ID: 900245749

View in Genome Browser
Species Human (GRCh38)
Location 1:1635290-1635312
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 2, 1: 2, 2: 6, 3: 56, 4: 524}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900245742_900245749 0 Left 900245742 1:1635267-1635289 CCTTGTATAAAAACCTGTCGAGT 0: 2
1: 0
2: 0
3: 4
4: 72
Right 900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG 0: 2
1: 2
2: 6
3: 56
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900338988 1:2178946-2178968 GTGCTGGTTCAGCTGGGGATAGG - Intronic
900345196 1:2207192-2207214 CTGCTGGCAGAGCTGGGTCCTGG + Intronic
900381125 1:2384616-2384638 CTGGTGGCGCAGCTGAGGCGGGG - Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900490293 1:2945572-2945594 CTCCTGGCACAGATGTGACTTGG + Intergenic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901066069 1:6495241-6495263 CTGCTGGCACGGATGGTGCCTGG - Intronic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
901219110 1:7572946-7572968 TTTCTGGAAGAGCTGGGGCTGGG - Intronic
901323633 1:8354241-8354263 CTGCTGGCAGAGCACAGGCTAGG + Exonic
901737912 1:11323962-11323984 TGCCTGGCACAGCTGGGGCTGGG + Intergenic
902036037 1:13458793-13458815 CTGATGGGTAAGCTGGGGCTGGG + Intergenic
902288356 1:15421180-15421202 CAGGTGGCAGAGCTGGGGTTTGG + Intronic
902648798 1:17823132-17823154 CTACGGGCATAGCTGGGGCCAGG - Exonic
902687102 1:18085311-18085333 CTGCAGGCTCAGCTGAGGATTGG + Intergenic
902807901 1:18872300-18872322 CTACTGGCCCAGGTGGGTCTGGG + Exonic
902943225 1:19815162-19815184 CAGCTGGCGCCGCTGGGACTTGG + Exonic
902991399 1:20189866-20189888 CTGGTGGCAGAGCTGGAGATAGG - Intronic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903192363 1:21663843-21663865 CTGCTGGCAAGGCTGGGGTTTGG - Intronic
903375171 1:22861223-22861245 CTGCTCACACAGGTGGGTCTGGG + Intronic
904799770 1:33084086-33084108 GTTCTGGCCCAGCTGGGGCTGGG + Exonic
905693625 1:39959995-39960017 CTCCTGGCAGAGCAGGGGATGGG + Intronic
906002968 1:42443122-42443144 ATGCTGGTTCAGCTGGGCCTTGG - Intronic
906513321 1:46423871-46423893 CTGCTGGCCCTGCTGGGGGCTGG + Intergenic
906725348 1:48040304-48040326 ATGTTTGCACAGCTGGGGATGGG + Intergenic
907247152 1:53115620-53115642 CAGTTGGCAGAGCTGGGACTAGG - Intronic
907391433 1:54160816-54160838 CTGCTTCCAAAGCTGGGGCAGGG + Intronic
907481517 1:54748405-54748427 CTGCTGCCGCAGCAGGGCCTAGG - Intergenic
907899463 1:58724659-58724681 CTGCTTGCCCAGCTGTGTCTAGG - Intergenic
908339359 1:63160813-63160835 CTGCTGGCACAGCTTGATCTGGG + Intergenic
909357170 1:74723157-74723179 CTCCTGGCTCAGATGTGGCTGGG - Exonic
910123518 1:83816018-83816040 CTCCATGTACAGCTGGGGCTGGG - Intergenic
911371945 1:97004367-97004389 CTGCATGAATAGCTGGGGCTGGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912977366 1:114342684-114342706 CTGCTGGCACCACTGGCGCTGGG - Intergenic
913018608 1:114764393-114764415 CTGCTTTCACAGCTGGCGTTAGG - Intergenic
913130494 1:115834286-115834308 CCGCTGGGCCAGCTGGGGCTAGG + Intergenic
913562082 1:120031689-120031711 CTGGTGGCAGTGCTGGGCCTAGG + Intronic
913636042 1:120761905-120761927 CTGGTGGCAGTGCTGGGCCTAGG - Intergenic
914282667 1:146191077-146191099 CTGGTGGCAGTGCTGGGCCTAGG + Intronic
914543697 1:148641793-148641815 CTGGTGGCAGTGCTGGGCCTAGG + Intronic
914622924 1:149429216-149429238 CTGGTGGCAGTGCTGGGCCTAGG - Intergenic
915265349 1:154712744-154712766 CTGCTGGCAGAGCTGAGAGTCGG - Intronic
915518486 1:156427950-156427972 GGGCTGGCAGAGCTGAGGCTGGG - Intronic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
915544938 1:156591814-156591836 CTGCGGGCGCTGCTGGGCCTCGG + Exonic
916715450 1:167443347-167443369 GGGCAGGCACACCTGGGGCTGGG - Intronic
917789139 1:178488296-178488318 CTGCTGGTCCAGCCAGGGCTGGG - Intergenic
920047914 1:203145603-203145625 CAGGTGGCAGAGCTGGGACTGGG - Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920999294 1:211026528-211026550 CTGCTGGCGTAGCTGAGGCGGGG - Intronic
922012145 1:221599573-221599595 CAACTGGCACAGCTGGCACTGGG - Intergenic
922291630 1:224213504-224213526 CCACTGGCACCGCTGGGCCTAGG - Intergenic
923445569 1:234067717-234067739 CTGGAGGCTCAGCTCGGGCTAGG - Intronic
923586721 1:235279641-235279663 CTGCTTGCAAAGCTGGCCCTTGG + Intronic
1062901078 10:1147537-1147559 TTGCTGGCACCCCTGGGGGTGGG + Intergenic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1065390267 10:25175457-25175479 CTGCTTGCTCAGCTGGGATTGGG + Exonic
1067288744 10:44926554-44926576 CTGCTGGCTCACCTGGGGCGAGG - Intronic
1068666277 10:59678954-59678976 GTGCTGGCAGAGCTGGGTTTGGG - Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1070736297 10:78865986-78866008 CTGCTGGAACAAGTGGGGCCTGG - Intergenic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1073100959 10:101006474-101006496 TTTCTGGCACACCTGGGGGTGGG - Exonic
