ID: 900251284

View in Genome Browser
Species Human (GRCh38)
Location 1:1671450-1671472
Sequence ACCCGGTGCTCACCTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900251284_900251293 29 Left 900251284 1:1671450-1671472 CCAGATGCAGGTGAGCACCGGGT 0: 1
1: 0
2: 2
3: 5
4: 108
Right 900251293 1:1671502-1671524 GACTCACCAGTCCATGATGTTGG 0: 1
1: 0
2: 0
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900251284 Original CRISPR ACCCGGTGCTCACCTGCATC TGG (reversed) Intronic