ID: 900242448

View in Genome Browser
Species Human (GRCh38)
Location 1:1623524-1623546
Sequence CGCCCTCGCCGCCGTCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900242448_900242454 -5 Left 900242448 1:1623524-1623546 CCAGCAGGACGGCGGCGAGGGCG 0: 1
1: 0
2: 0
3: 20
4: 180
Right 900242454 1:1623542-1623564 GGGCGGCGTGGGCACGGTGGTGG 0: 1
1: 0
2: 2
3: 35
4: 459
900242448_900242453 -8 Left 900242448 1:1623524-1623546 CCAGCAGGACGGCGGCGAGGGCG 0: 1
1: 0
2: 0
3: 20
4: 180
Right 900242453 1:1623539-1623561 CGAGGGCGGCGTGGGCACGGTGG 0: 1
1: 0
2: 0
3: 34
4: 336
900242448_900242456 11 Left 900242448 1:1623524-1623546 CCAGCAGGACGGCGGCGAGGGCG 0: 1
1: 0
2: 0
3: 20
4: 180
Right 900242456 1:1623558-1623580 GTGGTGGAGCTTGGCCGCCACGG 0: 1
1: 0
2: 1
3: 23
4: 153
900242448_900242455 2 Left 900242448 1:1623524-1623546 CCAGCAGGACGGCGGCGAGGGCG 0: 1
1: 0
2: 0
3: 20
4: 180
Right 900242455 1:1623549-1623571 GTGGGCACGGTGGTGGAGCTTGG 0: 1
1: 0
2: 2
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900242448 Original CRISPR CGCCCTCGCCGCCGTCCTGC TGG (reversed) Exonic
900156884 1:1206731-1206753 CGCCCCTGCCGGCGACCTGCGGG - Intergenic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
901016668 1:6235842-6235864 CAGCCTCGCCACCTTCCTGCTGG - Exonic
901721801 1:11204593-11204615 CGCCCTCCCTGCGCTCCTGCTGG - Exonic
903785633 1:25859377-25859399 AGCCTGCGCCGGCGTCCTGCCGG - Exonic
904086665 1:27914277-27914299 CTTCCTCGCCGCCTTCCTGCGGG + Intronic
904319799 1:29689476-29689498 TGCCCTCCCAGCCCTCCTGCTGG + Intergenic
904942783 1:34176949-34176971 CACCCTCGCCGTCGTCGAGCGGG - Intronic
905894756 1:41538291-41538313 TGCCCTCGCCTCTGTCCAGCTGG - Intronic
912500947 1:110121548-110121570 GGCCCTTGGAGCCGTCCTGCTGG + Intergenic
914713456 1:150235381-150235403 CGCCCACGCCGCCGGCCCCCAGG + Intronic
915467592 1:156106503-156106525 GGCCCTCGCTGCCCGCCTGCGGG + Intronic
916961476 1:169893787-169893809 CTCCCCCGCCGCCTTCCTGCAGG - Exonic
919847027 1:201648757-201648779 CGCCGCTGCCGCCTTCCTGCCGG - Exonic
924740652 1:246792748-246792770 AGCCCTCGCGGCCGCCCTGGGGG + Intergenic
924740685 1:246792840-246792862 AGCCCTCGCGGCCGTCCTGGGGG + Intergenic
924740695 1:246792870-246792892 AGCCCTCGCGGCCGTCCTGGGGG + Intergenic
1063639806 10:7818488-7818510 CGCCCCGGCGGCCGTCCAGCGGG + Exonic
1065845035 10:29736717-29736739 CGCCCTCCTCGCCCACCTGCCGG + Intronic
1067318810 10:45198546-45198568 CGCCCTGGCCGCCCTCCCCCGGG + Intergenic
1070559244 10:77553485-77553507 TGCCCTCGCCTCCCTCCTGCTGG + Intronic
1070768385 10:79069177-79069199 CGCCCTCGCTGCGCTCCTCCCGG + Exonic
1071598198 10:86942980-86943002 CGCCTTCGCCGCCCTGCTGGAGG - Exonic
1073578093 10:104641600-104641622 CGCCTCTGCCGCCGCCCTGCTGG - Exonic
1074121733 10:110498346-110498368 CGCCGCCGCCGCCCTCCTGCAGG - Exonic
1074772098 10:116741486-116741508 CGCTCTCGCCGAGGCCCTGCAGG + Intronic
1076888538 10:133273379-133273401 CGCCCTCGCCACCTTCATCCAGG + Exonic