1073452362 10:103617466-103617488 CTGCTGCCACCTCTGGGGCCTGG - Intronic
1075135599 10:119782735-119782757 CAGCTGGCAGAGGTGGGGCCTGG + Intronic
1076389479 10:130087830-130087852 CCGGTGGCAGAGCTGGCGCTGGG - Intergenic
1076520506 10:131078111-131078133 CAGCTGGCACCACTGGGGCCAGG - Intergenic
1076636720 10:131885942-131885964 CTCCTGGCCAGGCTGGGGCTGGG - Intergenic
1076945062 10:133640843-133640865 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077295813 11:1825781-1825803 CTGCGGGCAGACCTGGGGCAAGG - Intergenic
1077319641 11:1935500-1935522 CCGCAGGCAAAGCTGGGACTGGG + Intronic
1078081046 11:8204948-8204970 CGGCTGGAACATGTGGGGCTGGG + Intergenic
1078847129 11:15128524-15128546 TTACTGGCAGAGCTGGGGCTAGG + Intronic
1079135766 11:17775300-17775322 CTGCTGGCACCACTGGGGGCTGG - Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080396862 11:31898269-31898291 CTGCTTGCTCAGCTGGGTGTAGG + Intronic
1080690221 11:34550002-34550024 CTGCAGGAGCAGCTGGGGATTGG + Intergenic
1080884115 11:36349739-36349761 CTGCTGGCTGAGATGGGCCTGGG + Intronic
1081734154 11:45391755-45391777 CTGCTGGCCCATCTGAGGATGGG + Intergenic
1082768520 11:57187435-57187457 CTGCTGCCACCGCTGGAGCAAGG + Exonic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083235729 11:61349621-61349643 CTGCTGCTACAGCTGAGGCCTGG - Exonic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1084860216 11:72013283-72013305 CTGCGGGCCCAGCGGGAGCTTGG - Exonic
1084964711 11:72738600-72738622 GTGCTGGGACAGCTGGGCCCAGG - Intronic
1085150512 11:74249236-74249258 GTGCTGGCAAAGCTGTGGTTTGG - Intronic
1085157713 11:74311562-74311584 CTGCTGGCGGTGCTGGCGCTCGG - Exonic
1085637244 11:78168306-78168328 AGGGTGGCACAGCAGGGGCTGGG + Intergenic
1085769679 11:79313722-79313744 CTGTTGTCACTGCTGGAGCTCGG - Intronic
1086430004 11:86727501-86727523 GTCCTGACACAGCTGGGGATGGG + Intergenic
1087475118 11:98624266-98624288 CTGCTAGCATTGCTGTGGCTGGG + Intergenic
1088545332 11:110953350-110953372 CTGTTGGCTGAGCTGGTGCTTGG + Intergenic
1088695326 11:112361423-112361445 CTGCTGCCCCAGCTAAGGCTGGG + Intergenic
1089074168 11:115724741-115724763 CTGATGCCACAGCTGCTGCTGGG + Intergenic
1089666533 11:120023923-120023945 CTCCTGGCACAGCTGGGTTCAGG + Intergenic
1090044320 11:123317434-123317456 CTAATGCCTCAGCTGGGGCTAGG + Intergenic
1091282072 11:134387506-134387528 CTGCCTGCCCAGCTGGGCCTTGG - Intronic
1091318975 11:134636343-134636365 CTGGTTGCATTGCTGGGGCTCGG + Intergenic
1091335309 11:134762112-134762134 CTGCTCCCACAGCTGGGGAGTGG - Intergenic
1091564647 12:1639564-1639586 CTGCTGACACCCCTGGGGCAGGG - Intronic
1091713656 12:2760693-2760715 CAGCTGTCACAGCTGTGGGTTGG + Intergenic
1092159600 12:6308929-6308951 CTCCTGGCCCAGCTGGTGGTGGG - Intergenic
1092861725 12:12724837-12724859 CTGCGGGCCCAGCTGGGGGTGGG + Intergenic
1094393874 12:29983221-29983243 CTGATGTCACGGCTGGGTCTGGG - Intergenic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG + Intronic
1095832642 12:46604096-46604118 CTGCTGACACTGCTGCTGCTGGG + Intergenic
1096090227 12:48894529-48894551 CTGGTGCCACATCTGGGCCTGGG - Intergenic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1096220454 12:49825754-49825776 CTGCTGGCTCTCCTGGGCCTGGG - Intronic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1097112986 12:56675997-56676019 CTGATGGATCACCTGGGGCTGGG + Intronic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1099038361 12:77618143-77618165 CTGAAGGCTCAACTGGGGCTGGG - Intergenic
1100615597 12:96229408-96229430 CTGCTGGCAAGCCCGGGGCTGGG - Intronic
1101863315 12:108500300-108500322 TTTCTGGCACATCTGGGTCTAGG - Intergenic
1102080062 12:110090740-110090762 TAGATGGCAGAGCTGGGGCTGGG - Intergenic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103781077 12:123399175-123399197 CTGCTTGCACATCTGGCCCTGGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103897736 12:124285033-124285055 GTGCTGGCAGAGCTAGTGCTTGG + Intronic
1104216274 12:126736859-126736881 CTGCTGGAACCGCTGGGAGTTGG - Intergenic
1104282632 12:127391860-127391882 CTGCTGGCAAAGCTGATGCTTGG + Intergenic
1104558525 12:129823496-129823518 CTGCTGGCAAGGCTGGCCCTTGG - Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104947627 12:132423623-132423645 CTGCAGGCGGAGCAGGGGCTGGG + Intergenic
1104960594 12:132486888-132486910 TGGGTGGCACAGCTGAGGCTGGG + Intergenic
1104978339 12:132561940-132561962 GTGCTGGCACTGCTGGGGGATGG + Intronic
1104980603 12:132571690-132571712 CTCATGGCACAGCTTGGGGTGGG - Intronic
1104982010 12:132577365-132577387 CTCCTGGGAAAGCGGGGGCTGGG - Intronic
1105303632 13:19155001-19155023 CTGCTGGCCCTGGTGGGCCTGGG + Intergenic
