ID: 900241752

View in Genome Browser
Species Human (GRCh38)
Location 1:1620633-1620655
Sequence CCCCGGCCTGTGCCATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 172}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900241741_900241752 19 Left 900241741 1:1620591-1620613 CCTCTCACTTGTCCCCCCGCCAG 0: 1
1: 0
2: 1
3: 16
4: 166
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241744_900241752 5 Left 900241744 1:1620605-1620627 CCCCGCCAGCAGACTGCTGCGTC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241740_900241752 20 Left 900241740 1:1620590-1620612 CCCTCTCACTTGTCCCCCCGCCA 0: 1
1: 0
2: 1
3: 16
4: 221
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241739_900241752 21 Left 900241739 1:1620589-1620611 CCCCTCTCACTTGTCCCCCCGCC 0: 1
1: 0
2: 0
3: 21
4: 313
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241745_900241752 4 Left 900241745 1:1620606-1620628 CCCGCCAGCAGACTGCTGCGTCG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241743_900241752 6 Left 900241743 1:1620604-1620626 CCCCCGCCAGCAGACTGCTGCGT 0: 1
1: 0
2: 1
3: 4
4: 92
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241746_900241752 3 Left 900241746 1:1620607-1620629 CCGCCAGCAGACTGCTGCGTCGG 0: 1
1: 0
2: 1
3: 15
4: 156
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241748_900241752 0 Left 900241748 1:1620610-1620632 CCAGCAGACTGCTGCGTCGGCCT 0: 1
1: 0
2: 1
3: 1
4: 93
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172
900241742_900241752 7 Left 900241742 1:1620603-1620625 CCCCCCGCCAGCAGACTGCTGCG 0: 1
1: 0
2: 2
3: 18
4: 131
Right 900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900241752 Original CRISPR CCCCGGCCTGTGCCATTCTG TGG Intronic
900156835 1:1206556-1206578 CCCCGTGCTGTGCCATGCTCGGG + Exonic
900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG + Intronic
901680469 1:10910044-10910066 CCCAGCCCTGAGCCCTTCTGGGG + Intergenic
902512705 1:16974955-16974977 CAGCGGCCTGTGCCAATCCGTGG - Exonic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906061492 1:42952047-42952069 CCCCTGCCTGCCCCATGCTGTGG - Intronic
907288522 1:53397453-53397475 CCCAGGCCTGTACCCTTCTAGGG + Intergenic
908394252 1:63710994-63711016 CCCCAGCCTCTGTCATTCTGTGG - Intergenic
911785783 1:101944897-101944919 CCTGGGCATGTGCCATTGTGAGG + Intronic
912796303 1:112695596-112695618 CCCCGGCATTTGCCATTCTTTGG - Intronic
914248961 1:145906491-145906513 CCCAGGCCTGTGCCCCTCTCTGG - Exonic
919919707 1:202160733-202160755 CTCCCGCCTGTGCCCTTCTGGGG + Exonic
922870135 1:228896028-228896050 CCCCTGCCTGCCCCATGCTGTGG + Intergenic
923193666 1:231643832-231643854 CCTCGGCCAGTACCATTGTGTGG - Intronic
923515628 1:234695717-234695739 GACCTGCCTGTGCCATCCTGGGG + Intergenic
924243885 1:242063076-242063098 CCCAGTCCTGTGCCATGCAGGGG - Intergenic
924744275 1:246818123-246818145 CAGCGGCCTGTGCCAATCCGTGG + Intergenic
1063159556 10:3409244-3409266 CACCGGCCTTTGCAATGCTGAGG - Intergenic
1066493253 10:35915496-35915518 TCCAGCCCTGTGCAATTCTGTGG - Intergenic