1077076145 11:703099-703121 CGGCCTGGAGGCCGTCCTGCAGG + Exonic
1079217527 11:18526967-18526989 CTTCCGGGCCGCCGTCCTGCGGG + Exonic
1081545183 11:44066568-44066590 TGGATTCGCCGCCGTCCTGCTGG + Exonic
1081872991 11:46391676-46391698 CGCCCGCCCCGCCGGCCCGCGGG - Intergenic
1083454771 11:62771438-62771460 CGCCCCCGCCGCCGTCGTCTCGG + Exonic
1083599662 11:63939034-63939056 CGCCGTTGCCGCCTCCCTGCCGG + Exonic
1083726319 11:64630386-64630408 GGCCCGCGCCGCCTACCTGCCGG + Exonic
1083741419 11:64713474-64713496 CGCAGTCGCCGCCGTCGTCCAGG + Exonic
1084021344 11:66420068-66420090 CGCCCCCGCCCCCGGCCCGCGGG + Intergenic
1084952995 11:72677004-72677026 TGCCCGCCCCGCCGCCCTGCCGG + Intergenic
1085784881 11:79440331-79440353 CGCCCTAGCCTCCCTCCTCCTGG + Intronic
1089526587 11:119101146-119101168 CCCCCTCGCCCCCTTGCTGCTGG - Intronic
1091718345 12:2795354-2795376 CAGCCTCGCGGCCGTCCCGCCGG + Intronic
1093736433 12:22625385-22625407 CGCCGTCGCCGTCGTCGTGGTGG + Exonic
1102302792 12:111783184-111783206 CGCCCGGGCCGCCTTCCAGCTGG + Exonic
1102437758 12:112938632-112938654 CGCCCTGGCCGCTGCCCTGAGGG + Exonic
1105775816 13:23659132-23659154 CGCTCTGGCCACCGTCCTGCTGG + Exonic
1106247396 13:27961385-27961407 CCCCCTCGCCCGGGTCCTGCCGG + Intergenic
1107951345 13:45465020-45465042 CGCCATCGCCGCCGCCCTCGCGG - Exonic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1115474488 14:33800386-33800408 CCCCACCGCCGCCGCCCTGCGGG - Exonic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1118925702 14:70188531-70188553 CGCCGCCGCCGCCCTCCCGCCGG + Exonic
1122130828 14:99603982-99604004 CGCCCTCGCCCTCGCCCGGCCGG + Exonic
1122854742 14:104554684-104554706 CAGCCTCGCTGCCCTCCTGCAGG + Intronic
1122904584 14:104795835-104795857 CGCCCTCGCCGCCGGCCGCGCGG - Intergenic
1123168520 14:106349219-106349241 CGCCCCCTCCGCCTCCCTGCAGG + Intergenic
1123463492 15:20495687-20495709 TGCCCTGGCTGCCGTGCTGCAGG - Intergenic
1123654569 15:22504730-22504752 TGCCCTGGCTGCCGTGCTGCAGG + Intergenic
1123691101 15:22838794-22838816 CGCCTTCGTCGCCGTCCAGTGGG - Exonic
1124274334 15:28313095-28313117 TGCCCTGGCTGCCGTGCTGCAGG - Intronic
1124308480 15:28599927-28599949 TGCCCTGGCTGCCGTGCTGCAGG + Intergenic
1126467707 15:48975969-48975991 CGCTCTCCCCGCCGCCCGGCCGG - Intergenic
1126849734 15:52789692-52789714 CGCCGCTGCCGCCGTCCAGCAGG + Exonic
1128124718 15:65184451-65184473 CTCTCCCGCCGCTGTCCTGCGGG + Intronic
1132365190 15:101251771-101251793 CGCCGTCGTCGCCGTCGTGCCGG - Exonic
1132523392 16:401761-401783 CGCCCCCGCCCGCGGCCTGCTGG - Intronic
1132544791 16:528093-528115 CGCGCTCCCCGCCGCCCTCCGGG - Intronic
1132837093 16:1959609-1959631 CGCGCCCGCCGCCGCCATGCCGG + Exonic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1133234752 16:4382617-4382639 CGCCCTGGCCGCGGTGCTCCTGG + Exonic
1136543511 16:30942361-30942383 CCCCCTCTCCGCAGGCCTGCAGG + Exonic
1137605789 16:49786142-49786164 CGCCCCCGCCTCCGGACTGCAGG + Intronic