1105323421 13:19348061-19348083 CTGCTGGCCTTGCTGCGGCTGGG + Intergenic
1105873967 13:24537776-24537798 CTGCTGGCCTTGCTGCGGCTGGG - Intergenic
1105956368 13:25287128-25287150 CTGCTGGCCTGACTGGGGCTGGG - Intronic
1106758172 13:32842943-32842965 CTGAAGGCTCAGCTGGGGTTGGG - Intergenic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1106776730 13:33016498-33016520 CTGCTGGTGCTGCTGGGCCTGGG + Exonic
1107793400 13:44025558-44025580 TTGCTGGAACAGGTGGGGGTTGG + Intergenic
1107885627 13:44872281-44872303 CTGCTGGGACACGAGGGGCTGGG + Intergenic
1111798138 13:92949550-92949572 GAGCTGGGACAGCTGGGGCCAGG - Intergenic
1112693384 13:101919644-101919666 CTGCTGGGAGAGGTAGGGCTGGG - Intronic
1112805168 13:103156789-103156811 GTGCAGGCAAAGCTGGGGCAGGG - Intergenic
1113547085 13:111161415-111161437 CTGATGGCACAGCTGGCGAGTGG - Intronic
1113548620 13:111174727-111174749 CCGCTAGCACAGCTGAGGCACGG - Intronic
1113729151 13:112627209-112627231 GTGATGGCACAGCAGGGGTTGGG + Intergenic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1113902257 13:113803830-113803852 CTGCCCGCACCCCTGGGGCTGGG - Intronic
1113941165 13:114019235-114019257 CTGCTGACACTGCTGGGTGTGGG - Intronic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1114556450 14:23565108-23565130 TTGCTGGCCCAGGTGGGGCCTGG - Exonic
1116249174 14:42458556-42458578 CTGCTGGCAAATCGGGGACTTGG - Intergenic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1118822036 14:69352131-69352153 CAGCTGCCACTGCTGGGCCTGGG - Exonic
1118867411 14:69714313-69714335 CTGAGGGCTCAGCTGGGACTGGG - Exonic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120037708 14:79716761-79716783 TCCCTGGCACAGCTGAGGCTTGG + Intronic
1120409867 14:84140915-84140937 ATGCTGGCACAGCTAAGGCAGGG + Intergenic
1121324214 14:93010490-93010512 CTGCTGGCCCACCTGGGCCTCGG - Intronic
1121756398 14:96406296-96406318 CTGCTGTCACAGATGGGCATTGG + Intronic
1122282891 14:100634654-100634676 CTGCTGCTACAGGTGGGCCTTGG - Intergenic
1122613729 14:103002658-103002680 CTGCTCGCCAGGCTGGGGCTGGG + Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1202926214 14_KI270724v1_random:28410-28432 CCGCTGGGTCAGCTCGGGCTCGG + Intergenic
1124018860 15:25902110-25902132 CTGCAGGCTCATCTGAGGCTGGG - Intergenic
1125589181 15:40844079-40844101 GTGCTCGGAGAGCTGGGGCTCGG - Exonic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1127284011 15:57517002-57517024 CAGCTGCCAAAGCTGGGCCTGGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127684771 15:61332576-61332598 AGGCTGGCACAGCTGAGGGTGGG - Intergenic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1128385494 15:67145271-67145293 CTCATAGCACAGCTGGGACTTGG + Intronic
1128622231 15:69160576-69160598 CTGCGGGCACGGCGGTGGCTCGG + Intronic
1129264460 15:74386494-74386516 CTGCTGGCCCAGCAGGGTCCAGG - Intergenic
1129389709 15:75214461-75214483 CTGCTGCCCCAGCTGGTGGTGGG + Intergenic
1129475020 15:75779261-75779283 CTCCTTTCACAGCAGGGGCTAGG + Intergenic
1129679387 15:77649629-77649651 GAGCTGGGTCAGCTGGGGCTAGG + Intronic
1129838799 15:78730855-78730877 CTCCTTTCACAGCAGGGGCTGGG + Intergenic
1130871284 15:87974170-87974192 CTGCGGTCACACCTGTGGCTGGG + Intronic
1131217600 15:90552117-90552139 CTGCTGCCACAGCAGGCGCTCGG - Intronic
1132256996 15:100384525-100384547 TTGCTGTCACAGCTGGGGCCTGG - Intergenic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132538587 16:496426-496448 CTCCTGTCACAGCGGGGCCTGGG + Intronic
1132558508 16:583169-583191 CTGCTATCACACCTTGGGCTTGG + Exonic
1132806510 16:1777539-1777561 CAGCTGGCACAGCTGAGGCAAGG + Intronic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133237031 16:4392226-4392248 CAACCGGCCCAGCTGGGGCTGGG - Intronic
1133267659 16:4594558-4594580 CTGGTCCCACACCTGGGGCTGGG - Intronic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1134127632 16:11627296-11627318 CTGCTGGCAAAGATGGTGCTGGG - Intronic
1136586530 16:31189807-31189829 AGGCTGGCAGAGGTGGGGCTGGG + Intronic
1137039614 16:35598889-35598911 CTCCTGCCACAAGTGGGGCTGGG + Intergenic
1139512057 16:67433130-67433152 CTGGTTGCAAAGCTGGGGTTGGG + Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139939181 16:70592200-70592222 CTGCTGGCCCGGCTGAGGCTGGG + Intronic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1141699221 16:85634849-85634871 CTGCTGGCACAAATGGGGAGGGG + Intronic
1141825646 16:86477904-86477926 CTGCTGGCAGAGCTGGGCTTCGG + Intergenic
1142000205 16:87660041-87660063 CAGGTGGCAGGGCTGGGGCTTGG - Intronic
1143696703 17:8625820-8625842 CTGCTGCCACTGCTGGTCCTGGG + Intronic
1143776994 17:9206061-9206083 CTGGTGGCAGAGCAGGGTCTGGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144676540 17:17165865-17165887 CTGCTCACGCAGCTGGGCCTCGG - Intronic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1146225409 17:31061957-31061979 CAGCTGGGCCAGCTGTGGCTGGG - Intergenic
