic
1094505033 12:31054461-31054483 TGCCCAGAGGAGGGATCTTGAGG + Intergenic
1095363721 12:41375905-41375927 TTGCCAGGGGATGGGGCTTGGGG - Intronic
1096113150 12:49040703-49040725 TGGGCAGGGGGTGGCTCCTGGGG + Exonic
1097151181 12:56981041-56981063 TGCCCCAGGGAAGGGACCTGGGG + Intergenic
1097153010 12:56993642-56993664 TGAGCAGGGGATGGGGCGTGGGG - Intergenic
1097824488 12:64160650-64160672 TTGCCAGTGGCTGGGTCCTGGGG + Exonic
1098388932 12:69948877-69948899 TTCCCAGGGGAAGGGTGCAGAGG - Intronic
1098486484 12:71027709-71027731 TTTCCAGGGGGTGGGTCCAGGGG - Intergenic
1101585456 12:106081781-106081803 TGCCTAGGGGTTGGGTTCTATGG - Intronic
1101856854 12:108450962-108450984 TGCCCAGAGGAGGGGGTCTGGGG + Intergenic
1102370791 12:112381578-112381600 TGCCCTGGAAGTGGGTCCTGGGG + Intronic
1104466948 12:128998270-128998292 TGACCAGAGGAAGGGTTCTGAGG - Intergenic
1104944487 12:132409550-132409572 GGCCCGGGGGATGGGAGCTGTGG + Intergenic
1105702459 13:22943713-22943735 CATCCAGGGGATGGGGCCTGGGG - Intergenic
1107065955 13:36214533-36214555 TGCGCACGTGCTGGGTCCTGGGG + Exonic
1107157904 13:37191139-37191161 AGCCCAGGGGATGGGACATTTGG + Intergenic
1108040758 13:46337675-46337697 TGTCCAGGGGATGAGTACTGAGG - Intergenic
1111893272 13:94109216-94109238 TGCCCAGTGGATGGGTGCTATGG + Intronic
1111895178 13:94132814-94132836 TATCCATGGGCTGGGTCCTGAGG - Intronic
1112076801 13:95922743-95922765 AGCCCAGGAGTTGGGTGCTGTGG + Intronic
1113077436 13:106480910-106480932 TGTCCAGGCCGTGGGTCCTGGGG - Intergenic
1113769957 13:112901479-112901501 TTCCTAGGGAAGGGGTCCTGCGG + Intronic
1113795628 13:113056077-113056099 TCTCCATGGGAGGGGTCCTGTGG + Intronic
1114131806 14:19800758-19800780 TGCCAAGGGGAAGGATCCAGGGG - Intronic
1114613411 14:24056238-24056260 AGCCCAGAGGCTGGGACCTGGGG + Intronic
1118454490 14:65932152-65932174 TGCCCAGGGGAAGTGTCTTGGGG - Intergenic
1119555695 14:75550748-75550770 GACCCAAGGGATGGGTCCTGTGG - Intergenic
1120870944 14:89337070-89337092 TGCCCAAGAGAGGGGTCCTTAGG + Intronic
1121105440 14:91276229-91276251 AACTCAGGGGATGGGTTCTGTGG + Intronic
1121898375 14:97670201-97670223 TGCACAGGGGATGAGCTCTGAGG + Intergenic
1122215420 14:100200466-100200488 TTCCCAGGGGATGGGGAGTGGGG - Intergenic
1122468717 14:101951421-101951443 GGCCCAGGTCATGGGTGCTGGGG - Intergenic
1122725243 14:103746313-103746335 TGAGCAGGGAATGGGGCCTGCGG - Intronic
1122771869 14:104101230-104101252 TGCCCAGGGCGTGGCTGCTGGGG + Intronic
1122779640 14:104138345-104138367 TGCCCCGGGGAGGGGCGCTGGGG - Intergenic
1122888759 14:104723277-104723299 TGGCCAAGAGAAGGGTCCTGGGG - Intergenic
1123043866 14:105501971-105501993 AGCCCAGGGAATGTGTCCTACGG + Intergenic
1123411661 15:20066007-20066029 TGCCCTGAGGCTGGGCCCTGGGG - Intergenic
1123450486 15:20356797-20356819 GGCCCGGAGGAGGGGTCCTGAGG - Intergenic
1123521007 15:21073126-21073148 TGCCCTGAGGCTGGGCCCTGGGG - Intergenic
1126299860 15:47183965-47183987 TGAGCAGGGGAAAGGTCCTGGGG - Intergenic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1129664757 15:77573356-77573378 TCCCCAGAGTATGGGTGCTGGGG - Intergenic
1129685452 15:77683922-77683944 TGCCCAGAGGCTGTGTCCTCAGG - Intronic
1130068462 15:80626656-80626678 GGCCCTGGGTATGGGTGCTGTGG + Intergenic
1130136831 15:81188541-81188563 AGCCCAGGGGATAGGTACTCAGG + Intronic
1131765566 15:95672009-95672031 TTCCTAGGTGAAGGGTCCTGTGG - Intergenic
1132147766 15:99438474-99438496 GGCCCAGGCGGTGGGTCCTCCGG + Intergenic
1132465886 16:77345-77367 GGCCTAGGGGACGGGCCCTGAGG - Intronic
1132618269 16:852830-852852 TTCCCAGGCGATGGGTCCCTCGG + Intergenic
1132638567 16:966311-966333 TGCACAGGGCATGAGTGCTGGGG - Intronic
1132788330 16:1670589-1670611 AGTCCAGCGGAAGGGTCCTGAGG - Intronic
1133593825 16:7271863-7271885 TGCACAGGGGATGGGCTGTGAGG - Intronic
1133880436 16:9776760-9776782 TGCCCAGGGGTTGGGTACTTTGG + Intronic
1134513099 16:14864578-14864600 TCCACAGGTGATGGTTCCTGAGG + Exonic
1134700736 16:16263067-16263089 TCCGCAGGTGATGGTTCCTGAGG + Exonic
1134971089 16:18531592-18531614 TCCGCAGGTGATGGTTCCTGAGG - Exonic
1135752131 16:25066381-25066403 TGCCCACAGGATTGGTCCTTTGG - Intergenic
1135935348 16:26775110-26775132 TGCCCTAGGGTTGGCTCCTGGGG + Intergenic
1138551604 16:57751745-57751767 GGCCCAGGGGCTGGGGGCTGGGG + Intronic
1138562854 16:57812416-57812438 TGCAGAGGGGCTGGGTGCTGAGG - Intronic
1139335249 16:66226724-66226746 TGTCCGGGGGATGAGTTCTGTGG - Intergenic
1139953694 16:70683680-70683702 GGCCCAGGGGAGGGCTTCTGTGG + Intronic
1140378876 16:74468652-74468674 TCCTCAGGGGCTGGGTGCTGTGG - Intronic
1140485530 16:75290230-75290252 TCCCCATGGGCTGGGTGCTGTGG - Intergenic
1141131937 16:81443446-81443468 TGCCCAGGAGATGCCTCCTTGGG - Intergenic
1141319519 16:82994191-82994213 TGCACAAAGGATGGGTTCTGAGG - Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1141997696 16:87645748-87645770 TGCCCAGGGTCTGGCTCCTGTGG + Intronic
1142029741 16:87832568-87832590 TGCCCAGGGTCTGGGCCCTTGGG + Exonic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142353299 16:89589596-89589618 AGACCACGGGAGGGGTCCTGTGG - Intronic
1142623464 17:1179159-1179181 GGCCCAGGGGTTCGGTGCTGGGG - Intronic
1143165357 17:4894730-4894752 GGCCCAAGGGAGAGGTCCTGTGG - Intronic
1143660516 17:8321905-8321927 TGGCCAGTAGCTGGGTCCTGAGG + Exonic
1144497285 17:15756766-15756788 GGGCCAGGGGTGGGGTCCTGCGG - Intergenic
1144500900 17:15786338-15786360 CGCCCAGGGGAGGGGGCCTCGGG + Intergenic
1144629071 17:16861254-16861276 GGGCCAGGGGCGGGGTCCTGCGG - Intergenic
1145160648 17:20571815-20571837 GGGCCAGGGGCGGGGTCCTGCGG - Intergenic
1145163062 17:20589000-20589022 CGCCCAGGGGAGGGGGCCTCGGG + Intergenic
1146896485 17:36545300-36545322 AGGCCAGGGGTGGGGTCCTGGGG + Intronic
1147384366 17:40072723-40072745 AGCCCAGGGGCTGGGCACTGGGG - Intronic
1147609421 17:41792902-41792924 TGTCCAGGGGAGGGGCCTTGAGG + Intergenic
1148054300 17:44784707-44784729 TGCACAGGGGCTGGGTGCAGTGG + Intergenic
1149427609 17:56570211-56570233 TGCCCAGGGTATGGGGCCTCAGG + Intergenic
1149592401 17:57840851-57840873 TGCACAGGGGATTGGTGCTAGGG - Intronic
1149638746 17:58190141-58190163 AGCCTAGGGGCAGGGTCCTGTGG + Intergenic
1151666787 17:75549758-75549780 TGCCCAAGGGCTAGGACCTGAGG - Intronic
1151955701 17:77379189-77379211 TGCTCAGTGGATGGGTCCACGGG - Intronic
1152002260 17:77654272-77654294 TGCCCTTGGGATGGGACCTATGG - Intergenic
1152198089 17:78929285-78929307 TGCCCTGGGCATGGGGCATGCGG - Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152621869 17:81368875-81368897 TGCCCAGAGGGTGTGTCTTGTGG + Intergenic
1153488590 18:5627123-5627145 TTCACAGAGGATGGGTCCTGTGG - Intronic
1156226865 18:35118199-35118221 TGCCGAGGGCATGGCTGCTGTGG - Intronic
1157501094 18:48191243-48191265 TGGCCAGGTCATGGGCCCTGTGG + Intronic
1157807057 18:50665857-50665879 TGTCCATGGGCTGGGGCCTGGGG + Intronic
1158485335 18:57861237-57861259 AGCCCAGGGGGTGGAGCCTGGGG - Intergenic
1160513012 18:79463080-79463102 TGGGAAGGGGATGGGTCCTTGGG - Intronic
1160761506 19:787738-787760 TGGCCTGGGGCTGGGCCCTGGGG - Intergenic
1160975633 19:1790935-1790957 TGGCCAGGGGGTGGGGCATGTGG - Intronic
1161233676 19:3187751-3187773 TGTCCAGGGGAAGCGCCCTGGGG + Intronic
1162086879 19:8254651-8254673 TGCCCTGGGGGTGGGGCGTGGGG + Intronic
1163202173 19:15777352-15777374 TGCCCTAGGGATATGTCCTGAGG - Intergenic
1163550584 19:17964516-17964538 TTCCCAGGGCATGAGTCCCGGGG + Intronic
1163843183 19:19624073-19624095 TGCCCAGGGAATGGGGGCTTTGG - Exonic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165933521 19:39375524-39375546 TGCCAAGAGGAAGGGACCTGGGG - Intronic
1166154796 19:40902883-40902905 TACCCAGGAGATGGGTGGTGTGG - Intergenic
1166173279 19:41047438-41047460 TACCCAGGAGATGGGTGGTGTGG + Intergenic
1166944837 19:46390389-46390411 AGCCCAGGGCCTGGGTCCGGTGG - Exonic
1166966703 19:46533445-46533467 AGCTCTGGGGAGGGGTCCTGGGG + Intronic
1167048981 19:47067428-47067450 TGCCCGGGGAGTGGGTCCAGGGG + Exonic
1167744997 19:51345489-51345511 TGGCCAGTGGGTGGGTCCAGAGG - Intronic
1168105283 19:54162436-54162458 TGTCCAGAGGGCGGGTCCTGAGG + Intronic
925378810 2:3409077-3409099 TGCCCAGGGCATGGCACCAGAGG - Intronic
927788992 2:25995099-25995121 TGCCCAGGTGATGAAGCCTGTGG - Intergenic
928086191 2:28347854-28347876 CGCCCCGGGGCTGGGGCCTGGGG - Intergenic
929892188 2:45927540-45927562 GGCCCAGAGGTTTGGTCCTGGGG - Intronic
931849369 2:66237263-66237285 TGCTCAGCGGCGGGGTCCTGGGG - Intergenic
932745871 2:74333078-74333100 TGCCCAGGGGAAGACACCTGTGG - Intronic
933638031 2:84728391-84728413 TGCCCAGTGGAGGGGTATTGAGG + Intronic
933902726 2:86861427-86861449 TGGCCAGGCCATGGGTCCTGTGG - Intronic
935340320 2:102053690-102053712 TGTCCAGGGAATGTGTCCAGGGG - Intergenic
935497870 2:103804017-103804039 TGCACAGGAGAAGGGTCATGTGG + Intergenic
935745947 2:106190456-106190478 TGCCTAGGGGTTGGGTGCGGTGG + Intronic
935777821 2:106487841-106487863 TGGCCAGGCCGTGGGTCCTGTGG + Intergenic
936057011 2:109269004-109269026 TGCCCAGGTGATGAGGCTTGAGG + Intronic
936751564 2:115648517-115648539 TACCCAGGTGATGGGTTCTTAGG + Intronic
937028429 2:118718297-118718319 TGTCCAGGAGATGTGTCCTCTGG + Intergenic
937574371 2:123401377-123401399 GTTCCAGGGGATGGGTCATGTGG - Intergenic
937853489 2:126656322-126656344 CGCCGTGGGGAAGGGTCCTGGGG + Intronic
938044948 2:128110406-128110428 TGGGCAGAGGATGGGTGCTGGGG - Intronic
938399388 2:130976191-130976213 GGCCCAGGGCATTGGTCTTGAGG + Intronic
943558964 2:189438653-189438675 TTGCCAGGGGATAGGTCTTGGGG + Intergenic
944721848 2:202430611-202430633 TGCCAACTGGATGGGTCCTTTGG + Intronic
944924435 2:204449786-204449808 TTCCCAGTAGGTGGGTCCTGAGG + Intergenic
946884644 2:224210786-224210808 TGCACTGGGGATGTGCCCTGGGG + Intergenic
947931023 2:233965162-233965184 GGCCCAGGGGCTGGGTCCTCTGG - Intronic
948389489 2:237601788-237601810 CGCCCAGAGGAGGGATCCTGGGG - Intergenic
948653126 2:239461594-239461616 TAACCAGGGAATGCGTCCTGGGG - Intergenic
948950485 2:241247901-241247923 TCCCCAGAGCAGGGGTCCTGTGG + Intronic
1169198571 20:3696723-3696745 CGACCATGGGATGGGACCTGGGG + Exonic
1171351199 20:24504553-24504575 TGCCTGGGGGCTGGGACCTGAGG + Intronic
1172841885 20:37906912-37906934 TGTCCAGGGGAGGGATCCAGAGG + Intronic
1172885824 20:38230103-38230125 TGGCTAGGGGCTGGGTCCCGAGG + Intronic
1173204570 20:40982665-40982687 TGCACAGGGGACAGGTGCTGGGG - Intergenic
1174082401 20:47979755-47979777 TCCCCAGGGAATAGGACCTGAGG + Intergenic
1174134150 20:48367483-48367505 TCCCCAGGGAATAGGACCTGAGG - Intergenic
1174168834 20:48603931-48603953 TGCCCTGGGCATGTGCCCTGTGG + Intergenic
1175991036 20:62789222-62789244 AGGCCAGGTGATGGGCCCTGGGG + Intergenic
1179573588 21:42292475-42292497 TGCCCTAGGCAGGGGTCCTGGGG - Intronic
1179902972 21:44403264-44403286 TGTCCAGCTGCTGGGTCCTGGGG + Intronic
1179953803 21:44726954-44726976 TGCCCAGCAGGTGGGTCATGAGG - Intergenic
1179960956 21:44766765-44766787 TGCCCAGTGGGTGGGTTCGGTGG + Intergenic
1180788041 22:18557871-18557893 TGTCCAGGGGCTGGGCCTTGGGG - Intergenic
1180836412 22:18931872-18931894 TGCAGAGCGCATGGGTCCTGGGG - Intronic
1180954962 22:19737466-19737488 AGCCTGGGGGGTGGGTCCTGAGG + Intergenic
1180979404 22:19871676-19871698 GGCCCATGGGAGGGGTCTTGTGG + Intergenic
1180993533 22:19953145-19953167 CGCCCAGGCCATGAGTCCTGAGG - Intronic
1181233697 22:21437447-21437469 TGTCCAGGGGCTGGGCCTTGGGG + Intronic
1181244953 22:21497396-21497418 TGTCCAGGGGCTGGGCCTTGGGG - Intergenic
1181600644 22:23949856-23949878 AACCCAGGGGACGGGCCCTGGGG - Intergenic
1181607867 22:23991466-23991488 AACCCAGGGGACGGGCCCTGGGG + Intergenic
1181694268 22:24585140-24585162 AGGCCTGGGGCTGGGTCCTGAGG + Intronic
1183899003 22:40991152-40991174 TGGGCAGGGGCTGGGGCCTGAGG - Intergenic
1184718209 22:46294030-46294052 AGGCCTGGGGCTGGGTCCTGGGG + Intergenic
1184820364 22:46905486-46905508 AGCCCAGGGGATGGCTACTCAGG - Intronic
1185420742 22:50732864-50732886 TGCCCAGGGAGTGGGGCCGGTGG - Intergenic
1203286504 22_KI270734v1_random:157171-157193 TGCAGAGCGCATGGGTCCTGGGG - Intergenic
949639473 3:6019087-6019109 TGCCCTGGGGATGGTTGCTCAGG - Intergenic
951840858 3:27032458-27032480 TGACCAGGGAAGGGATCCTGGGG + Intergenic
952231327 3:31433764-31433786 TGCCCAGGGGAAGCTGCCTGTGG - Intergenic
952362706 3:32646830-32646852 AGCCCAGGGGTTGGGTGCTATGG + Intergenic
954760655 3:52871290-52871312 TGCCCAGGGTGTGAGTCCTGTGG - Intronic
955349330 3:58182378-58182400 TGCTCTGTGGATGAGTCCTGTGG - Intergenic
955812847 3:62809322-62809344 TGCCCAGGGGTTTGCTCTTGTGG - Intronic
956738835 3:72259189-72259211 TGCCCAGTGGATGGTCCCTAGGG + Intergenic
962280738 3:134049867-134049889 TGCCCAGGTGAGAGGTCCAGAGG - Intronic
962785015 3:138760245-138760267 TGCTTAGGGGATGGGCCGTGAGG - Intronic
967606577 3:191454170-191454192 TGCCCAGGGATTGTGTCCTATGG + Intergenic
967878444 3:194282188-194282210 AGCCCAGGGAATGGTTTCTGAGG - Intergenic
968656178 4:1779408-1779430 TGCCCAGGGGACAGGTGTTGAGG + Intergenic
968744550 4:2352954-2352976 TGCCCAGGGGACAGGTGCTGGGG - Intronic
969478276 4:7433445-7433467 TGCCCAGCAGTGGGGTCCTGGGG + Exonic
975403933 4:73968236-73968258 TGCCCTGGAGATCTGTCCTGGGG - Intergenic
975471615 4:74775533-74775555 TTCCCAGGGGATGATTTCTGGGG - Intronic
975794922 4:77996977-77996999 TGCCCAGAGGATGGGGGTTGAGG + Intergenic
975810665 4:78165706-78165728 TGGCTAGGGGTTGGCTCCTGTGG + Intronic
976858311 4:89630551-89630573 TGGCCAGGTGATGGGTATTGCGG - Intergenic
977491181 4:97713761-97713783 GGCCCAGGGTACGGGACCTGTGG + Intronic
979888911 4:126065192-126065214 GGTCCTGGGGATGGGTCCTGAGG + Intergenic
982712294 4:158769281-158769303 TGCCCAGGGCAGGGCTCCTAAGG + Exonic
984725053 4:183012886-183012908 TGCTCTGGGTATGGGACCTGGGG - Intergenic
985476428 5:81876-81898 AGCCCAGGGGAGGCTTCCTGGGG + Intergenic
985602303 5:841581-841603 TGAGCAAGGGATGGGTGCTGGGG - Intronic
986107253 5:4671576-4671598 TGTTCAGGGGATGCTTCCTGTGG - Intergenic
986549213 5:8934338-8934360 TGCCTTGAGGATGAGTCCTGGGG - Intergenic
986988348 5:13524073-13524095 TGCCCACGGGAGGGGTTGTGGGG + Intergenic
987306659 5:16643816-16643838 GGCCCAGGGGATGTCTCATGAGG + Intergenic
990809456 5:59706143-59706165 TGCCCTGGGGATTGGCCATGTGG + Intronic
992383158 5:76258333-76258355 TGCCCAGGGGAGATTTCCTGAGG - Intronic
993179371 5:84531402-84531424 TTACCAGAGGATGGGTCATGGGG + Intergenic
995241035 5:109885384-109885406 TGGCCAGGGGCTTGGTCCCGGGG - Intergenic
996540951 5:124629694-124629716 TGCCCAGGTCCTGTGTCCTGGGG - Intergenic
996780582 5:127182528-127182550 TGCCCAGGGGATGGAACCTCAGG + Intergenic
997196916 5:131986336-131986358 TGCCCCCGGGATGGGCCATGTGG - Intronic
998172024 5:139878088-139878110 TGCACAGGGCTTGGGGCCTGTGG - Intronic
998365088 5:141625221-141625243 TGCAGAGGAGAGGGGTCCTGAGG - Exonic
1001080741 5:168665495-168665517 GGGCCAGTGCATGGGTCCTGAGG + Intronic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1002103678 5:176869536-176869558 GGCCCAGGGGACGGGGCGTGAGG - Intronic
1002257317 5:177967676-177967698 TGCCCAGAGGCTGTGTGCTGTGG - Intergenic
1002470686 5:179433687-179433709 TTCCCAGGGGCTGGGTGCGGTGG - Intergenic
1002757568 6:176870-176892 TTCCCAGGGGAGGGTTCCTTTGG + Intergenic
1006136037 6:31897145-31897167 GGCCCGGGGGAGGGGTCGTGCGG - Intronic
1006645178 6:35510848-35510870 GGCCCAAGGGGTGGGTGCTGAGG - Exonic
1006851738 6:37103390-37103412 AGCCCAGGGCATGTGTCCTTGGG - Intergenic
1010051075 6:71505113-71505135 TGTCCAGGGGATGTGTCGGGTGG - Intergenic
1011131865 6:84060024-84060046 TCCCCTGGGGATGGGTCATAGGG + Intronic
1014380155 6:120729879-120729901 TGCCTTGGGGATGGTTGCTGTGG + Intergenic
1015167694 6:130216766-130216788 AGCCTAGGGGAGGGGTTCTGTGG - Intronic
1018214975 6:161518120-161518142 TGGCCTGGGGATGGGGCCGGGGG + Intronic
1018771961 6:166978725-166978747 GGCCGAGGGGGTGGGTCATGAGG + Intergenic
1019779180 7:2929674-2929696 TGCTCAGAGGCTGGGTCTTGGGG + Intronic
1019884904 7:3895336-3895358 TGACTAGGGAATGGGCCCTGAGG - Intronic
1020009257 7:4799563-4799585 TGCTCAGGGGAGTGGACCTGGGG - Intronic
1020151720 7:5686973-5686995 TGGCCTGGGGATGGGGACTGGGG + Intronic
1021910003 7:25376071-25376093 TTCCCAGGGGTTGGGGCATGGGG + Intergenic
1022368879 7:29751946-29751968 TGCACAGGGGAAGGGAGCTGAGG - Intergenic
1022660927 7:32365574-32365596 GGCCCAGGACATGGGTACTGGGG - Intergenic
1023121874 7:36917721-36917743 TGTCCAGGAGTTGGATCCTGGGG - Intronic
1024094973 7:45976153-45976175 AGCCCAGAGGCTGGGTCCTGAGG + Intergenic
1024204946 7:47149992-47150014 GGCCCAGGAGAAGGGTCCTATGG - Intergenic
1024985874 7:55192631-55192653 GGCCTGGGGGACGGGTCCTGGGG + Intronic
1029435662 7:100562701-100562723 GACCCAGGGGAGGGGACCTGAGG + Intronic
1030715270 7:112801509-112801531 TCCCCAGTGGACAGGTCCTGTGG + Intergenic
1031676249 7:124615885-124615907 GGCCTTGGGGGTGGGTCCTGAGG - Intergenic
1032001329 7:128267408-128267430 TTCCCAGGGGATGGGGGCGGGGG + Intergenic
1034116885 7:148591462-148591484 TGCCCTGGAGATGGGTCCACAGG + Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034442940 7:151096314-151096336 GGCCCAGGGGAAGGGACCTGAGG + Intronic
1036695296 8:10970279-10970301 GGCCTAGGGGATGGGTACTGAGG + Intronic
1037581714 8:20249473-20249495 TTCCCAGGAGATGGGTCCAGGGG - Exonic
1037906480 8:22718672-22718694 TGATCAGGGGCTGGGCCCTGGGG + Intronic
1038612567 8:29069607-29069629 TGCCCAGGTGGAGGGTCCTGGGG - Exonic
1038747441 8:30266897-30266919 TTCCCAGGGGAGAGGACCTGAGG + Intergenic
1039038269 8:33383099-33383121 TTCTCAGGGGCAGGGTCCTGAGG + Intronic
1040555014 8:48470604-48470626 TTGCCAGGGGAGGGGTGCTGGGG - Intergenic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1041720076 8:60967691-60967713 TGCTCAGGGTGTGGGTGCTGAGG + Intergenic
1042186273 8:66139324-66139346 TGCACAGGAGAAGAGTCCTGGGG + Intronic
1045054543 8:98357950-98357972 GACCCTGGGCATGGGTCCTGGGG - Intergenic
1047227518 8:122969224-122969246 TGACCAGGGGATGGGGCAGGGGG + Intronic
1048503131 8:134996765-134996787 GGCCCAGGGGATGGCTCAGGAGG - Intergenic
1048881794 8:138877674-138877696 AGCCCACGGGAGGGGTCCTCGGG - Intronic
1049476657 8:142800043-142800065 GGCCCAGAGGATGGGTCCTCAGG + Intergenic
1049497506 8:142943278-142943300 TCCCCAGGGGCTGGGCCCTGGGG - Intergenic
1049544272 8:143222086-143222108 TGCTCAGGCGATGGTCCCTGGGG - Intergenic
1049642931 8:143723504-143723526 AGCCCAGGGGCTGTTTCCTGAGG + Intergenic
1051102263 9:13535161-13535183 TCCTCAGGGGCTGGGACCTGCGG + Intergenic
1053315181 9:37045042-37045064 TGCCCACTGGAAGGCTCCTGAGG - Intergenic
1053417950 9:37958629-37958651 TTCCCAGGGGACAGGTCCTGGGG + Intronic
1054453058 9:65413478-65413500 AGCCTGGGGGATGGGCCCTGTGG - Intergenic
1057833772 9:98427814-98427836 AGCCCTGTGGAGGGGTCCTGAGG + Intronic
1057892002 9:98876510-98876532 TGCCAAGTGGGTGGTTCCTGCGG + Intergenic
1058373073 9:104292838-104292860 TGCGCAGGGGAAGGGTCTAGAGG - Intergenic
1059409814 9:114124828-114124850 TGCCCATGGTCTGGGCCCTGGGG - Intergenic
1060993363 9:127861680-127861702 TCCCCAGGGTATGGGTGTTGGGG + Intergenic
1061130582 9:128705743-128705765 TGCCCACGGCCGGGGTCCTGAGG - Exonic
1061212714 9:129203052-129203074 CCCCCAGGGGAGGGGTCCTAGGG - Intergenic
1061396496 9:130346586-130346608 TGCCCTGGGGTTAGGGCCTGTGG - Intronic
1061443496 9:130623636-130623658 TGCCCAGGTCATGGGCCCTCCGG + Exonic
1062425341 9:136503664-136503686 GGGCCTGGGGATGGCTCCTGGGG - Intronic
1062502756 9:136858347-136858369 TGCCCAGGGCTTGGGCCGTGGGG + Intronic
1187887996 X:23907394-23907416 AGCCGAGGGGATGGGTACTTTGG + Intronic
1187953079 X:24489972-24489994 AGCCCAGGGAATGGGTTCTCAGG + Intronic
1190984547 X:55489062-55489084 GGCCGATGGGAGGGGTCCTGGGG - Intronic
1191840790 X:65512472-65512494 TGACCAGGAGCTAGGTCCTGAGG - Intergenic
1192578781 X:72263755-72263777 TGCCCATGTGAGGGGTACTGAGG + Intronic
1195195600 X:102494985-102495007 ATCCCAGGGTATGGGTTCTGGGG - Intergenic
1195292497 X:103442458-103442480 TGTCCAGGAGATGGGACATGAGG + Intergenic
1197776527 X:130121801-130121823 TGCCCAAGGGAAGGGGTCTGGGG + Intergenic
1198827324 X:140713074-140713096 GGGCCAGGGGAGGGGTCCTGAGG + Intergenic
1199713295 X:150487648-150487670 TGGCCAGGTGAGGGGCCCTGGGG - Intronic