1138619176 16:58197955-58197977 CGCCCGCCCCGCCGCCCCGCCGG - Intergenic
1139364503 16:66425675-66425697 CCCACTCCCCGCCCTCCTGCAGG - Intergenic
1141593306 16:85082717-85082739 CGCCCTCCCCGCCGGCCACCAGG - Intronic
1141989684 16:87602773-87602795 CGCCCTCCCCGCGGGGCTGCCGG + Intronic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1143172861 17:4940034-4940056 CGCCCGCGCCGGCTTCCAGCGGG - Exonic
1143223740 17:5282636-5282658 CGCCCCCGCCTCCGCCCGGCGGG - Intronic
1145810271 17:27760163-27760185 CGGCCTCCCCGCACTCCTGCAGG + Exonic
1146759114 17:35460669-35460691 CGCCCCCGCCCCCGCCCCGCTGG + Intergenic
1148128350 17:45248089-45248111 CGCCCTCGCCTCCGACCCCCAGG - Intergenic
1148581549 17:48747436-48747458 AGCCCGCGCCGCCGTCCAGCGGG + Intergenic
1149651683 17:58279918-58279940 GGCCCTCACCGCCGTCCTGGTGG + Exonic
1151450737 17:74196877-74196899 CGCCCTCCTCTCCCTCCTGCAGG + Intergenic
1151703157 17:75753904-75753926 CGCCCGCGCCGCCGTCGTCCGGG - Exonic
1151766873 17:76137382-76137404 CACCCTGGCCTCCGACCTGCAGG - Exonic
1152079002 17:78175009-78175031 CCCCCACCCCGCCGGCCTGCAGG + Intronic
1152424273 17:80210496-80210518 CGCCCCCGACGGCGTCCTGGAGG - Exonic
1152625565 17:81386647-81386669 GGCACTTGCCGCCGCCCTGCAGG - Intergenic
1153935245 18:9914657-9914679 CGCCCGCGCCGCGGTCCGCCTGG + Intronic
1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG + Exonic
1158543852 18:58379279-58379301 CGCCCTGGCCCCCGTCATGAGGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160826555 19:1082941-1082963 CGCTCTCCGAGCCGTCCTGCCGG - Exonic
1160930600 19:1568019-1568041 CGCCCCCGCCGCCGTCGGGCTGG + Exonic
1160957590 19:1700554-1700576 GGCCCCCGCCGCCGGCCCGCAGG + Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161124795 19:2549769-2549791 CGCCCTCACCCCCGGCCTGCTGG - Intronic
1161354198 19:3810160-3810182 CGGCCTCCCCCCCGCCCTGCGGG - Intronic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
1163051841 19:14690163-14690185 CGCCCTCCCCGCCCTCCCGAGGG - Intronic
1163607275 19:18281991-18282013 CGCCCCCGCCCCCGCCCGGCCGG - Intergenic
1163749212 19:19065242-19065264 CCCCCTCTCCGGCATCCTGCAGG - Intronic
1166304235 19:41928548-41928570 CGCCCTCGCGGCCGCCCGGCCGG + Intronic
1166852756 19:45768361-45768383 CGCCCACCACGCCTTCCTGCAGG - Exonic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167072323 19:47228212-47228234 CGCCGTCACCGCCGCCCTGGGGG - Exonic
1167762940 19:51460790-51460812 CGCCCTCCTTGCCGTCCAGCAGG - Intergenic
1168316379 19:55486521-55486543 CGCCCTGGCCCTCCTCCTGCCGG + Exonic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
929133736 2:38603005-38603027 CGCCTTCGCGGCCGTCGCGCAGG + Intronic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
931241871 2:60461267-60461289 CGCCCTGCCCGACGTCATGCAGG - Exonic
932042987 2:68319544-68319566 CGCCGTCGCCGCCGTCCGCCCGG + Exonic
933816653 2:86074086-86074108 CGTTCTCACCGCCGTCCTGAGGG - Intronic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