1146884442 17:36461790-36461812 CTGCTGTCACAGCTCTGGATTGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1148050462 17:44767655-44767677 GTGCCGGGGCAGCTGGGGCTGGG - Intronic
1148156143 17:45426134-45426156 CTGCTGGCCAGGGTGGGGCTTGG + Intronic
1148755606 17:49971572-49971594 CTGCTGGGAGAGTTGGGGCGCGG + Intronic
1149133760 17:53340314-53340336 CATCTGCCACTGCTGGGGCTTGG + Intergenic
1150216926 17:63476457-63476479 CGGCCGGCACACCTGGGGCTTGG - Intergenic
1150387812 17:64774753-64774775 CTGCTGGCCAGGGTGGGGCTTGG + Intergenic
1151151394 17:72090759-72090781 TTCCTTGCAGAGCTGGGGCTGGG - Intergenic
1151309672 17:73285608-73285630 CTGCGGGCTGAGCCGGGGCTGGG + Exonic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152026698 17:77814306-77814328 CTGTTGGCTCGGCTGGCGCTGGG - Intergenic
1152292134 17:79445949-79445971 CAGTTGTCACAGCTGTGGCTGGG + Intronic
1152366620 17:79860212-79860234 TGGCAGGCGCAGCTGGGGCTTGG + Intergenic
1152439058 17:80294225-80294247 CAGCTGGCACAGATGGCCCTTGG - Intronic
1152621009 17:81364833-81364855 CTGCGGGCAGCGCTGGGACTGGG - Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1154251431 18:12748156-12748178 CTCCTGGTACAGCTGTGGCCGGG + Intergenic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1155525070 18:26707586-26707608 CTGCCTGAACAGCTTGGGCTTGG - Intergenic
1156508568 18:37615771-37615793 CTGCAGGAGCAGCTGGGACTTGG + Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1158259661 18:55592647-55592669 CTGCTGGGGCTGGTGGGGCTGGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160165318 18:76506597-76506619 ATGCTGGCAGGGCAGGGGCTGGG - Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160623668 18:80188535-80188557 GTGCTGGCACAGTTGGGTCGAGG - Intronic
1160780947 19:877789-877811 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160780962 19:877845-877867 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160780979 19:877901-877923 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781001 19:877969-877991 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781019 19:878031-878053 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781059 19:878181-878203 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781101 19:878305-878327 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781123 19:878373-878395 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781167 19:878503-878525 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781186 19:878565-878587 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160781203 19:878627-878649 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781256 19:878795-878817 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781281 19:878863-878885 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1160781352 19:879073-879095 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781377 19:879141-879163 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781399 19:879229-879251 CTGCTGGGGCATGTGGGGCTCGG - Intronic
1160781418 19:879317-879339 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781449 19:879429-879451 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781466 19:879485-879507 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781502 19:879621-879643 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781518 19:879677-879699 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160781542 19:879765-879787 CTGCTGGGGCACGTGGGGCTGGG - Intronic
1160800678 19:966648-966670 CTGCTTGCACAGCTGCTGCCTGG - Exonic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160855543 19:1215552-1215574 CTGCAGGCTGTGCTGGGGCTGGG - Intronic
1160981612 19:1818944-1818966 CGTGTGGCACAGCAGGGGCTGGG + Intronic
1161000721 19:1909489-1909511 CTGCTGGCACAGGTGAGGACAGG - Intronic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1161079790 19:2305088-2305110 CTGCTGTGACAGCAGTGGCTGGG - Intronic
1161341775 19:3746925-3746947 GTGCAGGCCCAGCTGGGGTTTGG + Intronic
1161569794 19:5024271-5024293 GCACTGGCACTGCTGGGGCTGGG - Intronic
1162582894 19:11541065-11541087 CTTCTGGGCCAGCTGGGGCGAGG - Exonic
1162798716 19:13099516-13099538 CTGCGGCCAGAGCTGCGGCTTGG + Exonic
1162904941 19:13817808-13817830 GAGGTGGCACTGCTGGGGCTGGG + Exonic
1163268069 19:16233435-16233457 CTGTTGGCTAAGCTGGGGCAGGG + Intronic
