ID: 900247812

View in Genome Browser
Species Human (GRCh38)
Location 1:1646716-1646738
Sequence CCTGAGAAGCAGAGACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 2, 1: 0, 2: 3, 3: 28, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900247812_900247817 13 Left 900247812 1:1646716-1646738 CCCACCAGTCTCTGCTTCTCAGG 0: 2
1: 0
2: 3
3: 28
4: 321
Right 900247817 1:1646752-1646774 TCCCTTTCACTTGTGTAGAACGG 0: 1
1: 0
2: 0
3: 12
4: 162
900247812_900247820 26 Left 900247812 1:1646716-1646738 CCCACCAGTCTCTGCTTCTCAGG 0: 2
1: 0
2: 3
3: 28
4: 321
Right 900247820 1:1646765-1646787 TGTAGAACGGTTTTGATTCCTGG 0: 1
1: 1
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900247812 Original CRISPR CCTGAGAAGCAGAGACTGGT GGG (reversed) Intronic
900189567 1:1347676-1347698 CCAGAGAAGCAGGGACTGCAAGG + Intronic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900348600 1:2224225-2224247 CCTGAGGAGGAGAGAGTGGGTGG + Intergenic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900504743 1:3023980-3024002 ACTGAAAGGCAGAGATTGGTAGG - Intergenic
900585983 1:3432532-3432554 GCTGGGAAGCAGAGACTGCCCGG - Intronic
900686848 1:3954241-3954263 GCTTTGAAGCAGAGACTGGTGGG + Intergenic
900909002 1:5580922-5580944 CCAGAGAAACAGAGGCTGGGTGG - Intergenic
901207259 1:7504209-7504231 CCTGGGCAGCAGAGCCTGGCAGG - Intronic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
901586373 1:10297229-10297251 TTGGAGCAGCAGAGACTGGTAGG + Exonic
902088754 1:13885017-13885039 CCTGAGAGGCAGAGATTGTAGGG - Intergenic
903077418 1:20782473-20782495 CTTGGGAAGCTGAGACTGGGAGG + Intronic
903414290 1:23170963-23170985 CCTGAGTAGCTGAGACTGCACGG - Intronic
903957480 1:27035330-27035352 CCAGACACGCAGAGACTGGGAGG - Intergenic
905095898 1:35470366-35470388 CCTGAGTAGCTGAGACTGCAGGG - Intronic
905773020 1:40650308-40650330 CCTCAGAAGCAGGGACTTGAAGG + Intronic
905890468 1:41515667-41515689 ACTAAGAAGCAGGGAATGGTCGG + Intronic
906787180 1:48626452-48626474 CCAGAGAAGGACAGACTGATTGG - Intronic
909859986 1:80593284-80593306 CCTGAGGAGTAGTTACTGGTAGG - Intergenic
909902482 1:81155293-81155315 CTTGGGAAGCAGAGAGTGTTGGG - Intergenic
910602760 1:89049576-89049598 CCTGATTAGCAGAGGCAGGTGGG - Intergenic
913048937 1:115098555-115098577 ACTGAGAACCAGACACTGATGGG + Intergenic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
913233024 1:116757382-116757404 CCTTAGAAGCAGATGCTAGTAGG + Intronic
915033366 1:152902857-152902879 CCTGCTAATTAGAGACTGGTGGG - Intergenic
916005384 1:160654748-160654770 CCTGAGAAACAGAGACAGCTGGG + Intergenic
917000416 1:170351688-170351710 TGAGAGAAGCAGAGAGTGGTTGG + Intergenic
917431966 1:174979309-174979331 CCTTTGAAGCAGACACTGGTTGG + Intronic
919663798 1:200273145-200273167 CCTGAAGAGGAGAGGCTGGTTGG - Intergenic
920119305 1:203643800-203643822 TCTGAGATGCAGCGACTTGTTGG + Intronic
920297039 1:204964699-204964721 ACTGAGAACCAGAGACTCATGGG - Intronic
921667985 1:217895308-217895330 TCTGAGAAACAGAGAGTGATAGG - Intergenic