936257925 2:110933609-110933631 TGCACTCGCGGCAGTCCTGCAGG - Exonic
937221574 2:120345555-120345577 CGTCCTCGCCGCGGGCCGGCGGG - Intergenic
937957337 2:127428739-127428761 CGCCCTCGCAGGCATCCTGCCGG - Exonic
942046146 2:172100572-172100594 CGCCCCCGCCGCCGTGATGGTGG + Exonic
947621461 2:231593785-231593807 AGCCCTCGCCCCTGTCCAGCAGG - Exonic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
949032545 2:241803932-241803954 TGAGCGCGCCGCCGTCCTGCAGG - Exonic
1169081569 20:2800533-2800555 CGCCCTGGCCGCCTTCGCGCCGG - Exonic
1169195521 20:3680392-3680414 AGCCCTGGCCTCAGTCCTGCTGG + Intronic
1170804470 20:19617624-19617646 AGCCCAAGCCGCCCTCCTGCAGG - Intronic
1171974848 20:31587902-31587924 CGCCCTCGCCCCCGCCCGCCGGG + Intergenic
1173609390 20:44355698-44355720 CGCACTCACCGCCTTCCTGGTGG + Intronic
1175284866 20:57831201-57831223 CGCCCTCACTGCCGTCTTACAGG - Intergenic
1176242984 20:64083645-64083667 CGCGCGCGCCGCCATCCGGCTGG - Exonic
1176286171 21:5020657-5020679 CCCCCTCTCCGCAGTCCCGCGGG + Intergenic
1176998220 21:15580620-15580642 CTCCTTCACCGCTGTCCTGCAGG - Intergenic
1179729185 21:43358199-43358221 GGGCCTCGCCGCCCTCCTCCTGG + Intergenic
1179871010 21:44242818-44242840 CCCCCTCTCCGCAGTCCCGCGGG - Intergenic
1180179666 21:46112298-46112320 TGCCCTTGCTGCGGTCCTGCCGG - Exonic
1180866323 22:19122033-19122055 CACCCGCGGCGCCCTCCTGCAGG - Intronic
1180944182 22:19680630-19680652 CGCCCTCTCCCCCTCCCTGCTGG + Intergenic
1182435531 22:30327117-30327139 AGCCCTCCCCGCCCTCCTCCGGG + Intergenic
1183264453 22:36816808-36816830 CGACCTCGCCGGCGCCCAGCGGG + Intronic
1183486437 22:38089581-38089603 CGCCCACTCCCCCGGCCTGCTGG - Exonic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1184788271 22:46682516-46682538 CGCCCTCGTCGCAGTCCCGAGGG - Intergenic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
1185398743 22:50605336-50605358 CTCCCCCGCCTCTGTCCTGCCGG + Intronic
1185413462 22:50697687-50697709 CGGCCTCGCCGCGGTGCAGCGGG - Intergenic
950043152 3:9933140-9933162 CCACCACGCCGCCCTCCTGCAGG - Exonic
950610627 3:14124643-14124665 CGCCCTCCCTACCTTCCTGCCGG + Exonic
957947988 3:87089098-87089120 CGCCCGCGCCCCCGTACTCCGGG - Intergenic
960269454 3:115658537-115658559 CGGGCTCGCGGCCGTGCTGCGGG + Intronic
961460481 3:127046895-127046917 CGCCTTAGCTGCCTTCCTGCGGG + Intergenic
962520983 3:136196896-136196918 CGCCCTCGCGGCCTTTCTCCTGG + Intronic
963870251 3:150408570-150408592 CGCCGTCGCCGCCCGCCCGCAGG + Exonic
966808556 3:183824879-183824901 TGCCCTCGCAGCCGCCCTCCTGG - Intronic
967979056 3:195054565-195054587 CACCCTCTCCCCAGTCCTGCAGG - Intergenic
968597222 4:1491763-1491785 CCCCCTGACCGCCGTCCTCCTGG + Intergenic
969082329 4:4628338-4628360 AGCCCTCCCTGCCCTCCTGCTGG + Intergenic
969532379 4:7737047-7737069 CGCCCTTGCCTCTGTCCAGCAGG + Exonic
979278237 4:118836393-118836415 CGCGCTCCCCTCCTTCCTGCGGG - Intronic
