ID: 900252046

View in Genome Browser
Species Human (GRCh38)
Location 1:1676030-1676052
Sequence AGAGACACTCAACCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 0, 2: 0, 3: 24, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900252040_900252046 28 Left 900252040 1:1675979-1676001 CCAGCAGAGTCCCCGCTCTAGTA 0: 2
1: 0
2: 0
3: 5
4: 52
Right 900252046 1:1676030-1676052 AGAGACACTCAACCAAAACCAGG 0: 2
1: 0
2: 0
3: 24
4: 247
900252043_900252046 18 Left 900252043 1:1675989-1676011 CCCCGCTCTAGTAACGAGAGGGA 0: 2
1: 0
2: 0
3: 1
4: 21
Right 900252046 1:1676030-1676052 AGAGACACTCAACCAAAACCAGG 0: 2
1: 0
2: 0
3: 24
4: 247
900252045_900252046 16 Left 900252045 1:1675991-1676013 CCGCTCTAGTAACGAGAGGGACT 0: 2
1: 0
2: 0
3: 3
4: 28
Right 900252046 1:1676030-1676052 AGAGACACTCAACCAAAACCAGG 0: 2
1: 0
2: 0
3: 24
4: 247
900252044_900252046 17 Left 900252044 1:1675990-1676012 CCCGCTCTAGTAACGAGAGGGAC 0: 2
1: 0
2: 1
3: 1
4: 29
Right 900252046 1:1676030-1676052 AGAGACACTCAACCAAAACCAGG 0: 2
1: 0
2: 0
3: 24
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900252046 Original CRISPR AGAGACACTCAACCAAAACC AGG Intronic
900252046 1:1676030-1676052 AGAGACACTCAACCAAAACCAGG + Intronic
900262457 1:1738888-1738910 AGAGACACTCAACCAAAACCAGG + Intronic
904977102 1:34465123-34465145 AGAGAGACTGGGCCAAAACCTGG + Intergenic
905501425 1:38441995-38442017 AGAAACACCCAGCCTAAACCTGG + Intergenic
905950484 1:41946587-41946609 AGAGACATTCTAGCAAAAGCAGG + Intronic
910591135 1:88928942-88928964 AGAGACATTCTAGCAAAAGCAGG + Intergenic
911344681 1:96682081-96682103 AAAGCCAGTCAACCAAATCCAGG + Intergenic
912463824 1:109855580-109855602 AGAGACATTCTAGCAAAAGCAGG - Intergenic
912982608 1:114389839-114389861 TGAGACAGTCTTCCAAAACCTGG - Intergenic
913270445 1:117087836-117087858 AGAGGCATTCAACCAAACCGGGG - Intronic
913468920 1:119171235-119171257 AGAGACATTCTAGCAAAAGCAGG - Intergenic
916288795 1:163140653-163140675 AGAGACACTTAAGCAAAAATTGG - Intronic
916666359 1:166971360-166971382 AAGCACACTCAACCCAAACCAGG - Intronic
916692731 1:167206295-167206317 AGACACACTCAACTAGAATCTGG - Intergenic
918453495 1:184683894-184683916 AGAGACACAGAAACAACACCTGG - Intergenic
922505776 1:226124651-226124673 AGAGACACACAAACAAAGCAAGG - Intergenic
922684589 1:227629371-227629393 AGAGACATTCTAGCAAAAGCAGG - Intronic
922827181 1:228529891-228529913 AGAGACACCTAACCAACCCCAGG - Intergenic
922990948 1:229910783-229910805 AAAGACAGTCAACCAAAAAGGGG - Intergenic
1063777257 10:9277964-9277986 AGGCACAGTCAACCAAAACCAGG + Intergenic
1064858972 10:19804510-19804532 ATAGATACTCAACAAAAACCTGG + Intergenic
1065199469 10:23299494-23299516 AGAGACATTCTAGCAAAAGCAGG - Intronic
1067682329 10:48448950-48448972 AGGGACACTCAGCCAATCCCTGG + Intronic
1069742210 10:70692010-70692032 AGAACCACTCATCCAAACCCTGG - Intronic
1070091447 10:73289614-73289636 AGAGTAACAAAACCAAAACCTGG + Intronic
1071478589 10:86045678-86045700 AGAGACAGTCAACCACCACTCGG - Intronic