1067083715 10:43227450-43227472 CCCTGGCCTGTGCCCCGCTGAGG + Intronic
1067374113 10:45711632-45711654 CACCGGCCCCTGCCACTCTGAGG - Intergenic
1067379573 10:45760630-45760652 CACCGGCCCCTGCCACTCTGAGG + Intronic
1067881946 10:50053386-50053408 CACCGGCCCCTGCCACTCTGAGG - Intergenic
1067887270 10:50101287-50101309 CACCGGCCCCTGCCACTCTGAGG + Intronic
1068326825 10:55501144-55501166 TCCCTGCCTCTGCCATTATGTGG - Intronic
1069823304 10:71240461-71240483 CCACGGCCTGTGCCTATCAGAGG - Intronic
1070630122 10:78078658-78078680 TCCCTCCCTGTTCCATTCTGTGG + Intergenic
1071314020 10:84374272-84374294 CCTTGGCCTGTGCTATACTGAGG + Intronic
1073465757 10:103693706-103693728 CCATGGCCTCTGCCATTCTCGGG - Intronic
1074117133 10:110464711-110464733 CCCCTGCCTGTGCCAGCCTGAGG + Intergenic
1074160077 10:110829821-110829843 CCCCTGCCTGTGCCATTCCCAGG + Intronic
1076052961 10:127349768-127349790 CCCCGGTCTTTGGCATTCCGTGG + Intronic
1077320587 11:1939147-1939169 CGCCTGCCTCTGCCTTTCTGGGG - Intergenic
1079773644 11:24496825-24496847 CCCCGCCCCGCGCCATCCTGGGG + Intergenic
1084538813 11:69774407-69774429 CCCCGGCCTGGCCCAGGCTGGGG - Intronic
1088849073 11:113690667-113690689 CCCCTGCTTGGGCCTTTCTGGGG - Intronic
1094635875 12:32226947-32226969 CCCTGGTCTGTGCCAAGCTGTGG - Intronic
1094871324 12:34600743-34600765 CACGGGCCTGTGACATTCTGTGG - Intergenic
1096258937 12:50078989-50079011 CCCTGGCCTGGGGCAGTCTGGGG + Intronic
1097779030 12:63682235-63682257 CCCCTCCCTGGGCCTTTCTGAGG - Intergenic
1100765177 12:97856240-97856262 CCCACTCCTGTACCATTCTGTGG + Intergenic
1102656510 12:114486374-114486396 CACTGGCCTGTTCCTTTCTGTGG + Intergenic
1102963806 12:117111408-117111430 TCCCGGTCTGTGCCCTTTTGTGG - Intergenic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104582024 12:130017763-130017785 CCCAGGCTTGTGTCATTCCGCGG - Intergenic
1106028229 13:25975040-25975062 CCCCACGCTGTGCCCTTCTGTGG + Intronic
1106176843 13:27338996-27339018 CCACTGTCTGTGCCATTCAGTGG + Intergenic
1108826214 13:54415819-54415841 CCCCTGCCTGTGCCTTGCTTGGG + Intergenic
1114522399 14:23347608-23347630 CCCTGGCCTGTGTCTTCCTGGGG - Exonic
1116136401 14:40929324-40929346 CCCTGTCTTGTGCCATTCAGGGG + Intergenic
1121336212 14:93078937-93078959 CACCGGCCTTTCCCATTGTGCGG - Intronic
1123701715 15:22918912-22918934 CCCCGGCATGTGCCAGGCAGAGG - Intronic
1123998509 15:25735049-25735071 CCACTGCCTGGGCCATTCAGCGG + Intronic
1124992852 15:34692932-34692954 GCTCTGCCTGTGCCTTTCTGTGG - Intergenic
1127793072 15:62415580-62415602 CCCCTGCTTGCCCCATTCTGGGG + Intronic
1128080917 15:64856443-64856465 CCTCTGCCTGTGCTGTTCTGTGG + Intronic
1128245714 15:66131315-66131337 CCCGGGCCTGGGCCGTGCTGTGG + Intronic
1128340733 15:66821041-66821063 CGCCTGCCTGTGCCATCTTGAGG + Intergenic
1129069509 15:72939004-72939026 CCCCAGCGTCTGCCATTCTTTGG - Intergenic
1133023396 16:2976785-2976807 CCCCGGCGGGTGTCATTCCGGGG - Exonic
1138605360 16:58085097-58085119 CCCAGGGCTGAGCCAGTCTGGGG - Intergenic
1140210977 16:72969969-72969991 CCACGGCCTGGGCGATTCTCTGG - Intronic
1140235880 16:73158176-73158198 CCCCGGCATTTACCACTCTGGGG + Intergenic
1141395341 16:83699559-83699581 CTCCTGCCTGTGCCAGCCTGTGG + Intronic
1142174976 16:88640951-88640973 CCCAGGCCTGTGACAGTCTCAGG + Intergenic
1142305939 16:89285699-89285721 CTCCCTCCTCTGCCATTCTGGGG - Intronic
1142709444 17:1715458-1715480 CCCCAGCCTGTCCGATTGTGAGG - Intergenic
1142984980 17:3690205-3690227 CCCAGGCCTGGGCCAGTGTGAGG + Intronic
1143010194 17:3861948-3861970 CCTTGGCCTGACCCATTCTGTGG - Intronic
1143106895 17:4534573-4534595 TCCCGGGCTGTCCCATGCTGGGG - Intronic
1144234000 17:13239016-13239038 CACCCACCTTTGCCATTCTGAGG - Intergenic
1147337885 17:39738196-39738218 CCCCAGGCTGTGCCAGTCTCCGG + Intronic
1147726207 17:42567429-42567451 CCCTAGCCTGTGCCAGTCTCGGG + Intronic
1148216493 17:45836426-45836448 CCCTGGCCAGTGCCGCTCTGAGG + Intergenic
1151362495 17:73596944-73596966 CCCCGGCCATTTCCATTCTGGGG + Intronic
1151669230 17:75562940-75562962 CCCATGGCTGTGCCATGCTGGGG + Intronic
1155542088 18:26879270-26879292 CCCCTGCCTTTGCCATACTGAGG + Intergenic
1155671647 18:28378701-28378723 ACCTGGCCTGTGTTATTCTGAGG - Intergenic
1158514970 18:58123388-58123410 TCCCGGGCTTTGCCAATCTGTGG + Intronic
1160298046 18:77655574-77655596 CCCAGGCATGCGCCATGCTGTGG - Intergenic
1160767619 19:815405-815427 CCGGGGCCTGTGCCAGCCTGTGG - Intronic
1160767642 19:815475-815497 CCGGGGCCTGTGCCAGCCTGTGG - Intronic
1160767657 19:815534-815556 CCGGGGCCTGTGCCAGCCTGTGG - Intronic
1160767686 19:815630-815652 CCGGGGCCTGTGCCAGCCTGTGG - Intronic
1160884000 19:1336391-1336413 CCCCGGCCTGTGCTGAGCTGGGG - Intergenic
1161718769 19:5892073-5892095 CCCCCTCGTGTTCCATTCTGGGG + Exonic
1162367190 19:10256765-10256787 GCCCGCCCAGTGCCTTTCTGCGG - Exonic
1162959405 19:14117354-14117376 CCCCGGCCTGTCCAAGGCTGGGG - Intronic
1164595266 19:29527744-29527766 CCCCGCCCTCTGCCACTTTGAGG + Intronic
1164834443 19:31348857-31348879 CCCCGGCCTGGCTCTTTCTGTGG - Intronic
1165327798 19:35124455-35124477 CCCCGCCCTGTGCCGTTCACAGG + Intergenic
1166049487 19:40249473-40249495 CCCAGCCCTGGGCCATCCTGCGG + Intronic
1167307406 19:48716940-48716962 CGCGGGCCAGCGCCATTCTGGGG + Intronic
925160183 2:1678053-1678075 ACCCGGGCTGTGCAATGCTGGGG - Intronic
925285902 2:2715578-2715600 CCACGGACTGTGCCAATGTGGGG + Intergenic
927708968 2:25313633-25313655 CCCAGGTCTGTGCCATTGTGAGG - Intronic
932002830 2:67900199-67900221 GCCCCGCCTGTGCCTTTCTATGG - Intergenic
932435844 2:71702225-71702247 CACCAGCCTCTGCTATTCTGGGG - Intergenic
934748014 2:96772228-96772250 CGCCTGCCTGTGCCTTTGTGGGG - Intronic
934748114 2:96772931-96772953 CACCTGCCTGTGCCTTTGTGGGG - Intronic
937988849 2:127651181-127651203 ACCTGGCCTGTGCCTTCCTGTGG + Exonic
938209610 2:129456893-129456915 CCCAGGGCTGGGTCATTCTGTGG - Intergenic
938324293 2:130387846-130387868 CCCTGGCGTGTGCACTTCTGGGG - Intergenic
939043598 2:137222924-137222946 CCCTGGCCTCTCTCATTCTGTGG + Intronic
940840333 2:158572641-158572663 CCCAGGCCTGTCCTCTTCTGTGG - Intronic
942566047 2:177265173-177265195 CCCCGGCTGGCGCCATTCTCGGG - Intronic