921874746 1:220181907-220181929 CCTGAGTAGCTGAGACTACTGGG - Intronic
923036467 1:230288159-230288181 CCTGAGAAGCTGAGGCTGATGGG + Intergenic
923519020 1:234721734-234721756 TCTGAGAAGCTGAGGCTGGGTGG + Intergenic
1063150683 10:3333615-3333637 CCTGAGAGGCAGGAGCTGGTGGG + Intergenic
1063655225 10:7981378-7981400 CCAGAGAAGGGGTGACTGGTTGG + Intronic
1064316398 10:14261762-14261784 CCTGAGAGGGAGAGACAGGAGGG + Intronic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1066095147 10:32065212-32065234 TTTGAGAAGCTGAGGCTGGTGGG - Intergenic
1066653157 10:37678719-37678741 CGTGAGAAACAGAGACAGGAAGG - Intergenic
1066688861 10:38007103-38007125 TTTGGGAAGCAGAGGCTGGTGGG + Intergenic
1067037511 10:42931261-42931283 CATGAGAAACAGAGACAGGAAGG - Intergenic
1067554235 10:47256945-47256967 ACTGAGAAGCAGACACTGCCTGG + Intergenic
1068077362 10:52273389-52273411 CCTGTGAAGGAGAGTCTGGGAGG - Intronic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1069955724 10:72050192-72050214 CAAGACAAGCAGAAACTGGTGGG + Intergenic
1069968505 10:72143443-72143465 CTTGAGAGGCTGAGACTGGAGGG - Intronic
1070144181 10:73761699-73761721 AGTGAGAAGGAGAGTCTGGTTGG + Intronic
1070800159 10:79240423-79240445 CCTCTGAAGCAGAGACTGGTTGG + Intronic
1073002110 10:100293507-100293529 CCTGAGAGGCAGGGATTGATGGG - Intronic
1075598403 10:123749099-123749121 CCTGAGAAGCAGAGCATATTAGG + Intronic
1075604192 10:123792561-123792583 AATGAGAAGCAGAGACAGATAGG + Intronic
1076002972 10:126927020-126927042 ATTGAGAAGGAGAGACTTGTAGG + Intronic
1076983229 11:216519-216541 CATGAGCTGCAGTGACTGGTAGG - Exonic
1077846859 11:6034427-6034449 CTTGGGAAGCAGAGACTTGGAGG + Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1080183973 11:29457289-29457311 CCTGCAAAGAAGAGACAGGTAGG - Intergenic
1080722600 11:34864703-34864725 CCTGAAATTCAGAGTCTGGTGGG - Intronic
1080842900 11:36000911-36000933 CCAGGGAAGCAGAGACACGTGGG + Intronic
1081641610 11:44759418-44759440 CCTGAGAAACTGAGACTCTTAGG - Intronic
1082834272 11:57640194-57640216 CCAGAGAAACAGAGGCTGGAGGG - Intergenic
1082835678 11:57648818-57648840 CCTGTGAAGCAGAGACTGAAAGG - Exonic
1083311534 11:61786342-61786364 CCTGAGAGCCAGAGACTTCTTGG + Exonic
1083487840 11:62994756-62994778 CCTGAGAGGCAGAGAAGGATTGG + Exonic
1083811480 11:65109078-65109100 GCTGAGAAGCAGGGCATGGTGGG + Intronic
1083955845 11:65982369-65982391 CCTCAGGAGCACAGCCTGGTGGG + Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085150829 11:74251761-74251783 TCTGACAAGCAGACACTTGTAGG + Intronic
1087988801 11:104720992-104721014 TTTGTGAGGCAGAGACTGGTAGG + Intergenic
1089094353 11:115906478-115906500 CATGAGGAGCAGAGACTGAAGGG - Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1091271490 11:134314708-134314730 TCTGAGAAGCAGAGACTAATTGG - Intronic
1091786997 12:3249094-3249116 CCTGGGAAGCAGACTCTGGCAGG - Intronic
1091814140 12:3423527-3423549 CGTGAGAAGCATAGACAGGAAGG + Intronic