1072378001 10:94837493-94837515 AGAGACATTCTAGCAAAACCAGG - Intronic
1073551937 10:104411327-104411349 AGAAACTATCAACAAAAACCAGG - Intronic
1075813076 10:125241460-125241482 AGAGACAGAGAACCAAAATCTGG + Intergenic
1076009241 10:126974158-126974180 AGAGTCACTCAATCAACACTGGG - Intronic
1076856216 10:133116634-133116656 GCAGACACTCAACCAGAAACGGG + Intronic
1078612193 11:12830371-12830393 AGGAAGACTCAACCCAAACCTGG + Intronic
1079601216 11:22315058-22315080 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1083133099 11:60645778-60645800 AGAGACAATTTAACAAAACCAGG - Intergenic
1084494212 11:69494803-69494825 AAAGACCCTCAACCACAACCTGG + Intergenic
1085089606 11:73699408-73699430 ACAGACACTCAACCAGAGCTAGG + Intronic
1085601672 11:77861217-77861239 AGAGACATTCTAGCAAAAGCAGG - Intronic
1088500053 11:110474066-110474088 AGAGACAATCACCCACCACCAGG - Intergenic
1088994170 11:114982053-114982075 ATAGACACTCAACAAATCCCTGG - Intergenic
1089370384 11:117951385-117951407 AGAGAGACTCAACCACAACTTGG - Intergenic
1092001128 12:5033146-5033168 AGAGACTCTCAACCAGCTCCCGG + Intergenic
1092244311 12:6854909-6854931 TGAGACACTGAACCCAAACCAGG - Intronic
1092846049 12:12586267-12586289 AGAGCAACTCAGCCAACACCTGG + Intergenic
1093618509 12:21258113-21258135 AGAAACCCTCAACAAAAACCTGG - Intergenic
1096351975 12:50908161-50908183 AGAGACATTCAAGCAAAAGTGGG - Intergenic
1099881702 12:88475245-88475267 AGAGACATTTAAGCAAAGCCTGG + Intergenic
1099938888 12:89161214-89161236 AGAGAAATTCAACCAAAATCTGG + Intergenic
1100757211 12:97764612-97764634 AGAAACACACATGCAAAACCAGG - Intergenic
1102475294 12:113185018-113185040 AGAGACGCGCGACCAAAACCCGG + Intronic
1103527321 12:121577606-121577628 ACAGCCACTCAACCAGAACCTGG + Intronic
1103803194 12:123552943-123552965 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1104851444 12:131876874-131876896 AGAGACATTCTATCAAAAGCAGG - Intergenic
1106094304 13:26629197-26629219 AGAGACACTGAACACAAAGCAGG - Intronic
1107474026 13:40717607-40717629 AGACACACTCAAACAATAGCAGG - Intergenic
1108876777 13:55058132-55058154 AGAGACATTCCAGCAAAAGCAGG + Intergenic
1109995097 13:70112781-70112803 AAAGACACACAAATAAAACCTGG - Intergenic
1110293108 13:73830393-73830415 AAAGACACTGAAACAAAAACTGG + Intronic
1110582130 13:77142947-77142969 AAAGATACTCATCCCAAACCAGG + Intronic
1111515451 13:89325198-89325220 GGAGACCCTCAACCATAACAAGG + Intergenic
1112108735 13:96270985-96271007 AGAGAGACTCTGCCATAACCAGG - Intronic
1112134237 13:96558308-96558330 AGAGACACTCTCCCAGAACTTGG - Intronic
1112852058 13:103718271-103718293 AGAGAGACCTAACCAAAACCTGG + Intergenic
1116371418 14:44138066-44138088 AGAAAGACTCAACCAATATCAGG + Intergenic
1116478804 14:45372570-45372592 AGAGACCCTGAAACAGAACCAGG + Intergenic
1117672532 14:58123183-58123205 AGAGACATTCTAGCAAAAGCAGG + Intronic
1120258078 14:82144648-82144670 ATAAACACTCAATCCAAACCAGG - Intergenic
1121315682 14:92959838-92959860 CCCGAGACTCAACCAAAACCAGG - Intronic