1163582645 19:18147602-18147624 CTGCTGGGACATCAGGGGCTGGG - Exonic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163679848 19:18674845-18674867 CTCCTGGGACAGCTGGGGAATGG - Intergenic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1164987262 19:32657649-32657671 CTGATGGCAGAGCTTGGCCTGGG + Intronic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1165102046 19:33444701-33444723 TGCCTGGCCCAGCTGGGGCTTGG - Intronic
1165448255 19:35868571-35868593 CTCCTGTCACCGCTGGGGCCGGG + Exonic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166748487 19:45153376-45153398 CTGCTGGCGGCGCTGGGCCTGGG - Exonic
1167116300 19:47491120-47491142 CACCTGGCTCAGCTGGGGCAGGG + Intronic
1167118319 19:47501079-47501101 ATGCTGGCATAGCTGGGATTAGG - Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167454340 19:49590694-49590716 AAGATGGCACAGCCGGGGCTGGG - Exonic
1167534557 19:50041484-50041506 AAGCTGTGACAGCTGGGGCTGGG - Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
926084003 2:10009866-10009888 CTGTTGGGACAGCAAGGGCTGGG + Intergenic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926326419 2:11788162-11788184 CTGCTGGCACGGCTGCTGCTGGG + Intronic
926418673 2:12675728-12675750 CTGCTGGCAGAGCAGAGGGTGGG - Intergenic
927716334 2:25355786-25355808 GTGCTGGGACAGCTGGGATTCGG - Intergenic
929314871 2:40464982-40465004 GTTCTGGCACAGCTGGGGGTGGG - Intronic
929603555 2:43219825-43219847 CTGCTGGCACGGCTGAGGGAGGG - Intergenic
929919355 2:46161528-46161550 CTGCCAGTACAGCTGGGGCCTGG - Intronic
930259885 2:49133243-49133265 TTGCTTGCACAACTGTGGCTTGG - Intronic
931063155 2:58554105-58554127 TTGCTGTCACCACTGGGGCTTGG + Intergenic
931465047 2:62478437-62478459 CTGCATGCAGAGCTTGGGCTGGG - Intergenic
932435211 2:71699330-71699352 CTCCTCCCCCAGCTGGGGCTGGG + Intergenic
932467539 2:71933281-71933303 CTGTTGGCCCAGCCTGGGCTCGG - Intergenic
933465093 2:82641574-82641596 CACCTTGCTCAGCTGGGGCTGGG - Intergenic
934655016 2:96112802-96112824 CTGCTGGCACAGCAGACTCTGGG - Intergenic
935203995 2:100881981-100882003 ATGCTGAAACTGCTGGGGCTGGG + Intronic
935217518 2:100986246-100986268 CAGGTGGCTGAGCTGGGGCTGGG - Intronic
935242529 2:101190867-101190889 CAGCTGGCTCAGTGGGGGCTGGG - Intronic
936491927 2:112979353-112979375 CTGTTTGCACTGCTGTGGCTGGG + Intronic
937078708 2:119125412-119125434 GGGCTGGCAGAGCTGGGGCCTGG - Intergenic
937263415 2:120600948-120600970 CTGCTCACACAGCTGAGGATGGG - Intergenic
937985687 2:127637145-127637167 CTGCTTGCCCTGCTGGAGCTGGG - Intronic
938233064 2:129678502-129678524 CTGCTGGCACGGGTGAGGATGGG + Intergenic
938377816 2:130820075-130820097 CTGCTATCCCAGCTGGGCCTGGG - Intergenic
938406933 2:131038021-131038043 GTGCTGGCATCTCTGGGGCTTGG + Intronic
938630801 2:133165064-133165086 CGGGTGTCACAGCTGGGGATGGG + Intronic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
940517139 2:154697425-154697447 CTGCAGGCTCAACTGAGGCTCGG + Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941978451 2:171430998-171431020 CTTCTGGCATGGCTGGGTCTGGG - Intronic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
946767320 2:223052803-223052825 CTGCCTCCACAGCAGGGGCTGGG - Exonic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
948152103 2:235752541-235752563 CTGCTGTCACAGCTGGAGAGGGG - Intronic
948201229 2:236130911-236130933 CTGCTGGGACCCTTGGGGCTGGG - Exonic
948697380 2:239738342-239738364 TTGCTGGCAGGGATGGGGCTGGG - Intergenic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
948897227 2:240933123-240933145 CTGCAGGCACAGCTCCTGCTCGG - Intronic
1170153513 20:13249339-13249361 CTGCTGGCAGAACTAGGGGTGGG - Intronic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1171782392 20:29430831-29430853 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
1172261331 20:33568495-33568517 CTGCTGGAAGAGCTGGGGGATGG + Intronic
1172273900 20:33669583-33669605 CTGATGGGACAGGTTGGGCTGGG - Intronic
1172483749 20:35286781-35286803 CTGCTCGCACGGCTGGAGCTGGG - Exonic
1172881182 20:38200956-38200978 CTGCTAGGATAGCTGGGGTTGGG - Intergenic
1172961852 20:38805713-38805735 CCGCTGGAGCAGCTGCGGCTCGG + Exonic
1173511306 20:43630983-43631005 CAGCTGGGATAGCTGAGGCTAGG + Intronic
1173567630 20:44052920-44052942 GTGCTAACACAACTGGGGCTTGG + Intronic
1173784341 20:45781871-45781893 TTGCTGGCAAGGCTGGGCCTTGG - Intronic
1173850722 20:46216233-46216255 CTGCTGGCACAGCGGGGGTTGGG - Intronic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174081224 20:47971991-47972013 CTGCGGGATCAGCTGGGTCTGGG - Intergenic
1174135276 20:48374897-48374919 CTGCGGGATCAGCTGGGTCTGGG + Intergenic
1174366130 20:50057626-50057648 CCTCTGGGACAGCTGGGGCCAGG - Intergenic
1174414214 20:50356554-50356576 CAGCTGGCAGAGGTGGAGCTGGG + Intergenic
1175069692 20:56322782-56322804 CTCCAGGCACCACTGGGGCTGGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175728951 20:61339769-61339791 CTGCAGGCATCGCTGGGGATTGG + Intronic