948051386 2:234982009-234982031 CCACTGCCTGTGCCAGTCAGAGG - Intronic
948856783 2:240733972-240733994 CCCCTGCCCGTGCCAGCCTGGGG - Intronic
948909712 2:240996928-240996950 CCACGGCCTGTGCCAGCCAGAGG + Intergenic
948922788 2:241073555-241073577 CCCTGGCCTGTTCCCGTCTGTGG - Intronic
1169062105 20:2668303-2668325 CCCTGGCCTATGCCATGCAGGGG - Intergenic
1172095978 20:32460729-32460751 GCCCAGCCTGTGACAGTCTGAGG + Intronic
1175137219 20:56833221-56833243 CCCCGGGGTGTGCAATACTGGGG - Intergenic
1175216817 20:57395642-57395664 CCCCTGCCTGGGCCTTACTGAGG + Intronic
1175368204 20:58469820-58469842 TCCAGGCCAGTCCCATTCTGGGG - Intronic
1175527563 20:59646064-59646086 CCCCAGCCCCTGCGATTCTGAGG + Intronic
1176268744 20:64224284-64224306 CCCTGGCTTATTCCATTCTGGGG + Intronic
1178406263 21:32325703-32325725 CCCAGGCCTCTGGCATGCTGGGG - Intronic
1179043941 21:37829026-37829048 CCAGGGCCTGTGCCATCCTGGGG + Intronic
1179088431 21:38241449-38241471 CCCAGGCCTCTGCCATTCGCCGG - Intronic
1179719336 21:43306476-43306498 CCCCGGGCTGTGCCTGCCTGGGG - Intergenic
1180160840 21:45998047-45998069 CCCGGGCCTGTGCCAGCCAGTGG + Intronic
1180878141 22:19184862-19184884 CCCCGGCCCATGCCACTCTCAGG + Intronic
1180885374 22:19239805-19239827 CTCAGGCCTGTGCCATGGTGAGG - Intronic
1184415606 22:44350268-44350290 CCCCTTCCTTTGCCTTTCTGGGG - Intergenic
1184504695 22:44893663-44893685 ACCCACCCTGGGCCATTCTGTGG - Intronic
1184639928 22:45865273-45865295 CCCCTGCCTCTGACATCCTGCGG - Intergenic
1184837036 22:47029869-47029891 CCCCGGCCCAGGCCACTCTGGGG - Intronic
1185302867 22:50091771-50091793 CCACTACCTGTGCCCTTCTGAGG + Intronic
950230643 3:11272631-11272653 CCCCGGACTGAACCAGTCTGAGG - Intronic
950345219 3:12287563-12287585 CCCCGGCCAGGGCCGGTCTGGGG - Intronic
950484934 3:13267564-13267586 CCCAGCCCTGTGCCCTTCTGGGG + Intergenic
953031622 3:39183688-39183710 CCCACGCCTGTGCAACTCTGTGG + Exonic
953150705 3:40321990-40322012 GCCAGTCCTGTGCCCTTCTGTGG - Intergenic
953551491 3:43907053-43907075 CCCCGGCCTGTCCCTTCCTCTGG + Intergenic
954572785 3:51656047-51656069 CCCCGGCATGTCCCATTGGGAGG + Exonic
954644403 3:52122125-52122147 CCCAGGCCTGTGCCATTTGGTGG - Intronic
956098718 3:65745310-65745332 CCACTCCCTGTGCCATTCTGGGG - Intronic
960134559 3:114092102-114092124 GCCGGGCCTGTGCCCTTCTAGGG + Intergenic
961650091 3:128412965-128412987 CCCCTGCCTGTGCCCTTGTGGGG - Intergenic
961676072 3:128567554-128567576 CCCCTGCCCGTTCCATGCTGCGG + Intergenic
961924541 3:130463626-130463648 CCCCTTCCTCTGCCATTCTAAGG + Intronic
962771121 3:138611016-138611038 CTCCGGACTCTGCCACTCTGAGG + Exonic
966865543 3:184257301-184257323 CCCAGGCCTGTGCGATTCCAAGG + Intronic
968093101 3:195909903-195909925 GCCCGGCCTGCGCCTTCCTGCGG + Intronic
968607909 4:1544176-1544198 CCCCGGCAACTCCCATTCTGTGG + Intergenic
968915831 4:3496709-3496731 CCCCAGCCTGTGTCACTCTTGGG + Intronic
974964468 4:68744485-68744507 CCCTGGCTTGTGGCACTCTGGGG - Intergenic
976305808 4:83558355-83558377 CCTCTGCCTCTGTCATTCTGTGG - Intronic
981746257 4:148055275-148055297 CCTCAGCCTGTGCGATCCTGAGG - Intronic