986320965 5:6632800-6632822 CCCCCTCGCCGCCGCCTCGCAGG + Intronic
987258292 5:16179581-16179603 TGCCGCCGCCGCCCTCCTGCCGG + Exonic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
991711769 5:69415357-69415379 CGGCCGAGCCGCCGTCCTTCCGG + Intronic
998166660 5:139848250-139848272 GGGCCCCGCCGACGTCCTGCGGG + Exonic
999768062 5:154755661-154755683 CGCCCGCGACGCCTTCCTCCGGG - Intronic
1002487731 5:179550922-179550944 CGCCCGCGCCGGCGGCCAGCGGG - Intronic
1002578847 5:180195021-180195043 CGCCCTGGTCGCCATCCTGCAGG - Intronic
1003421280 6:5960565-5960587 AGCCCTTGCCCCCGTCCTGTTGG - Intergenic
1006617963 6:35342640-35342662 CGCCACCGCCGCCGTCCCGCAGG - Exonic
1008673386 6:53795231-53795253 CGCCCCCGCCGCCGCCTAGCCGG - Exonic
1010209908 6:73354381-73354403 CGCCCTGGCTGCGGTCCAGCAGG + Intergenic
1017852219 6:158314547-158314569 CGCCCTGGCCTCCCTACTGCTGG - Intronic
1017962095 6:159232248-159232270 GGCCCTCACTGCAGTCCTGCCGG - Exonic
1019058140 6:169237323-169237345 GGCTCCAGCCGCCGTCCTGCCGG + Exonic
1020071213 7:5228170-5228192 CACACTCGCCGCCCTCCTGGGGG - Exonic
1020130650 7:5556770-5556792 CTCCCTCGCCGGCGTCTTCCGGG - Intronic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1029480968 7:100812746-100812768 CGCCCTGGACTCCTTCCTGCGGG - Exonic
1029715073 7:102321323-102321345 CGCCCGCGTCCCCGGCCTGCTGG + Exonic
1029736847 7:102469814-102469836 CGCCCTCGCAGCCGGCCAGCAGG - Exonic
1032344357 7:131105940-131105962 CGCGCCCGCCGCCGCCCGGCCGG - Intergenic
1035160982 7:156949822-156949844 GGGCCGCGCCGCGGTCCTGCTGG + Exonic
1035432169 7:158830046-158830068 CGCCCTCTCACCCGTCCTCCTGG - Intronic
1036476229 8:9095923-9095945 AGCCCTCGCCGCCTAGCTGCAGG + Intronic
1036560751 8:9898762-9898784 CGCCCTCCCGGCCGTGCAGCCGG - Intergenic
1036754069 8:11460981-11461003 CGCGCTCCCAGCCTTCCTGCAGG - Intronic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1043504992 8:80893832-80893854 CGTCCTCGCCTCCTTCCCGCCGG + Intergenic
1044549461 8:93495924-93495946 CGCGCTCGCCCCCGCTCTGCCGG + Intergenic
1048550372 8:135427980-135428002 CGCCCTCCCCACCTTCCTCCCGG + Intergenic
1049284143 8:141765447-141765469 CCACCTCGCCTCCATCCTGCAGG - Intergenic
1057207875 9:93184340-93184362 CGCCCTGGCCGCCGGGCCGCGGG + Intergenic
1058005145 9:99906584-99906606 CGCCCCCGCCCCCGCCCCGCAGG - Intergenic
1059541364 9:115133548-115133570 TGCCCTCACCACCTTCCTGCCGG + Intergenic
1060106485 9:120876458-120876480 AGCCCCCGCCTCCGTCCTCCCGG + Intronic
1060194712 9:121616183-121616205 CTCCCTCGCCTGCATCCTGCAGG - Intronic
1060987559 9:127828462-127828484 CGGCCGCGCCGCCTTCCTCCTGG - Intronic
1062556652 9:137115873-137115895 TGTCCTCACCCCCGTCCTGCGGG - Intergenic
1186047490 X:5552240-5552262 CGCCTTCTCCGCCGAACTGCGGG + Intergenic
1195716872 X:107826441-107826463 CCCCCTCGCCGCGGCCCTGGAGG + Intronic
1200100221 X:153686457-153686479 CGCCCACCCCGCACTCCTGCTGG + Intronic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic