ID: 900252515

View in Genome Browser
Species Human (GRCh38)
Location 1:1678501-1678523
Sequence CACTGAGCTGGCGGTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900252515_900252519 -4 Left 900252515 1:1678501-1678523 CCCATCACACCGCCAGCTCAGTG 0: 1
1: 0
2: 0
3: 13
4: 113
Right 900252519 1:1678520-1678542 AGTGCCACCCAGACGCTCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 146
900252515_900252528 23 Left 900252515 1:1678501-1678523 CCCATCACACCGCCAGCTCAGTG 0: 1
1: 0
2: 0
3: 13
4: 113
Right 900252528 1:1678547-1678569 CCATGTGTGCCCTGACCCCTCGG 0: 1
1: 0
2: 3
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900252515 Original CRISPR CACTGAGCTGGCGGTGTGAT GGG (reversed) Intronic
900252515 1:1678501-1678523 CACTGAGCTGGCGGTGTGATGGG - Intronic
900386580 1:2413472-2413494 CCCTGAGCTGGGGGTGGGAAGGG + Intronic
900597398 1:3488332-3488354 CACTGAGCGGGATGAGTGATTGG + Intergenic
900785617 1:4648130-4648152 CACTGGGCTGTAGGAGTGATGGG - Intergenic
901064088 1:6486426-6486448 CAGTGAGCAGTCGGTGTGAGGGG - Intronic
901380099 1:8867351-8867373 CAGTGAAATGGAGGTGTGATGGG - Intronic
902648098 1:17818036-17818058 CTCTGAGCTAGTGGTGTAATTGG - Intronic
904880799 1:33695385-33695407 CACTGTGGTGGCAGTATGATGGG + Intronic
907599810 1:55756786-55756808 CACTGGTCTGGGGGTGGGATGGG + Intergenic
908290875 1:62665790-62665812 CACTGAGCTAGTGCTGAGATTGG - Intronic
912554378 1:110505514-110505536 CACTGAGTAGACGGTGTGCTGGG + Intergenic
915918958 1:159959889-159959911 CGCTAAGCTGACAGTGTGATGGG - Intergenic
919817140 1:201448633-201448655 GACGGAGCAGGTGGTGTGATGGG + Intergenic
1063424469 10:5940661-5940683 CACTGAGCTGGTGGTGGGGGGGG - Intronic
1069181590 10:65367208-65367230 CAGTGAGCAGGCACTGTGATAGG - Intergenic
1070682691 10:78459934-78459956 CACTGGGCTGGTGGGGTCATCGG - Intergenic
1070808040 10:79282312-79282334 CATTGAGCTGGAGGTGAGCTTGG + Intronic
1076883753 10:133252068-133252090 CACGGAGCTGGCGGTGATAACGG + Intergenic
1077176900 11:1195221-1195243 CACGGAGCAGGCGGTGTGGTGGG - Intronic
1077429146 11:2507381-2507403 GACTGAGGTGGCTGTGGGATGGG + Intronic
1077915318 11:6608002-6608024 CATTGAGCTGGAGGTGGGATGGG - Intronic
1080432863 11:32214622-32214644 ACCTGAGCTGGCTGTGTGATTGG - Intergenic
1080699574 11:34633034-34633056 GACTGAGATGGAGGTGGGATGGG + Intronic
1081563825 11:44243814-44243836 CACTGAGCTGGAGGAATGACTGG + Intronic
1083360644 11:62105034-62105056 TGCTGAGGTGGGGGTGTGATAGG + Intergenic
1089171538 11:116515178-116515200 CACTGAGCTGGAAGTGGGAGTGG - Intergenic
1090434772 11:126677611-126677633 CGCTGAGCTGTCGCTGTGCTAGG + Intronic
1091989989 12:4947418-4947440 CTCTGAGCAGGCAGAGTGATGGG + Intergenic
1092218405 12:6697718-6697740 CCCTGAGCAGGCGGTGGGAGGGG + Exonic
1095267771 12:40180365-40180387 CACAGAGCTGGCTGTGTGGGAGG - Intergenic
1106314026 13:28577929-28577951 CAAAGAGCTGGCGGTGGGGTGGG - Intergenic
1119566048 14:75630256-75630278 CTCTGAGGTAGCTGTGTGATGGG + Intronic
1120240773 14:81947341-81947363 CACTGAGCTGGAAGAGTGAGAGG - Intergenic
1121522993 14:94599210-94599232 CACTGCACTGGCAGTGGGATTGG + Intronic
1121652489 14:95569566-95569588 CAGTGTGCTGGCAGTATGATGGG + Intergenic
1122720286 14:103718035-103718057 CACTGTGCTGGCTGCGTGCTTGG + Intronic