984823551 4:183905459-183905481 CCCCGGCGTGTGCGGTTGTGGGG + Exonic
985647126 5:1090236-1090258 CCCCAGCCTTGGCCAGTCTGTGG - Intronic
986518311 5:8586636-8586658 CCCCGGGATGTGCCATCCTCAGG + Intergenic
986741631 5:10710356-10710378 CCTCTGCCAGGGCCATTCTGTGG - Intronic
997409590 5:133680945-133680967 CCCAGACCTGTGGGATTCTGGGG + Intergenic
997432289 5:133848746-133848768 CCCCTGACTGTGCCTATCTGTGG - Intergenic
998159199 5:139803648-139803670 TCCCGGACTGTCCCAGTCTGAGG + Intronic
1003169627 6:3710860-3710882 CCAGGGCCTGTGCGTTTCTGAGG - Intergenic
1004134319 6:12951716-12951738 CCATGGCCTGTGCAAGTCTGAGG + Intronic
1004324712 6:14664499-14664521 GCCTGGCCTGTGCCACACTGGGG + Intergenic
1006385290 6:33727312-33727334 CCCACTCCTGTGCCCTTCTGAGG - Intronic
1006643051 6:35498153-35498175 CCTCGGCCTGTGCCAGGCTGGGG + Exonic
1006735577 6:36270435-36270457 CCTCGGCCTCTGACTTTCTGCGG - Intronic
1009177025 6:60472919-60472941 CTCGGGCCTCTGCCATTCTATGG + Intergenic
1012474472 6:99604786-99604808 CCCCGGCTTTTGCCATTCATGGG + Intergenic
1017017771 6:150115812-150115834 CCCCGGCGAGTGCCATTGAGAGG - Intergenic
1018924877 6:168199012-168199034 CCCCGCCCTGAGACATTCTGGGG + Intergenic
1019132846 6:169890187-169890209 GCGCTGCCTGTGCCATGCTGGGG - Intergenic
1020104108 7:5413223-5413245 CCCCGGCATGAACCAGTCTGTGG - Intronic
1022937951 7:35199878-35199900 CCCCTCCCTGGGCCTTTCTGAGG - Intergenic
1025158174 7:56629243-56629265 CCCTGGTCTGTCCCATTCTGTGG - Intergenic
1025757528 7:64358787-64358809 CCCTGGTCTGTCCCATCCTGTGG + Intergenic
1035953012 8:4044833-4044855 CCCAGGCTTGTACCATGCTGGGG + Intronic
1036604287 8:10292618-10292640 GCCCGGCCACTGCGATTCTGTGG - Intronic
1037465230 8:19153199-19153221 CCCCAGCATGTCCCATTCTATGG - Intergenic
1038120110 8:24603634-24603656 CCCTGGCTTGTGCCACTCTCAGG - Intergenic
1048875644 8:138835167-138835189 CCCTGCCCTTTGCCATCCTGAGG + Intronic
1048971110 8:139645388-139645410 CCCCTCCCTGGGCCATGCTGAGG - Intronic
1049610379 8:143552487-143552509 CCCCATCCTGTCCCCTTCTGGGG - Intergenic
1049641424 8:143717689-143717711 CCCAGGCCTATGGCATTGTGTGG + Exonic
1057917073 9:99065245-99065267 CCCCTGCCTGTGCCTTTCTTAGG + Intronic
1060188328 9:121577206-121577228 CCCCAGCCAGTGGGATTCTGGGG + Intronic
1060831954 9:126722714-126722736 GCCCGGCCTGTGCCCTACTCTGG - Intergenic
1061372874 9:130207690-130207712 CCCTGGCCTGTGCTCTCCTGGGG - Intronic
1061853483 9:133429212-133429234 CCCCGTGCTGTCCCACTCTGCGG + Intronic
1061971860 9:134049433-134049455 CTCCGGCCCCTGCCAGTCTGAGG - Intronic
1062019882 9:134314237-134314259 CCCCGGCCTGTGCCTTTGCCAGG - Intergenic
1062342552 9:136100249-136100271 CCCCGCTCTGTGCCAGCCTGAGG + Intergenic
1062344467 9:136108548-136108570 CCCAGGCCTGTCCCATCCCGAGG + Intergenic
1185790744 X:2927088-2927110 CCCCGTCCTGTCCCCTTCCGCGG - Intronic
1190703560 X:53006331-53006353 CCCATGGCTGTGCCATTCTGGGG + Intergenic
1200938109 Y:8756088-8756110 GCCCTGCCTGTGCCATTAGGTGG - Intergenic
1201074852 Y:10179118-10179140 CCCCGGACTGTGCTGTTCTTGGG + Intergenic