1091820687 12:3473287-3473309 CCTGAGAAGCCGTGTCTGTTGGG - Intronic
1092601524 12:10071464-10071486 CCCAAGAAGCAGAGACTGTGTGG - Exonic
1094428952 12:30345749-30345771 CCTGATAAGGAGCAACTGGTTGG + Intergenic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1098360097 12:69646178-69646200 CTTGGGAGGCTGAGACTGGTGGG - Intronic
1098403098 12:70094551-70094573 CCTTAGTGGCAGAGACTGGTAGG - Intergenic
1100790483 12:98124857-98124879 CCTCAAAAGCAGAGGCAGGTAGG + Intergenic
1103033636 12:117638997-117639019 CCTGTGAAGCAGTGTCAGGTAGG - Intronic
1103870025 12:124084771-124084793 GCTGAGAAGGAGAAGCTGGTAGG + Intronic
1105501259 13:20974831-20974853 CCTGGGAGGCAGCGAGTGGTGGG + Exonic
1105631215 13:22170707-22170729 CCTGAGAAGCATAACCAGGTTGG + Intergenic
1105972790 13:25446150-25446172 CCAGGGGAGCAGAGACTGATAGG - Intronic
1107403900 13:40095435-40095457 CATGAGAAGCAGGGACTGGATGG + Intergenic
1108176391 13:47797050-47797072 CCAGAGCAGCAGTGACTGGCAGG - Intergenic
1108446064 13:50510251-50510273 CATGAGAAGCAGAGACAGGCTGG - Intronic
1109064201 13:57664026-57664048 CCTGAGCAGCTGGGACAGGTGGG + Intronic
1113627836 13:111859450-111859472 CCTGAGCAGGAGAGGCTGGGGGG - Intergenic
1113767538 13:112890488-112890510 GCTGAGAAGCAGAGACAGACAGG - Intergenic
1114241390 14:20871630-20871652 CTTCAGGAACAGAGACTGGTAGG + Intergenic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1114630774 14:24158120-24158142 CCTGAGGAGGAGAGACAGATGGG - Exonic
1115755453 14:36523166-36523188 CCAGCGAAGCAGAGCGTGGTCGG - Intergenic
1118736454 14:68704814-68704836 CCTGAGATGCAGTGGCTGGTTGG - Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1119552478 14:75525062-75525084 CCTGGGAAGCAGAGACGGGGAGG - Exonic
1121517537 14:94562708-94562730 CCTGACAACCGGATACTGGTGGG + Intronic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122424832 14:101599803-101599825 CCTGTGCAGAAGAGGCTGGTAGG - Intergenic
1122745936 14:103897255-103897277 CCTGAGAACCAGAGCATGGCGGG + Intergenic
1122848529 14:104513863-104513885 CCAGAGAAGCAGGGGCTGGTGGG + Intronic
1123994560 15:25709613-25709635 CCTGAGAAGCAGACACCTGTGGG - Intronic
1126362422 15:47860112-47860134 CCTGAGAAGCAGAAACAGCGAGG - Intergenic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1127441024 15:59008340-59008362 CCTGAGTAGCTGAGACTGCAAGG + Intronic
1129057286 15:72829680-72829702 CCACAGAAGCAGAGACTGATGGG - Intergenic
1129462956 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG + Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131438249 15:92439843-92439865 CCAGAGAAGGAGTGACGGGTGGG + Intronic
1132559455 16:586803-586825 CCTGAGTAGCTGAAACTTGTAGG + Intergenic
1132990851 16:2792505-2792527 CCTGAGTAGCTGGGACTGATGGG - Intergenic
1133694502 16:8248849-8248871 CCTGAGAATCACAGTCTTGTAGG - Intergenic
1133900633 16:9970813-9970835 CCTGAGAAACGCAGACTGGTTGG + Intronic
1134610601 16:15605329-15605351 TCTGAGAGGCAGAGAGAGGTGGG + Intronic
1136155705 16:28380582-28380604 TCGGGGAAGAAGAGACTGGTTGG - Intronic