1124806911 15:32893355-32893377 ACACACACGCAATCAAAACCAGG - Intronic
1125252567 15:37722482-37722504 GGAGACACTAAGCCAAAACATGG + Intergenic
1127074196 15:55310079-55310101 AGAGACATTCTAGCAAAAACAGG - Intronic
1128362527 15:66972439-66972461 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1129084640 15:73075996-73076018 TGAGACATTCATTCAAAACCTGG - Intronic
1129383336 15:75181690-75181712 AGATGCACTCAACCACACCCAGG - Intergenic
1130322065 15:82849876-82849898 AGAGAGAGACAATCAAAACCTGG - Exonic
1131860489 15:96647784-96647806 AAAGACACTCAAATAAAATCTGG - Intergenic
1133505976 16:6412862-6412884 AGAGAGACTCAACAAATGCCAGG - Intronic
1133883614 16:9805894-9805916 AGAGACACTCAACCTATACAGGG + Intronic
1136123028 16:28153188-28153210 AAAGACACAAAAACAAAACCAGG + Intronic
1137048234 16:35687624-35687646 AGAGACTCCCAACCAACACCAGG - Intergenic
1137049210 16:35693845-35693867 AGAGACTCTCAGCCAAAAACAGG - Intergenic
1137052473 16:35725684-35725706 AGAGACTCTCAGCCAACCCCAGG - Intergenic
1138102989 16:54269300-54269322 AGAAACAAACAAACAAAACCAGG - Intronic
1138178494 16:54927386-54927408 AGAGACACAACACCAACACCAGG - Intergenic
1142404640 16:89880989-89881011 ACTGACACTCCACCAAAACGAGG - Intronic
1142858152 17:2744492-2744514 ACAGACAATAAACAAAAACCGGG - Intergenic
1147346059 17:39796128-39796150 AAACACAGTCCACCAAAACCAGG + Intronic
1147630871 17:41930674-41930696 AGAGACAATCAAAGAAAAGCTGG - Exonic
1148826927 17:50400667-50400689 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1149273990 17:55014343-55014365 AGAGACATTCTAGCAAAAGCAGG - Intronic
1149744296 17:59080414-59080436 AAAGAAACTCACCCAAAAGCTGG + Intronic
1150314193 17:64155045-64155067 ACACACACTCAACCACAACAGGG + Intronic
1203156080 17_GL000205v2_random:4778-4800 AGAAACATTCAACCAACAGCGGG + Intergenic
1153401644 18:4689092-4689114 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1157654163 18:49369107-49369129 AGAGAAAATGAACCAAAACGGGG - Intronic
1158785793 18:60710764-60710786 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1164173652 19:22749128-22749150 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1164369738 19:27634219-27634241 AGAGACTCTCAGCCAACCCCTGG - Intergenic
1164370120 19:27636639-27636661 AGAGACACCCAGCCAACCCCAGG - Intergenic
1164374360 19:27672456-27672478 AGAGACTGGCAACCAAATCCAGG - Intergenic
1164375242 19:27678330-27678352 AGAGACACTCAGGTAACACCAGG - Intergenic
1164379649 19:27720786-27720808 AGAGACTGCCAGCCAAAACCAGG - Intergenic
1164380875 19:27736157-27736179 AGAGACTCCCAGCCAATACCAGG - Intergenic
1164381355 19:27739335-27739357 AGAGACTCCCAACCAACCCCAGG - Intergenic
1164385349 19:27766986-27767008 AGAGACTCCCATCCAAACCCAGG - Intergenic
1165526073 19:36355781-36355803 AGAGAGACTTCACCAGAACCTGG + Intronic
1165779801 19:38425789-38425811 AGAGACACTCAGCCCAGGCCAGG + Intronic
1167742903 19:51335067-51335089 AGAGACAGTCATACTAAACCCGG + Intronic