1175888960 20:62307656-62307678 CTGCTGGAGCAGAAGGGGCTGGG - Exonic
1176008144 20:62877246-62877268 CCACTGGCACTGCTGGGTCTGGG + Intergenic
1176064905 20:63189255-63189277 CTGCTGGGTCCCCTGGGGCTGGG - Intergenic
1178842303 21:36147452-36147474 GTGCTGACACTGCTGGTGCTGGG + Intergenic
1179354053 21:40642151-40642173 GTACTGGCACAGCTGGGCCCTGG + Intronic
1180177897 21:46098888-46098910 CTGGTGGAACCGCTGGGCCTGGG + Intronic
1180600482 22:17012250-17012272 CTCCTGGCACAGGTGCTGCTTGG + Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181440272 22:22932079-22932101 CTGCTGCCAGGGCTGAGGCTTGG - Intergenic
1182357936 22:29730629-29730651 GGGATGGCACAGCTGGGGCATGG - Exonic
1182500549 22:30743588-30743610 CTGCTGGCACAGCTGGGCTCAGG + Intronic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183309219 22:37100426-37100448 CCTCTGCCACAGCTGGGGCCAGG - Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184419318 22:44370367-44370389 CTGCTGGCCCATCATGGGCTGGG + Intergenic
1184654858 22:45935926-45935948 CTGCTGGTACACTTGGGTCTCGG + Intronic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1185364730 22:50432254-50432276 CTTCTGGAACAGCTGGGGGGCGG - Exonic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949651703 3:6167354-6167376 CTTCTGGTACAGCTGGTTCTAGG + Intergenic
950006629 3:9695688-9695710 GTTGAGGCACAGCTGGGGCTGGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950097164 3:10337088-10337110 GAGCTGGCACAGCTGGGGTGGGG - Intronic
950275904 3:11660464-11660486 CTGCTAGCACAGCTAGCACTGGG - Intronic
950424754 3:12919125-12919147 CTGCTTGGACACCTGGGCCTGGG + Intronic
950504933 3:13388821-13388843 CTGCTGGCCCTGCTGTGACTGGG - Intronic
950552573 3:13675569-13675591 CTGCTGGCAGAGCTGGAGGTGGG - Intergenic
950604315 3:14064825-14064847 CTGCTGGGACTGCTGCTGCTGGG - Exonic
950722179 3:14891264-14891286 CTTCTGCCACAGCTGGCTCTGGG - Intronic
951464733 3:22989918-22989940 CTGCCGGCGCCGCTGGGGCCGGG - Intergenic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
952507993 3:34024931-34024953 CTGATGGGTCAGCTGGGGCCTGG + Intergenic
952968054 3:38633131-38633153 CTGCAGGTCCAGCTGGGGCCGGG + Exonic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953675963 3:45002793-45002815 CTAGTGGCACAGCTAGGGGTGGG - Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953694536 3:45147133-45147155 CAGGTGGCACACCTGCGGCTGGG - Intergenic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
954135115 3:48578882-48578904 ATGCTGGGACAGAGGGGGCTCGG - Intronic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954372402 3:50175693-50175715 GGGCTGGGAGAGCTGGGGCTGGG + Intronic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954538591 3:51379438-51379460 CTGCTGGCACAGCTGAAGGGTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954636378 3:52073109-52073131 CTGAGGGCAGAGCTGGGGGTGGG - Intergenic
954718308 3:52538256-52538278 CTGGTGGGACACCTGGGGCAGGG + Intronic
954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG + Intronic
955351728 3:58198376-58198398 CTGCTGGCACACCTTGTTCTGGG + Intronic
956047071 3:65207153-65207175 ATGCTGGCACACATGCGGCTTGG - Intergenic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
960970022 3:123132763-123132785 CTGCTGTCACGGCTGGGACAGGG - Intronic
961156409 3:124683439-124683461 CAGGTGGCAATGCTGGGGCTAGG - Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963969734 3:151416349-151416371 CTGCGAGGACTGCTGGGGCTGGG - Exonic
964824376 3:160809095-160809117 ATGCTGGCAGAGCTGGACCTCGG - Intronic
965757356 3:172040109-172040131 CTGCTGGGAAGGCTGGGGGTGGG - Intronic
966807484 3:183818472-183818494 CACCTGGCACTGCTGGGTCTTGG + Intronic
967882829 3:194313975-194313997 AGGCTGTCACAGCTGGGGCAGGG - Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968656835 4:1782375-1782397 GTGGTGGCTCTGCTGGGGCTAGG - Intergenic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
970320956 4:14874955-14874977 CTTCTGGCACAGCTGAAGGTAGG - Intergenic
970599938 4:17633731-17633753 GTCCGGCCACAGCTGGGGCTTGG + Exonic
971033204 4:22663639-22663661 CGCATGGCACAGCTGGGGCTTGG + Intergenic
972371171 4:38424722-38424744 CTGCTGGCCCTGCTGGGGAGGGG - Intergenic
972822434 4:42717023-42717045 GTGCTGGCCCAGCTGGTGCTGGG + Intergenic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
973293286 4:48490547-48490569 CTCCTGGCGCAGGTGGGGCCGGG + Exonic
973605101 4:52579066-52579088 CTGCTGGTGCTGCTGGTGCTGGG + Intergenic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
976928649 4:90534417-90534439 AGGCTGGCACAGCCTGGGCTCGG - Intronic
977350471 4:95878782-95878804 CTGCTTCCAAAGCTGGGGCAGGG + Intergenic
977608499 4:99007863-99007885 CTGATTGCAGATCTGGGGCTGGG - Intronic