1122795968 14:104206383-104206405 CAGAGAGCTGGCGGTGACATGGG + Intergenic
1122838416 14:104442703-104442725 CACAGAGCTGGCCATGTGGTTGG - Intergenic
1123044389 14:105504162-105504184 CACTGGGCTGGTGGGGTGCTGGG + Intergenic
1123705869 15:22950856-22950878 CCGTGAGATGGCGGTGAGATGGG - Intronic
1128537922 15:68504547-68504569 TCCTGGGCTGGCGGTGTGACTGG - Intergenic
1129958936 15:79665588-79665610 GACAGAGCTGGCAGTGGGATAGG + Intergenic
1131508025 15:93033287-93033309 CGCTGAGCTGGAGTGGTGATGGG + Intergenic
1133500509 16:6361818-6361840 CACTGGGCTGGAGGAGTGCTAGG + Intronic
1133698252 16:8285531-8285553 GAATGAGCTGGCAGTGTGCTGGG + Intergenic
1141949233 16:87330085-87330107 CACGGAGCTGGCTGTGGGCTGGG + Exonic
1142051987 16:87964998-87965020 GTCTGAGCTGGCAGGGTGATAGG + Intronic
1143616290 17:8051986-8052008 CAGTGTGCCGGCGCTGTGATGGG - Intergenic
1145101231 17:20079670-20079692 GTCTGAGCTGGCAGTGTGCTAGG + Intronic
1145200373 17:20939316-20939338 CACAGTGCTGGAGGTGTAATTGG - Intergenic
1145416270 17:22716091-22716113 CACTGTGCAGGGGGTGGGATGGG + Intergenic
1153632420 18:7084291-7084313 CATTGAGCAGGAGGTGAGATAGG + Intronic
1155140809 18:23042951-23042973 CACTGAGCAGCTAGTGTGATTGG - Intergenic
1155908945 18:31486777-31486799 GACTGGGGTGGGGGTGTGATGGG - Intergenic
1159146696 18:64463629-64463651 GACTGTGCTGGAGGTGTGAACGG + Intergenic
1159921342 18:74230037-74230059 CACTGGGCTGGCTCTGTGACAGG + Intergenic
1162398962 19:10433065-10433087 GACTGAGCTGGGGCTGTGAGTGG + Intronic
1162917210 19:13881021-13881043 TACGGAGCTGGGGGTGGGATGGG - Intergenic
1165184203 19:34002746-34002768 CACTGAGCGGGAGGAGAGATGGG + Intergenic
1165485009 19:36090228-36090250 CACTGAGCTTGCAGTGTGTGGGG + Intronic
1167605359 19:50479021-50479043 CGCTGAGCTGCCGCTGTGACAGG - Exonic
1167648348 19:50717578-50717600 CACTGAGATGGGGGTGTCATGGG + Intronic
1168178510 19:54643557-54643579 CTCTGATTTGGCGGTGGGATAGG - Intronic
927503485 2:23597909-23597931 CACTGAGATGGAGGAGTGAGGGG - Intronic
934576817 2:95407142-95407164 CACTGACCTGGCTCTGTGGTGGG - Exonic
934639036 2:96015310-96015332 CACTGACCTGGCTCTGTGGTGGG - Intergenic
934794612 2:97090102-97090124 CACTGACCTGGCTCTGTGGTGGG + Exonic
939409828 2:141810322-141810344 CCCAGAGCTGGCTGTGTGATGGG - Exonic
939645610 2:144694734-144694756 TACAGAGCTGGAGGTGTGATCGG - Intergenic
939868684 2:147503855-147503877 CACTGAGGTGGAGGTGGGACAGG - Intergenic
940977682 2:159964658-159964680 CACTGAGCTCACTGTGTCATAGG + Intronic
1168846731 20:950206-950228 CACAGACCTGGCTGTGTGCTTGG + Intergenic
1168979460 20:1992495-1992517 AGCTGAGCTAGAGGTGTGATAGG - Intronic
1169746207 20:8945669-8945691 CACTGATCTGGAGGGGTTATGGG + Intronic
1170724069 20:18910352-18910374 CACTGAGGTGGGAGTGTGCTTGG + Intergenic
1171519574 20:25765489-25765511 CACTGTGCAGGGGGTGGGATGGG + Intronic
1171557346 20:26091004-26091026 CACTGTGCAGGGGGTGGGATGGG - Intergenic
1172110479 20:32541727-32541749 CGCTGAGCTGGCGGGGTAAATGG + Intronic
1174066856 20:47871884-47871906 CCCAGAGCTGCCGGTGTCATGGG - Intergenic
1174499698 20:50975646-50975668 CAGTGTGCAGGCGGTGGGATGGG - Intergenic
1174499710 20:50975689-50975711 CAGTGTGCAGGCGGTGGGATCGG - Intergenic