1167899931 19:52612385-52612407 AGATCCACTCAATAAAAACCAGG - Exonic
924974040 2:156898-156920 AGAGACATTCTAGCAAAAGCAGG - Intergenic
925264877 2:2560060-2560082 ATAGACACTCAACAAAGCCCAGG + Intergenic
926129247 2:10290538-10290560 AGAGACACTCATCCTCAACAAGG - Intergenic
926337840 2:11877505-11877527 AGGGACACTTACCCACAACCTGG + Intergenic
926864564 2:17343306-17343328 AGAGACATTCTAGCAAAAGCAGG + Intergenic
927381248 2:22481642-22481664 AGAGACTCTCTGCCAAACCCAGG - Intergenic
928036558 2:27829703-27829725 AGAGTCTCTAAACCAAAACCAGG + Intronic
928119235 2:28570488-28570510 AGAAACACTCAACAAAGGCCGGG + Intronic
928408789 2:31037686-31037708 AGAGTCACTAAACCACAAGCAGG - Intronic
928677139 2:33661201-33661223 AGAGACATTCTAGCAAAAGCAGG + Intergenic
929352328 2:40972451-40972473 AGAGAAGCTTAAACAAAACCAGG - Intergenic
934671966 2:96219887-96219909 AGAGACATTCTAGCAAAAGCAGG - Intergenic
935748785 2:106212400-106212422 AGAGACATTCTAGCAAAAGCAGG + Intergenic
937393973 2:121518406-121518428 AGAGAGCCCCAACCAGAACCCGG + Intronic
937437098 2:121889616-121889638 AGTGACACTTACCAAAAACCAGG - Intergenic
938315745 2:130326882-130326904 AGAGACACTAAACAAAAACAAGG + Intergenic
940415850 2:153418960-153418982 AGAGACTCTCATTCAAAAACGGG - Intergenic
943690440 2:190864353-190864375 AGAGACACTGTTCCACAACCTGG + Intergenic
944039245 2:195335912-195335934 AGAGACATCCTAGCAAAACCAGG - Intergenic
944214495 2:197240650-197240672 AGAGACACTGAATCTAAACTGGG - Intronic
944986726 2:205185687-205185709 AGAGATACTGAAACCAAACCAGG + Intronic
945068229 2:205965215-205965237 TGAGACACTGCACCAAAACTAGG + Intergenic
946191988 2:218012371-218012393 AGAGACACTCAACAAACAGAAGG + Intergenic
948494139 2:238335095-238335117 AGAAACACTCATGCAAAAACTGG - Intronic
1174977209 20:55349265-55349287 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1182585882 22:31344193-31344215 AAAAACACTCTACCCAAACCTGG + Intronic
951200584 3:19872358-19872380 AGAGACATTCCAGCAAAAGCAGG - Intergenic
951837964 3:27003350-27003372 AGAGACATTCTAGCAAAAGCAGG + Intergenic
951920492 3:27849236-27849258 AGGGGCACTAAACAAAAACCTGG - Intergenic
952369619 3:32708981-32709003 AGGGACACTCAAAGAAAACCTGG - Intronic
952922125 3:38292793-38292815 AGAGACATTCTAGCAAAAGCAGG - Intronic
954096331 3:48331650-48331672 AGAGACATTCTAGCAAAAACAGG - Intergenic
954141634 3:48609756-48609778 AGAGCCAGTCAGCCAAAGCCAGG - Exonic
956721136 3:72118474-72118496 AGAGACACTGAATCCAAACAGGG - Intergenic
958465304 3:94449798-94449820 AGAGACACGAAACAAAAACTAGG - Intergenic
958639405 3:96785508-96785530 TGAGACACAAAACCAAAACCAGG - Intergenic
960367872 3:116795695-116795717 AGAAATAATGAACCAAAACCAGG - Intronic
962495547 3:135935950-135935972 AGAGACATTCTAGCAAAAGCAGG + Intergenic
963439845 3:145324941-145324963 AGATACACTCTACCAAATACTGG - Intergenic
963784528 3:149520632-149520654 AGTTACTCTCAATCAAAACCAGG + Exonic
963915870 3:150858392-150858414 AGAGACATTCTAGCAAAAGCAGG + Intergenic