977885148 4:102245141-102245163 CGGCTGGCACCGCTGGCCCTGGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
980493424 4:133560324-133560346 CAGCTTCCACAGCTGGGACTAGG + Intergenic
981319576 4:143375868-143375890 TTGTTGTCACAGCTGGGGATGGG - Intronic
981540925 4:145845604-145845626 CGGGTGGCTCAGCTGGGACTGGG - Intronic
982162228 4:152581676-152581698 CAGCTAGCACAACTAGGGCTTGG + Intergenic
982189063 4:152834933-152834955 CAGCTGGCACAGCTGGGATGTGG + Intronic
982318774 4:154058236-154058258 CTTCTGGCCCCTCTGGGGCTAGG - Intergenic
985130634 4:186735100-186735122 CTGAAGGTACAGCTAGGGCTGGG - Intergenic
985448445 4:190041353-190041375 CCGCTGGGCCAGCTCGGGCTCGG - Intergenic
986059395 5:4173763-4173785 CTCCTGGGAAAGCTGGGGATTGG + Intergenic
986626155 5:9725417-9725439 CTGCTGGCCCTGCTGGCCCTGGG + Intergenic
986639875 5:9861820-9861842 CTTCAGGCTGAGCTGGGGCTAGG - Intergenic
986707552 5:10464072-10464094 CGGCTGGGACAGGTGGGGCAGGG - Intronic
987450917 5:18083209-18083231 TTTCTTGCACAGCTGGGACTAGG + Intergenic
988618894 5:32802359-32802381 CTAGTGGCAGAGCTGGGGTTTGG + Intergenic
989584598 5:43064849-43064871 CTGCTGGCAGGGCTTGGCCTCGG - Intergenic
990077326 5:51865131-51865153 CTGGTGGCTCAGCTGGGACTTGG - Intergenic
995965543 5:117903179-117903201 TTACTGGCACAGCTGAAGCTTGG - Intergenic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998095748 5:139394764-139394786 CAGCGTGCGCAGCTGGGGCTGGG + Exonic
998500700 5:142630259-142630281 CAGCTAACACAGCTGGGACTAGG - Intronic
999198975 5:149802681-149802703 CAGATGGGGCAGCTGGGGCTGGG + Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999480678 5:151945430-151945452 CTGCTGGGAGATCTTGGGCTAGG - Intergenic
999824484 5:155260936-155260958 CTGCTTGCACAGCAGGAACTGGG + Intergenic
1001065065 5:168529558-168529580 CGGCTGGGGCAGCTGGGGCGGGG + Exonic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002279330 5:178121463-178121485 CTTCTGGCACACCTGGGGGATGG - Exonic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002643503 5:180641555-180641577 CTGCTGGCTGAGCTGGGGTTGGG + Intronic
1004364295 6:14998993-14999015 CTGCCTTCTCAGCTGGGGCTGGG + Intergenic
1005522554 6:26613582-26613604 GGGGTGGCAGAGCTGGGGCTGGG - Intergenic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006402318 6:33825015-33825037 CTGCAGGCACTGCTGGGTTTGGG + Intergenic
1006748450 6:36361562-36361584 CTGGTGGCTCTGCTGGGTCTTGG - Intronic
1007335425 6:41151867-41151889 CTGAGGGCAGAGCTTGGGCTAGG - Intronic
1007697645 6:43743953-43743975 TTCCTGGCACAGCTGGGCCTGGG - Intergenic
1011003217 6:82614911-82614933 CTGCTGGCCCTGCTGAGGGTAGG + Intergenic
1011664037 6:89617871-89617893 CAGCTGGCACAGCTCTGGCCAGG - Intronic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1016831770 6:148441308-148441330 CTGCTGGCACAGGCGGTTCTGGG + Intronic
1017703563 6:157098797-157098819 CGGCTGGCACAGCTCAGCCTGGG - Intronic
1017958046 6:159195534-159195556 CTTCTGGCAGAGCTGGGCTTTGG + Intronic
1019305142 7:330686-330708 CTGCTCACACAGCCAGGGCTTGG + Intergenic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1019563917 7:1670482-1670504 CTGGGGGCGCAGCAGGGGCTGGG - Intergenic
1020097412 7:5376732-5376754 CGGCCGGCAGATCTGGGGCTGGG - Intronic
1020339680 7:7096277-7096299 CTGCTAGCTCACCTGGGGCCAGG - Intergenic
1021534392 7:21687149-21687171 CTGCTGGCCCAGCTGGTACCGGG + Exonic
1021940124 7:25670746-25670768 CTGCTGTCACAGGCGAGGCTGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023871054 7:44263227-44263249 CTGGTGGCAAGGCTGGGGCAGGG + Intronic
1024035641 7:45505711-45505733 TGGGTGGCACAGCGGGGGCTTGG + Intergenic
1025256268 7:57385658-57385680 CAGCTGGCAGAGGTGGAGCTGGG - Intergenic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1029887469 7:103888377-103888399 CTCTTCCCACAGCTGGGGCTTGG + Intronic
1031603930 7:123747751-123747773 CTGCTGGCAATTCTGGGGGTGGG - Intronic
1032000648 7:128263018-128263040 CAGCTGGGATGGCTGGGGCTGGG - Intergenic
1032019096 7:128396684-128396706 CTGCTGTCACCACTGGGGGTGGG + Exonic
1032238065 7:130141479-130141501 GTGCTGGCGCAGCGGGGCCTGGG - Intergenic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1034259931 7:149748687-149748709 CAACTGGCCCAGCTTGGGCTGGG + Intergenic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1034788151 7:153944162-153944184 CTTCCAGCACAGCCGGGGCTCGG + Intronic
1034815669 7:154170184-154170206 CTGCTGGGTCAGCTGCGGCAAGG - Intronic
1035052210 7:156005433-156005455 TTGCTGGCACCGCTGGGCCCAGG - Intergenic
1035251670 7:157601679-157601701 CTGCTGCCCACGCTGGGGCTTGG + Intronic
1035294947 7:157861720-157861742 CTGCTGGCAACGCAGAGGCTGGG - Intronic
1035303964 7:157917854-157917876 CAGCAGGCCGAGCTGGGGCTGGG + Intronic
1035398666 7:158551154-158551176 GTGCTGGCACAGCTGGGCTCTGG + Intronic