1136207379 16:28734707-28734729 TCGGGGAAGAAGAGACTGGTTGG + Intronic
1138036086 16:53608093-53608115 ACTGAGAAGTAGAGAGTGGCAGG - Intronic
1138677938 16:58665528-58665550 TCTAAGAAGCAGAAGCTGGTTGG - Exonic
1138770516 16:59657427-59657449 CCTGAGATGGACACACTGGTTGG + Intergenic
1138837635 16:60457865-60457887 CTTGATATGCAGTGACTGGTTGG + Intergenic
1141192491 16:81834651-81834673 CCTGAGAGGAAGATTCTGGTAGG + Intronic
1141826962 16:86487204-86487226 CCTGAGACTCAGAGACAGATGGG + Intergenic
1141855230 16:86676736-86676758 CCAGAAAAGCACAGAGTGGTAGG + Intergenic
1143039616 17:4024110-4024132 CCTGAGAGGCAGCGATTGGGAGG - Intronic
1143114587 17:4575556-4575578 ACAGAGAAACAGAGACTGGGAGG + Intergenic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1143708930 17:8720097-8720119 CCTGTGAAACAGATCCTGGTGGG - Intergenic
1143904564 17:10198563-10198585 GCCGGGAAGCAGAGACTCGTTGG + Intergenic
1143949387 17:10620640-10620662 CCTGAGAATCAGAACCTGGAAGG + Intergenic
1144889433 17:18485801-18485823 CCTGCGTGGCAGAGACTGCTTGG - Intronic
1145142778 17:20458495-20458517 CCTGCGTGGCAGAGACTGCTTGG + Intronic
1145721740 17:27079728-27079750 TCTGTGAAGAAGAGACTGGGGGG - Intergenic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148895275 17:50835861-50835883 CCTGAGAAGAAGGCCCTGGTGGG + Exonic
1150294372 17:63999993-64000015 CAGGAGAAGCAGGGACTGGGTGG + Intronic
1150434683 17:65144596-65144618 GCTGGGAAGCAGAGTCTGTTTGG + Intronic
1151403236 17:73869878-73869900 CCAGAGCAGCAGAGAAGGGTAGG - Intergenic
1151616385 17:75215332-75215354 CCTGAGTAGCTGAGACTGCGGGG + Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152254537 17:79230045-79230067 CATGAGAAGCTGAGCCTGTTTGG - Intronic
1153701069 18:7693816-7693838 CCTGAGATGCAGACACAGGGTGG + Intronic
1154018933 18:10645512-10645534 CCTGGGAGCCAGACACTGGTAGG - Intergenic
1154185282 18:12177710-12177732 CCTGGGAGCCAGACACTGGTAGG + Intergenic
1154353813 18:13609728-13609750 TCTGAGAAGCCGAAGCTGGTGGG + Intronic
1155518130 18:26643118-26643140 CCAGAGAAGCAGATTCTGGCAGG + Intronic
1156156577 18:34309819-34309841 CCAGAAAAACAGACACTGGTAGG - Intergenic
1157339842 18:46769213-46769235 CCTGAGGAGCAGGGACAGGGTGG - Intergenic
1157365937 18:47064382-47064404 CCTAAGAAGCAGGGAGTGGTGGG + Intronic
1158568771 18:58578997-58579019 CCACAGCAGCAGCGACTGGTCGG - Exonic
1159944016 18:74430196-74430218 CAGGAGAAGCAGAGAAGGGTGGG + Intergenic
1161268164 19:3374822-3374844 CGTGAGAGGCAGGGCCTGGTTGG - Intronic
1161865858 19:6831748-6831770 GCTGAGAAACAGACACTGCTAGG - Intronic
1163267911 19:16232750-16232772 CCTGGGGAGCAGAGACTGTGGGG + Intronic
1163327583 19:16615057-16615079 CCCTTGAAGCAAAGACTGGTTGG - Intronic
1165109532 19:33493721-33493743 CCTAGGAACCAGAGGCTGGTAGG - Intronic
1165347526 19:35258146-35258168 GTTGAGAAGCACAGACTGCTGGG + Intronic
1165393309 19:35550483-35550505 CTACAGAAGCAGATACTGGTGGG + Exonic
1166328861 19:42067379-42067401 TCTGAGAAGAAGAGAGTGCTAGG + Intronic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1166885049 19:45955332-45955354 CCTGAGAAGGAGAGACAGACAGG + Intronic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925095887 2:1201789-1201811 AATGAGAATCAGAGACTTGTGGG + Intronic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
929936218 2:46296560-46296582 CCTGAGATGCAGTGACTTGAGGG + Intronic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
930509815 2:52330305-52330327 ACTGGTTAGCAGAGACTGGTAGG + Intergenic
931634996 2:64332912-64332934 CCCGAGGAGCAGAAACTTGTGGG - Intergenic
931668384 2:64625993-64626015 GCTTAGAGGCAGAGTCTGGTTGG + Intergenic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
932485436 2:72081685-72081707 TCAGAGCAGCAGAGGCTGGTAGG - Intergenic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
933843710 2:86308428-86308450 CCTGAATAGCTGAGACTGCTGGG - Intronic
935638422 2:105268589-105268611 GCTGGGAAGCAGAGAGAGGTGGG + Intronic
936350211 2:111706826-111706848 GCTGAGAAGGAGACTCTGGTGGG - Intergenic
937014887 2:118596335-118596357 CAAGAGAGGCAGAGACTGCTGGG - Intergenic
937082922 2:119153353-119153375 CCTGAGGAGAGGAGACTGGAGGG + Intergenic
938170210 2:129069401-129069423 GCTGAGAAGCAAAGACAGTTAGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938672519 2:133599646-133599668 ACTGAAAAGAAGAGACTGATGGG + Intergenic
939895527 2:147786524-147786546 CCTGATAAGCAGAGAAGGATGGG - Intergenic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
940860113 2:158762534-158762556 CCTGGGCAGCGGAGACTTGTAGG + Intergenic
940885317 2:158984796-158984818 CGTAAGAAGCAGAGGCTGGGAGG + Intronic
940890667 2:159032603-159032625 CCTGAGAAGCTGCGACTGACAGG - Intronic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
945011578 2:205469530-205469552 CTTCTGAAGCAGAGACTGGATGG - Intronic
945065637 2:205945635-205945657 GCTGAGAGGCAGAGGCTGGTAGG - Intergenic
945194375 2:207224596-207224618 CCTGAGATCCAGAAACTGCTTGG + Intergenic
945560155 2:211329889-211329911 CCTAAGCAGCAGAGAGTTGTTGG - Intergenic
946089561 2:217208633-217208655 CCTCAGAAGGATAGAATGGTGGG - Intergenic
946321269 2:218955858-218955880 CCTCAGGAGCTGAGACTGATGGG + Intergenic
946409811 2:219510358-219510380 CCTGAGTGGCAGAGACAGGCTGG - Intergenic
947102566 2:226637175-226637197 TCTGAGCAGCAGAAACTAGTAGG + Intergenic
947838254 2:233190329-233190351 CTTGAGAAGCAGAGAAGGGCAGG - Intronic
948449510 2:238060648-238060670 CCTGAGGAGCAGAGGCGGCTGGG - Intronic
948802604 2:240439685-240439707 ACTGAGAAGCAGATGCTGGTGGG - Intronic
1169093372 20:2874617-2874639 CCTGAGAAACAGAAGATGGTGGG + Intronic
1170771142 20:19333369-19333391 GCTGAGAAACAGATTCTGGTGGG + Intronic
1171891805 20:30724304-30724326 CCTGAGAAGGAGAGCCTGTCTGG + Intergenic
1173287291 20:41684250-41684272 CCTGAGTAGCTGAGACTAGGAGG + Intergenic
1173921455 20:46749217-46749239 CCAGAAAAGCATAGAATGGTGGG - Intergenic
1175461939 20:59158372-59158394 CCTGTGCAGCACAGACTGTTTGG - Intergenic
1175507124 20:59494001-59494023 CCTGAAAGCCAGAGCCTGGTTGG - Intergenic
1175617635 20:60414795-60414817 CCTAAGAAGCAGAAACTGTGTGG - Intergenic
1177815342 21:25970460-25970482 CCAGAGAAGGATAGGCTGGTGGG - Intronic
1178131627 21:29579729-29579751 AATGACAAGCAGAGTCTGGTTGG + Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1179201782 21:39230284-39230306 TCAGAGAAGCAGACACTGGGGGG - Intronic
1179719035 21:43305133-43305155 CCTGAGGAGCAGTGACGGGGAGG + Intergenic
1180092394 21:45539797-45539819 CTTAAGAGGCAGAGGCTGGTGGG + Intronic
1180579431 22:16817353-16817375 CCTCAAAAGCAGAAACTGATTGG - Intronic
1180751908 22:18130546-18130568 CCTGAGTAGCTGGGACTAGTAGG + Intronic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184445425 22:44544340-44544362 GCTGAGAAGCAGAGCCTGGAGGG + Intergenic
1184644559 22:45889055-45889077 CCTGAGATGCAGGGAAGGGTGGG - Intergenic
1184787721 22:46679971-46679993 GCTGAGAAGCAGAGTCCTGTTGG + Intergenic
1185311772 22:50160067-50160089 GCTGAGGAGCAGAGAGTGGGAGG + Intronic
949871541 3:8593674-8593696 CCTGACAAGCAGCGACAGGTGGG - Intergenic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
952860165 3:37806475-37806497 CCTGAGAGGCAGAGCCAGGTGGG - Intronic
953232394 3:41076549-41076571 CCTGGGAAGCAGAGCATGGCAGG + Intergenic
953657554 3:44865534-44865556 CTCTAGAAGCAGTGACTGGTGGG + Exonic
954540315 3:51389394-51389416 ACTGGAAAGCAGAAACTGGTAGG - Exonic
954980026 3:54737512-54737534 CCTGGGAAGAAGAGGGTGGTTGG + Intronic
955195882 3:56804389-56804411 CCTGAGAAGTAGGAACTGCTGGG - Intronic
956077710 3:65523562-65523584 CATGTGAAACAGAGACTAGTGGG - Intronic
956101354 3:65771805-65771827 TATGAGAAGCAGGGACTAGTTGG + Intronic
956178160 3:66493669-66493691 CCTGAGTAGCTGAGACTAGAAGG - Intronic
956688483 3:71854609-71854631 CCAGATAAGGAGAGACTGTTAGG - Intergenic
958605342 3:96351063-96351085 CCTGTGAAGCAGAGGCGTGTTGG - Intergenic
959398490 3:105869776-105869798 CATGATTAGCAGAGACTGTTTGG - Intergenic
959926438 3:111926690-111926712 CTTCAGAGGCAGAGAATGGTTGG + Intronic
960550532 3:118971466-118971488 CCTGAAAAGAAGTGACTGGAAGG + Intronic
962391711 3:134977900-134977922 CCTGTGAAGGAGAGAATGGAAGG + Intronic
963512696 3:146268703-146268725 TCTGAGAAGCAGGGACTTGCTGG - Intergenic
964736635 3:159924953-159924975 CCTGAGACGCAGACATTTGTAGG + Intergenic
966886923 3:184381943-184381965 TCTGAGAAGCGGATCCTGGTAGG - Exonic
967867389 3:194201589-194201611 CCTGAGCAGCAAAGACTGCTGGG + Intergenic
969051528 4:4376701-4376723 CAAGAGAGGCAGAGACTGGAGGG - Intronic
969220607 4:5756171-5756193 CCTGAGATGCAGGGGATGGTTGG + Intronic
969486673 4:7476083-7476105 CCTGAGAGCCACAGGCTGGTGGG + Intronic
970452912 4:16189885-16189907 CCTACGAAGGAGAGACTAGTAGG + Intronic
971105853 4:23523968-23523990 CCTAAGAAGGAGATCCTGGTGGG + Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
974278000 4:59751584-59751606 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
975141693 4:70925166-70925188 CCTGAGTAGCAGAGACTTACAGG + Intronic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
977554773 4:98477494-98477516 CCTCAGAAGCAGAGCCGAGTGGG - Intronic
979637904 4:122978249-122978271 GCTGAGAAGTAGACACTCGTTGG - Intronic
980521511 4:133941898-133941920 ACTGAGAAGCAGAAAATTGTGGG - Intergenic
981195212 4:141911768-141911790 CTTGACATACAGAGACTGGTGGG - Intergenic
982032168 4:151311713-151311735 CCTGAGTAGCTGAGACTGCAGGG - Intronic
985303226 4:188511941-188511963 ACTGACCAGCAGAGTCTGGTGGG + Intergenic
985641890 5:1067289-1067311 CCAGAGAGGCAGAGACCGGCTGG + Intronic
987104010 5:14619026-14619048 CCTGAGAAGCAAAATCTGATTGG + Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
988914209 5:35876109-35876131 TCTGAGAAGCAGAGGCTTGGAGG + Exonic
988955375 5:36311104-36311126 CCAGAGAGACAGAGACTGGAAGG + Intergenic
989509744 5:42271734-42271756 CCTGAGTAGCAGAGACTACGGGG + Intergenic
989743280 5:44797012-44797034 GCTGTGAAGCAGATAATGGTGGG - Intergenic
992773507 5:80070258-80070280 CCTGGGAAGCTGAGCCTGGCAGG - Intronic
995287676 5:110410090-110410112 CATGAAGAACAGAGACTGGTGGG + Intronic
997428601 5:133821827-133821849 CCAGAGAAAAGGAGACTGGTCGG + Intergenic
998328727 5:141304769-141304791 CCTGAGTAGCTGAGACTAGAGGG + Intergenic
998361391 5:141591080-141591102 GCTGAGAAGATGAGACTGGGGGG - Intronic
999337119 5:150730681-150730703 GCTGTGAAGCACAGACTGGCTGG + Exonic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1005045594 6:21639322-21639344 CCTGAGAAGATGAGACTGAAGGG - Intergenic
1005306432 6:24518372-24518394 CTGGAGAAGCAGAGACTGAGTGG + Intronic
1005853516 6:29841440-29841462 CCTGAGAAGAAAAGACAGATAGG + Intergenic
1006341214 6:33448170-33448192 CCTGAGATGCAGAGAGGAGTGGG - Intronic
1007341294 6:41192901-41192923 CCTGAGAAGAAGGGACAGGGTGG + Exonic
1007907521 6:45477224-45477246 CCTGAGAAGCAAACACTCCTAGG - Intronic
1009276693 6:61690802-61690824 CATGAGAAGCAGATACTGATAGG + Intronic
1014681168 6:124432481-124432503 CCTGAGAAGCTGTGACTTATAGG - Intronic
1015129186 6:129790929-129790951 TCATAGAAGCAGAGACTGGGTGG + Intergenic
1016455787 6:144229550-144229572 CCTAAGCAGCTGAGTCTGGTGGG - Intergenic
1016639331 6:146330996-146331018 TGTGAGATGCAGAGACTGATAGG + Intronic
1017726847 6:157282240-157282262 CCTGAGTAGCTGGGACTGGCAGG + Intergenic
1018131692 6:160738094-160738116 CCTGAGCAGCAGTGACTCATGGG - Intronic
1019144319 6:169967095-169967117 CCTGAGAAGGAGAGACTCGCAGG + Intergenic
1019682227 7:2357014-2357036 TCTGAGCAGGAGAGTCTGGTGGG - Intronic
1020365437 7:7375769-7375791 CCTGAGACACAGATACTGTTAGG - Intronic
1020949497 7:14657704-14657726 CCAGAAATGCAGAGTCTGGTGGG - Intronic
1023318215 7:38963975-38963997 CCTGACAATCAGAAACTGGGAGG - Intergenic
1024116958 7:46203715-46203737 TCTGAGGAGCAGAGACTAGAAGG - Intergenic
1024343508 7:48290372-48290394 CCGGAGAAGGAGAGTCTGATAGG + Intronic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1026941517 7:74290145-74290167 CCTGGGGAGCACAGCCTGGTGGG + Intronic