964263444 3:154867417-154867439 ACAGATATTCAACCAAAAGCTGG + Intergenic
964953526 3:162325409-162325431 AGAGACATTCTAGCAAAACCAGG + Intergenic
965054700 3:163697860-163697882 AGAGACATTCTAGCAAAAGCAGG - Intergenic
965934625 3:174092243-174092265 AGAGACACATAAGCTAAACCAGG + Intronic
966353606 3:179056887-179056909 AGAGACATTCTAGCAAAAGCAGG + Intronic
967623660 3:191662635-191662657 AGAGACATTCTAGCAAAAGCAGG + Intergenic
967957995 3:194892762-194892784 AGAGACTTTCCACCAATACCTGG - Intergenic
972962012 4:44464519-44464541 AGATACACTCAATAAAAAGCAGG - Intergenic
975313710 4:72929477-72929499 AGAGACATTCTAGCAAAAGCAGG - Intergenic
975872809 4:78799802-78799824 AGGGACCTTCAACCACAACCAGG - Intronic
976189948 4:82478070-82478092 AGAGACATTCTAGCAAAAGCAGG + Intergenic
976560603 4:86496258-86496280 AGGCAAACTGAACCAAAACCCGG - Intronic
976619936 4:87117235-87117257 AGAGGTGCTCAGCCAAAACCTGG - Intronic
976833216 4:89339226-89339248 AGGGAGTCTCAAGCAAAACCAGG - Intergenic
977867487 4:102047000-102047022 AGAGACACTGGAATAAAACCAGG + Intronic
978909662 4:114048866-114048888 AGAGACATTCTAGCAAAAGCAGG + Intergenic
980230708 4:130042905-130042927 TGAGACACTAAAACAAAATCAGG - Intergenic
980444311 4:132886188-132886210 GGAGACATTCTAGCAAAACCAGG + Intergenic
981533028 4:145771202-145771224 AGAGAAGCAAAACCAAAACCTGG - Intronic
981736453 4:147957520-147957542 ACAGACACTTGAGCAAAACCAGG - Intronic
984040902 4:174732531-174732553 AGACAAACCAAACCAAAACCTGG + Intronic
985917802 5:2938088-2938110 AGAGAAACTAAACCCAAACCAGG + Intergenic
986031564 5:3898991-3899013 AAAGACACTCAACCAACAGCTGG + Intergenic
987068671 5:14315120-14315142 AGAGCCTTTAAACCAAAACCTGG - Intronic
988938653 5:36118212-36118234 AGGGACATTCAACAAAAAACTGG + Intronic
988957081 5:36330800-36330822 AGAGACATTCTAGCAAAAGCAGG - Intergenic
989659191 5:43780447-43780469 AGAGAAACTCAACAATATCCTGG + Intergenic
990574111 5:57108360-57108382 AGATACAATCAGCCAAATCCAGG + Intergenic
990680072 5:58232839-58232861 AGAGACATTTAAACAAAACAAGG - Intergenic
992278475 5:75146971-75146993 AGAGAAACACATCCAGAACCTGG - Exonic
992672143 5:79071077-79071099 AAAGACACTGAACAAAAACAGGG - Intronic
992880481 5:81104769-81104791 AGAGACACACAGCTAAACCCTGG + Intronic
993284447 5:85973383-85973405 AGAGGCAGTCATCCAAAAGCCGG + Intergenic
993492367 5:88567905-88567927 AGAGACACCAAACCTAGACCTGG - Intergenic
993560153 5:89396680-89396702 AGGGACAGTCCTCCAAAACCCGG + Intergenic
994607304 5:101985084-101985106 AGACACACACCACCATAACCTGG + Intergenic
995870741 5:116740891-116740913 AGAAGCCCTCAACCACAACCAGG - Intergenic
996239501 5:121178249-121178271 AGAGGCACACTACCAACACCTGG - Intergenic
996319362 5:122197111-122197133 AGAGCCACCCAACCCACACCAGG + Intergenic
997026061 5:130062978-130063000 AGCCACACTCAACAAAATCCAGG - Intronic
998800940 5:145868342-145868364 AAAGATATTCAGCCAAAACCTGG + Intronic
1000870966 5:166576793-166576815 ATAGACACTGAAGAAAAACCTGG - Intergenic
1001237342 5:170041584-170041606 AGTGCAACTCAACAAAAACCAGG + Intronic