1035580946 8:738660-738682 CTGCGCGCCCAGGTGGGGCTGGG + Intergenic
1038984246 8:32791570-32791592 CTGGTGGGATGGCTGGGGCTTGG - Intergenic
1040470878 8:47734985-47735007 CTGCTGGGAAGGCCGGGGCTGGG - Intronic
1040831776 8:51684908-51684930 CTGCTGTCTCATCTGAGGCTGGG - Intronic
1040871184 8:52101208-52101230 CTCCAGGCAGAGATGGGGCTGGG + Intergenic
1043526329 8:81100523-81100545 TGGTTGGCACAGCTGGGGATGGG - Intronic
1043542810 8:81281414-81281436 CTGCTGGCACTGCCGGGCCGGGG + Intronic
1044193185 8:89343352-89343374 ATGCTGCCACAGCTGGGGGATGG + Intergenic
1044506853 8:93030611-93030633 GTGCCTGCAGAGCTGGGGCTAGG - Intergenic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1045948932 8:107829773-107829795 CTGCTAGGTCAGCTGGGGCCTGG + Intergenic
1047796618 8:128263411-128263433 CTACTTGCACAGCTGGGTCTAGG + Intergenic
1048334213 8:133490963-133490985 CTGCTGGCACTGCTGGGCTGTGG - Intronic
1048438947 8:134445689-134445711 CTCCTGGCACACCTGATGCTGGG + Intergenic
1048697956 8:137049781-137049803 CTGCTGGAGCTGCTGGAGCTGGG - Intergenic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049425097 8:142534410-142534432 CAGCTGGCACAGCTGAAGATGGG + Intronic
1049441961 8:142613684-142613706 CGGCTGGTACTGCTGGGCCTCGG + Exonic
1049444402 8:142623434-142623456 CCGGTGGCAGATCTGGGGCTTGG + Intergenic
1049536190 8:143183556-143183578 CTGAGGGCTCACCTGGGGCTCGG + Intergenic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1049709219 8:144056189-144056211 CTGCTGGCAGAGCTGGGCTATGG - Exonic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1052997660 9:34559745-34559767 CTCCTGCCACCGCTGGGGGTGGG + Intronic
1053391609 9:37740245-37740267 CTGCTGGCCCCGCAGGTGCTGGG - Exonic
1055022061 9:71680633-71680655 CTCCTGTCTGAGCTGGGGCTTGG + Intergenic
1056475605 9:86948269-86948291 CAGATGGCCTAGCTGGGGCTGGG - Intergenic
1057066680 9:92059786-92059808 TTGCTGACATAGATGGGGCTGGG - Intronic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057511651 9:95684847-95684869 CTGCTGGCAAATCTGGGGCTGGG - Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1058592840 9:106583810-106583832 CTGCTGGCAGAGATGGGAGTGGG - Intergenic
1058985921 9:110208140-110208162 TTCCTGGCAGAGCTGGGACTGGG + Exonic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059445412 9:114334895-114334917 CTGTGGGCACAGCTGTGGTTTGG - Exonic
1060661672 9:125408399-125408421 CAGCTGCCACCGCTGGGCCTCGG + Intergenic
1060891987 9:127194954-127194976 CAGCTGTCACAGGTGGGGCAAGG - Intronic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1061064216 9:128267384-128267406 CTCCTCCCACAGCGGGGGCTGGG - Intronic
1061411783 9:130425820-130425842 GTGCTGCACCAGCTGGGGCTGGG - Exonic
1061487450 9:130927507-130927529 CAGCTGGCACAGATGGGGCCTGG + Intronic
1061590606 9:131595185-131595207 GTCATGGCACAGCTGGGGCTAGG + Intronic
1062283135 9:135760709-135760731 CTGGTGCCACAGCTTTGGCTTGG - Intronic
1062436789 9:136549963-136549985 CTGCAGGCACCCCTGGGCCTGGG - Intergenic
1062497126 9:136837249-136837271 CTGCTGCTGCTGCTGGGGCTGGG - Intronic
1062552593 9:137096714-137096736 CTGCTCGACCAGATGGGGCTCGG - Intronic
1203775758 EBV:72328-72350 CTTCTGGCACAGCTGTTGCCAGG + Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1188809702 X:34638189-34638211 CTACTGGCAGACCTGGGCCTGGG - Intronic
1188835394 X:34948381-34948403 GTGCTGGCAGGGGTGGGGCTGGG - Intergenic
1188917991 X:35935425-35935447 ATGCTGCCACTGCTGGGGGTTGG + Intronic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1191615109 X:63162393-63162415 AGGCTGCCACAGCTGGGACTGGG + Intergenic
1191621189 X:63216530-63216552 AGGCTGCCACAGCTGGGACTGGG - Intergenic
1191953807 X:66622925-66622947 CTGATGGCAGAGCTGGGACTAGG - Intronic
1193664469 X:84299303-84299325 ATGCTACCACAGCTGGGGGTGGG - Intergenic
1195672972 X:107484585-107484607 CAGCTGGCTCCCCTGGGGCTAGG + Intergenic
1196062979 X:111431171-111431193 CTGTTGGCACAGCAGGCACTGGG + Intergenic
1198392246 X:136188291-136188313 CTACTGGCACAGCCTGGGCAAGG - Intronic
1199878366 X:151953371-151953393 CTGCTGGCACACCAGTGGCAAGG - Exonic
1200067829 X:153512989-153513011 TCGGTGGCCCAGCTGGGGCTTGG + Intergenic
1200069009 X:153518615-153518637 CTGCTGGCCCTTCTGGGGGTTGG + Intronic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic
1200401865 X:156024511-156024533 CTCCTGTCACAGTTTGGGCTGGG - Intergenic
1201277380 Y:12312198-12312220 CTGGTGGCCCAGATGGGGGTTGG + Intergenic
1201329671 Y:12804029-12804051 CTGGTGGGCCAGCTCGGGCTTGG + Intronic
1201849565 Y:18462984-18463006 CTGATGGCCCAGCTGTGGTTAGG - Intergenic
1201883753 Y:18857391-18857413 CTGATGGCCCAGCTGTGGTTAGG + Intergenic
1202138551 Y:21696341-21696363 CTGGTGGAAGAGCTTGGGCTTGG - Intergenic