1028510546 7:91620718-91620740 CCTGTGACGCAGGGAGTGGTGGG - Intergenic
1030761010 7:113351775-113351797 CCAGAGAAGCAAAGACAGGTAGG + Intergenic
1034543810 7:151776910-151776932 GCTCAGAAGCAGAGACTGTGAGG - Intronic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1039351256 8:36766383-36766405 AATGAGAAGAAGAGATTGGTGGG - Intergenic
1039390752 8:37179300-37179322 CGTGGTAAGCAGAGGCTGGTTGG - Intergenic
1039944099 8:42115433-42115455 CTTGAGGACTAGAGACTGGTAGG + Intergenic
1040500450 8:48000484-48000506 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
1043172167 8:76979272-76979294 CCAGAGAGGCAGAGACTGAATGG + Intergenic
1044621926 8:94199002-94199024 TCTGAGAGGAAGAGACTGGCTGG - Intronic
1045059103 8:98396698-98396720 CCTGGGAGGCAGTGACTGGGTGG + Intergenic
1046402856 8:113729618-113729640 CTTGAGAAACGGAGACTGCTCGG + Intergenic
1047497053 8:125415946-125415968 CATCGGAAGCAGAGACAGGTAGG + Intergenic
1048091627 8:131247418-131247440 CCTGAGAAGCAGGGACTGCTGGG - Intergenic
1048275326 8:133061691-133061713 CCTGAGCTGCAGACACAGGTAGG - Intronic
1048439230 8:134447734-134447756 ACTGAGAAGGAGAGGATGGTGGG + Intergenic
1048673237 8:136747346-136747368 TCTGAGAAGAAAAGACTGGCTGG + Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049624842 8:143615308-143615330 CCTGGGAAGTAGAGCCAGGTGGG - Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1051468063 9:17403482-17403504 CCTGACACTAAGAGACTGGTTGG - Intronic
1051478210 9:17531960-17531982 CCTGACCAGCAGACACTGTTGGG - Intergenic
1053478518 9:38399176-38399198 CCTGGGAAGCAGAGATGAGTGGG - Intergenic
1055018063 9:71640405-71640427 CCTGAGAAGGGGAGAGTGGGTGG - Intergenic
1056240727 9:84643970-84643992 CCTGAGAACCAGGGAATGGATGG + Intergenic
1057578125 9:96260638-96260660 CCTGAGTAGCTGAGACTTATAGG - Intronic
1058354010 9:104061228-104061250 CCTGAGAAGCAGAGAAAAGAGGG + Intergenic
1058510256 9:105710736-105710758 CCTGACAAACAGAGACATGTTGG + Intronic
1058619841 9:106871407-106871429 GCTGGGAAGGAGTGACTGGTTGG + Intronic
1058954917 9:109937167-109937189 TCTGAGGAGCAGAGAATGTTTGG - Intronic
1060298109 9:122356668-122356690 ACTGAGACCCAGAGACTGGAGGG - Intergenic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061657629 9:132104939-132104961 CCTGAGAACAAGAGAATGGCAGG + Intergenic
1062427542 9:136512882-136512904 CCTGGGAAGCCGTGACTGGAGGG - Intronic
1187824920 X:23325179-23325201 CCTGAAAAGCAGAGTCGGGCAGG - Intergenic
1188581915 X:31724221-31724243 CCTGAGAGGAAGATACTGGCTGG + Intronic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189959545 X:46311377-46311399 CCTGAGAAGCAGATGCTGGTTGG - Intergenic
1190484727 X:50913104-50913126 AATGAGAAGCAGGGACTTGTAGG + Intronic
1190578802 X:51869993-51870015 CCTGAGTAGCTGAGACTAGGAGG + Intronic
1200683141 Y:6236280-6236302 CTTTAGAAGCAGAGACTGAAAGG - Intergenic
1201049491 Y:9918106-9918128 CTTTAGAAGCAGAGACTGAAAGG + Intergenic
1201349906 Y:13028374-13028396 ACTGAGAACCACAGACTGGAGGG + Intergenic