1002800220 6:515265-515287 ACAAACACGCAAACAAAACCAGG + Intronic
1002894617 6:1369611-1369633 AGAGACACAGAACCCAAAACTGG + Intergenic
1002949245 6:1792581-1792603 AGATATACTCTACCAAAACAAGG - Intronic
1003021963 6:2517591-2517613 AGAGACACTCTGCCCAAACATGG - Intergenic
1004743094 6:18482147-18482169 GGGGACAGTCAACCAGAACCAGG - Intergenic
1004910514 6:20278280-20278302 ATAGAAAATCAACCCAAACCAGG - Intergenic
1005255533 6:23998983-23999005 AGAGTCAACCATCCAAAACCAGG + Intergenic
1005391248 6:25335806-25335828 AGAGACAATAAACAAAAATCTGG - Intronic
1005906646 6:30266756-30266778 TTATACACTCAACCAAACCCAGG - Intergenic
1006258572 6:32850355-32850377 AAAGACACTCAACCAGAAGGAGG - Exonic
1006483918 6:34322176-34322198 AGAAACAATCAAACAAAACCAGG + Intronic
1006502517 6:34467507-34467529 AGAGCCACTCCACTCAAACCAGG + Intronic
1008582269 6:52917927-52917949 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1009029000 6:58034660-58034682 AGAGACCCTCTTCCTAAACCTGG + Intergenic
1009204537 6:60786059-60786081 AGAGACCCTCTTCCTAAACCTGG + Intergenic
1009544888 6:65009023-65009045 AGAGACATTCTAGCAAAAGCAGG + Intronic
1010893600 6:81341425-81341447 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1011076879 6:83447444-83447466 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1011189676 6:84716183-84716205 AGAGACATTCTAGCAAAAGCAGG - Intronic
1013022341 6:106232398-106232420 AGAGACATTCTAGCAAAAGCAGG + Intronic
1013543649 6:111135109-111135131 AGAGACATTCTAGCAAAAGCAGG + Intronic
1014508116 6:122284195-122284217 AGAGACACACAAGCAAGACTAGG + Intergenic
1014699061 6:124660792-124660814 AGACACATTCAACCCAAAGCTGG - Intronic
1014745467 6:125195239-125195261 AGAGAGACTCAAACAACAACAGG - Intronic
1014791360 6:125676054-125676076 AGAGACAATAAACAAAAAACTGG - Intergenic
1015570461 6:134616152-134616174 ACAGACACACACACAAAACCAGG + Intergenic
1015865380 6:137721879-137721901 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1016444613 6:144119264-144119286 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1018691306 6:166346272-166346294 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1019134221 6:169898106-169898128 AGCGACACACACCCAAAACCGGG - Intergenic
1019950431 7:4367832-4367854 AGACAGGCTCAACCAAACCCAGG + Intergenic
1020363869 7:7358696-7358718 ACAGCCACTGAACCAAAATCGGG + Exonic
1022920484 7:35008399-35008421 AAAACCCCTCAACCAAAACCAGG + Intronic
1024174899 7:46828882-46828904 CAAGAAACTCAACCAACACCTGG + Intergenic
1026483710 7:70799976-70799998 AATGACACTAAACCAAAAGCAGG - Intergenic
1028588480 7:92473577-92473599 AGAGACATTCTAGCAAAAGCAGG - Intronic
1030337399 7:108341519-108341541 AGAGACATTCTAGCAAAAGCAGG + Intronic
1030843388 7:114382025-114382047 AGAGACATTCTAGCAAAAGCAGG - Intronic
1031191691 7:118561173-118561195 ACAGAGACTGCACCAAAACCTGG + Intergenic
1031264659 7:119567883-119567905 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1033282579 7:140016652-140016674 GGAGACAATGAACCAAAGCCAGG - Intronic
