ID: 900252044

View in Genome Browser
Species Human (GRCh38)
Location 1:1675990-1676012
Sequence GTCCCTCTCGTTACTAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 2, 1: 0, 2: 1, 3: 1, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900252044_900252046 17 Left 900252044 1:1675990-1676012 CCCGCTCTAGTAACGAGAGGGAC 0: 2
1: 0
2: 1
3: 1
4: 29
Right 900252046 1:1676030-1676052 AGAGACACTCAACCAAAACCAGG 0: 2
1: 0
2: 0
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900252044 Original CRISPR GTCCCTCTCGTTACTAGAGC GGG (reversed) Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
905008384 1:34729649-34729671 GACCCTCTCCTCACTAGGGCAGG - Intronic
918413567 1:184285199-184285221 GTCCCTTTCTTTACTATTGCAGG - Intergenic
1069932368 10:71891405-71891427 GTCTCTCTCCCTAGTAGAGCTGG - Intergenic
1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG + Intergenic
1103147546 12:118608800-118608822 TTGCCTCTAGTCACTAGAGCTGG - Intergenic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1104131141 12:125895562-125895584 GTTTCTCTTGTTACTAGAACAGG - Intergenic
1107056986 13:36116612-36116634 ATCCTTCACATTACTAGAGCTGG + Intronic
1116756510 14:48955357-48955379 GTCCCTCTATTGACTGGAGCTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1135901618 16:26465033-26465055 GTCCCTCTCTATACTACTGCAGG + Intergenic
1150858509 17:68776579-68776601 GTGCCTCTCTTAACAAGAGCAGG - Intergenic
1157882127 18:51330363-51330385 TTCCCTTTTGTTTCTAGAGCTGG - Intergenic
1167853057 19:52216408-52216430 GCCCCTCTCATTCATAGAGCAGG - Intronic
931098587 2:58970242-58970264 ATCCCTCTAATTACTAGAGTGGG - Intergenic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
1169787142 20:9371022-9371044 GTCCCTCTGGTTCCCAGAGCTGG - Intronic
1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG + Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
963672441 3:148269018-148269040 GTCCCACATTTTACTAGAGCAGG + Intergenic
964826909 3:160838723-160838745 TTCCATCTCCTTACTAGAGATGG - Intronic
975893002 4:79051353-79051375 GTGTCACTCTTTACTAGAGCTGG + Intergenic
976589809 4:86837880-86837902 CTCCCTCTCCTTTGTAGAGCAGG - Intronic
994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG + Intergenic
995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG + Intergenic
1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1033718284 7:144026313-144026335 CTCTCTCTCTTTCCTAGAGCTGG + Intergenic
1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG + Intronic
1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG + Intronic
1060694306 9:125693382-125693404 TTCGCTCTTGTTACTTGAGCTGG - Intronic