ID: 900253128

View in Genome Browser
Species Human (GRCh38)
Location 1:1682105-1682127
Sequence AGTTCTATGGGAGGCCAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230492
Summary {0: 2, 1: 47, 2: 3042, 3: 67285, 4: 160116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900253128_900253136 7 Left 900253128 1:1682105-1682127 CCGCCTTGGCCTCCCATAGAACT 0: 2
1: 47
2: 3042
3: 67285
4: 160116
Right 900253136 1:1682135-1682157 CAGGCATGAGTGACCGTGCCCGG 0: 5
1: 276
2: 8927
3: 47450
4: 121254
900253128_900253142 28 Left 900253128 1:1682105-1682127 CCGCCTTGGCCTCCCATAGAACT 0: 2
1: 47
2: 3042
3: 67285
4: 160116
Right 900253142 1:1682156-1682178 GGCTGGGTGCAACCTTTCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 163
900253128_900253138 12 Left 900253128 1:1682105-1682127 CCGCCTTGGCCTCCCATAGAACT 0: 2
1: 47
2: 3042
3: 67285
4: 160116
Right 900253138 1:1682140-1682162 ATGAGTGACCGTGCCCGGCTGGG 0: 1
1: 1
2: 42
3: 443
4: 2574
900253128_900253137 11 Left 900253128 1:1682105-1682127 CCGCCTTGGCCTCCCATAGAACT 0: 2
1: 47
2: 3042
3: 67285
4: 160116
Right 900253137 1:1682139-1682161 CATGAGTGACCGTGCCCGGCTGG 0: 1
1: 11
2: 156
3: 1158
4: 4206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900253128 Original CRISPR AGTTCTATGGGAGGCCAAGG CGG (reversed) Intronic
Too many off-targets to display for this crispr