1174499721 20:50975732-50975754 CAGTGAGCAGGCGGTGCGATCGG - Intergenic
1175110834 20:56646787-56646809 CCCTGAGGTGGGGGTGTGCTGGG + Intergenic
1175425060 20:58858846-58858868 CACTGAGCTTTTGGTGTGGTAGG + Intronic
1176653716 21:9571766-9571788 CACTGTGCAGGGGGTGGGATGGG + Intergenic
1179101747 21:38360514-38360536 CACTGACCTGGTGGTGGCATAGG + Intergenic
1181474631 22:23160698-23160720 CACTGTGCTGCCTGTGTGAGTGG + Intronic
1181544969 22:23597588-23597610 CACTAAGCTGGGGATGAGATGGG + Intergenic
1181815342 22:25432294-25432316 CACTAAGCTGGGGATGAGATGGG - Intergenic
1183281898 22:36936638-36936660 CCCTGAGCTGGAGGGGTGAGTGG + Exonic
1183474914 22:38030860-38030882 AACTGAGCTGGGGGTGGGGTGGG - Intronic
1185340044 22:50287110-50287132 CCCTGGCCTGGCGGTGTGACGGG + Exonic
952955888 3:38556895-38556917 CACTGGGCTGTCAGTGTGATCGG + Intronic
953958669 3:47250387-47250409 CTCTGAGCTTGCAGTCTGATGGG - Intronic
957083428 3:75658358-75658380 CACTGACCTTGGGGTGTGCTGGG - Intergenic
962992751 3:140593802-140593824 CACTGAAGTGGCTGTGGGATAGG + Intergenic
963283079 3:143405659-143405681 CACAGAGCTGAGGGTGGGATGGG + Intronic
968481977 4:837267-837289 CCCTGAGCTGGCGGGTTCATGGG - Intergenic
978495986 4:109359501-109359523 AAATGAGCTGGCAGTGTGAGTGG - Intergenic
984020182 4:174475644-174475666 CACTGAGTTAGGGGTGTGATGGG + Intergenic
998456825 5:142280223-142280245 CACTCAGCAGGCGGTGTGTTTGG - Intergenic
999304693 5:150511960-150511982 GACTGTGCTGGGGGTGTGACTGG + Intronic
1002350131 5:178577449-178577471 CGCCGAGGTGGCGGTGTCATGGG - Intronic
1005859461 6:29889422-29889444 CACTGACCTGGCAGCGGGATGGG + Intergenic
1005867025 6:29944215-29944237 CACTGACCTGGCAGCGGGATGGG + Exonic
1006042914 6:31270370-31270392 CACTGACCTGGCAGCGGGATGGG - Exonic
1006191694 6:32213346-32213368 CAGTGAGCTGTCGTTTTGATGGG - Intronic
1007691325 6:43703261-43703283 CACTGAGCTGGCAGGCTGCTAGG - Intergenic
1007759053 6:44121604-44121626 CACTAAGCTGTAGGTGTGCTAGG - Intronic
1008624138 6:53301181-53301203 CACAGACCTGGCAGTGTGATTGG - Intronic
1010487977 6:76438430-76438452 CACTGGGCTGGAACTGTGATTGG - Intergenic
1020697276 7:11429072-11429094 CACTGAGCTTGCAGTCTGAGGGG + Exonic
1022522009 7:31014462-31014484 CACAGAGCTTGCAGCGTGATGGG - Intergenic
1024667435 7:51560637-51560659 CACTGAGCGGGAGATGTGATGGG + Intergenic
1025280063 7:57620424-57620446 CACTGTGCAGGGGGTGGGATGGG + Intergenic
1025304672 7:57845077-57845099 CACTGTGCAGGGGGTGGGATGGG - Intergenic
1031814825 7:126420792-126420814 CACACAGCTGGAGGTGTGAGAGG - Intergenic
1035462318 7:159049635-159049657 CTCTGAGATGGCTGTGTGTTGGG + Intronic
1049688771 8:143949811-143949833 CACTGAGGTGGGGGTGTGCGAGG - Intronic
1055441881 9:76344568-76344590 CACTGAATTGGGGGTGGGATGGG + Intronic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1203698668 Un_GL000214v1:118316-118338 CGCTGAAGTGGGGGTGTGATTGG + Intergenic
1189487192 X:41442826-41442848 CACTGAGCTGGGGTTTGGATTGG + Intergenic
1195748034 X:108138028-108138050 TGCTGAGATGGCGGTGTGATGGG - Intronic
1196950115 X:120868537-120868559 CACAGAGCCTGCGGTGTGGTGGG + Intergenic
1197699949 X:129591817-129591839 CACAGATCTGGAGGTATGATAGG + Exonic
1197858622 X:130946441-130946463 CACAGAGCTGGAGGAGAGATGGG - Intergenic