1034249295 7:149675479-149675501 AGAGACATTCTAGCAAAAACAGG + Intergenic
1036391337 8:8327099-8327121 GTAGACACTCAATAAAAACCTGG + Intronic
1040466941 8:47704399-47704421 TGATACACACAACCAAACCCTGG + Intronic
1040527642 8:48238861-48238883 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1041529493 8:58848460-58848482 AGAGACACTCAGATAAAACATGG + Intronic
1041822559 8:62054303-62054325 AGTGCCACACAACCAACACCAGG - Intergenic
1043490073 8:80740223-80740245 AGAGACATTCTAGCAAAAGCAGG + Intronic
1044280495 8:90349916-90349938 AGGGGAACTCAAGCAAAACCTGG - Intergenic
1046229791 8:111338810-111338832 AGGGAAACTCAAGCTAAACCTGG + Intergenic
1047443779 8:124901869-124901891 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1047483823 8:125310044-125310066 AGAGACACTGAAGCAAAATTAGG + Intronic
1049374181 8:142281266-142281288 AGAGACACCCAGCCAGAGCCAGG + Intronic
1051499470 9:17761361-17761383 ATACAGACTCAACCAAAAACCGG + Intronic
1054820286 9:69515280-69515302 AGAGACACTTAACCAAAGTTTGG - Intronic
1056123564 9:83512989-83513011 AAAGACACTCCCCAAAAACCAGG + Intronic
1056704600 9:88941275-88941297 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1060277591 9:122193725-122193747 AGAGGCCCTGAACCCAAACCAGG + Intronic
1060845312 9:126832260-126832282 ACAGACACAGAACCAAAATCAGG + Intronic
1062292919 9:135805433-135805455 ACAGACGCTCCACCAAGACCCGG + Intergenic
1062378327 9:136274975-136274997 AGAGACACTCGACCCAGGCCAGG - Intergenic
1188687843 X:33091327-33091349 AGGGATACTTAACCAAAAGCTGG + Intronic
1189077636 X:37933922-37933944 AGAGACCCTCAACAAAGACTAGG + Intronic
1189096184 X:38142861-38142883 ATTGGCACTCAACCAAAAGCAGG - Intronic
1189257729 X:39653396-39653418 TGTGACCTTCAACCAAAACCTGG - Intergenic
1189946639 X:46187151-46187173 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1190361544 X:49654266-49654288 AGAGTCCTTCAACCAAAACTTGG - Intergenic
1191054495 X:56228202-56228224 AAAGAGACTCAACCTAAAGCTGG + Intergenic
1191166989 X:57401847-57401869 AGAGACATTCTAGCAAAAGCAGG - Intronic
1191243825 X:58210249-58210271 AGAGACTCTGAGCCAAAACCAGG + Intergenic
1192939872 X:75901216-75901238 AGAGACATTCTAGCAAAAGCAGG - Intergenic
1193306806 X:79960156-79960178 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1195535053 X:106001167-106001189 AGAGACATTCTAGCAAAAGCAGG + Intergenic
1195546955 X:106123694-106123716 AGGGACCATCAACCAAAATCAGG + Intergenic
1196105756 X:111893408-111893430 ATAGACACTCAATCTTAACCTGG - Intronic
1196820626 X:119697593-119697615 AAAGAAACTAAAGCAAAACCAGG - Intergenic
1199644098 X:149888266-149888288 AGAGAAATTCAAACAAAAGCTGG + Intergenic
1200706412 Y:6446487-6446509 AGAGACAACAACCCAAAACCTGG + Intergenic
1200939866 Y:8770059-8770081 AGAGACAATGATCCACAACCTGG + Intergenic
1200940117 Y:8772226-8772248 GGAGACAATCACCCACAACCTGG + Intergenic
1201027700 Y:9718221-9718243 AGAGACAACAACCCAAAACCTGG - Intergenic