ID: 900254187

View in Genome Browser
Species Human (GRCh38)
Location 1:1688755-1688777
Sequence CACGTCCTGCAAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900254187 Original CRISPR CACGTCCTGCAAGGAGACGG AGG Intronic
900254187 1:1688755-1688777 CACGTCCTGCAAGGAGACGGAGG + Intronic
900262903 1:1741697-1741719 CACGTCCTGCAAGGAGACGGAGG + Intronic
901080234 1:6580006-6580028 CACGTCCGGCGCGGAGACGGTGG + Intronic
902503769 1:16926586-16926608 CATGTCCTGCAGGGAAACTGAGG + Intronic
902623610 1:17664430-17664452 CACCTCCTGCAGGGAGAGAGGGG - Exonic
903420037 1:23212300-23212322 CAAGTCCAGCAAGGAGACAGGGG - Intergenic
903968150 1:27102378-27102400 CACTCACTGCATGGAGACGGTGG + Exonic
905272114 1:36793969-36793991 CAGGTCCAGCAAGGAGTGGGGGG - Intergenic
909565954 1:77053838-77053860 GATGTCCTGCAAGGAGCTGGAGG - Intronic
915584000 1:156833781-156833803 CAGGTGCTGCAGGGAGACAGGGG + Intronic
920326596 1:205169827-205169849 CACTTCCTGGAAGGGGAAGGGGG + Exonic
921414170 1:214869591-214869613 CCCGTCCTGGAGGGAGATGGGGG - Intergenic
921814167 1:219546063-219546085 CACGTCCGGGAGGGAGATGGGGG + Intergenic
1064080398 10:12303549-12303571 CATGTCCTGCTTGGAGACGTTGG - Intergenic
1068655967 10:59576999-59577021 CATGTCCTGCAAGGAGGCCAGGG - Intergenic
1069890417 10:71648940-71648962 CAGGCCCTGCAGGGAGATGGTGG + Intronic
1076691142 10:132224421-132224443 CACGTGGTCCAAGGAGATGGTGG - Exonic
1086295759 11:85365921-85365943 CAGGTCCTGCCAGGAGGTGGGGG + Intronic
1089540346 11:119186075-119186097 AACTTCCTGCAAGGAGGCAGGGG - Exonic
1090818057 11:130315557-130315579 CACGTCCTGCCAGGTCACCGAGG - Intergenic
1091606653 12:1958615-1958637 AACCTCCTGGAAGGAGACAGGGG + Intronic
1092847870 12:12600782-12600804 CACGTGCTAAAAGGAGAAGGGGG + Intergenic
1094596709 12:31872862-31872884 CACGTCCTGCAAGGGGAATCAGG - Intergenic
1096880205 12:54661370-54661392 CAGGCCCTGAAAGAAGACGGGGG - Intergenic
1097261908 12:57725244-57725266 CACTGCCTCCAAGGAGATGGGGG + Intronic
1101671711 12:106881507-106881529 CACCTACTGCAAGGAGCCTGTGG + Intronic
1103926582 12:124426795-124426817 CAGGTTCTGCAGGGAAACGGAGG + Exonic
1105241660 13:18614492-18614514 CAAGTCCTGCTTGGAGAAGGTGG - Intergenic
1105398303 13:20062332-20062354 CACATACTGCAAGGTGATGGTGG - Intronic
1107820498 13:44281427-44281449 CATGTGCTGCAAGGAGAAGCCGG + Intergenic
1112324967 13:98438002-98438024 CACGTTCTGGAAGTAGATGGTGG + Intronic
1113376290 13:109767319-109767341 CCTGTCCAGCAAGGAGAAGGAGG + Intronic
1122148207 14:99706730-99706752 CATGTCCTGCATGGACACTGGGG - Exonic
1124691744 15:31829188-31829210 CCTGTCCTCCAAGGAGAGGGAGG - Intronic
1128509355 15:68303880-68303902 CACGATCTGCAAGGGGAGGGGGG + Exonic
1132557317 16:578362-578384 CACGTGCTGCAGGGACACAGGGG - Exonic
1135545807 16:23365633-23365655 CACATCTTGGAAGGAGAGGGGGG + Intronic
1137303957 16:47181383-47181405 CCCGTCCGGCAGGGAGATGGGGG + Intronic
1139654578 16:68379619-68379641 AACCTCCTGCGAGGAGACGGAGG - Intronic
1141152006 16:81570709-81570731 CATGTGCTGAAAGGAGACGCCGG + Intronic
1142334208 16:89476722-89476744 CACTTCCAGCAAAGAGATGGGGG + Intronic
1142713498 17:1736022-1736044 CTCGTGCTGCAGGGAGAGGGCGG - Exonic
1143504489 17:7356221-7356243 CTCCACCTGCAAGGGGACGGAGG + Exonic
1145896203 17:28459123-28459145 CCCGTCCGGGAGGGAGACGGGGG + Intronic
1147372764 17:40004814-40004836 CACATCCTAAAAGGACACGGAGG - Intergenic
1147768068 17:42850065-42850087 CAGATCCTGCAAGAAGAAGGAGG - Exonic
1148550954 17:48550614-48550636 CACGTCCTCCAAGCCAACGGGGG - Exonic
1149909000 17:60551680-60551702 CCCGTCCTGGAGGGAGATGGGGG + Intergenic
1150838331 17:68584668-68584690 CATCTCCTGCCAGGAGAGGGAGG + Intronic
1156500685 18:37555416-37555438 GAACTCCTGCAAGGAGACCGGGG - Intronic
1159611683 18:70532883-70532905 CACGTCCTGCGAGGAGAATCAGG - Intergenic
1162935666 19:13980336-13980358 AACCTCCTGGAAGGAGACTGGGG - Intronic
1163727240 19:18929629-18929651 CAGGTCCTGCCAGGAAAGGGTGG + Exonic
1165830720 19:38728979-38729001 CTCACCCTGCAAGGAGAGGGTGG - Exonic
1166178919 19:41093613-41093635 CTCCTCCTGCAGGGAGAGGGCGG - Exonic
1168045509 19:53791546-53791568 CAGAACCTGCAAGGAGACTGAGG - Intergenic
1168506933 19:56943702-56943724 CAGGTCCTGCAAGAAGACCTTGG + Intergenic
925150884 2:1613913-1613935 CACCTCCTGCTGGGAGAGGGAGG + Intergenic
925883343 2:8370809-8370831 CATTTCCTGCAAGGACAGGGTGG + Intergenic
926233291 2:11020945-11020967 CACGACCTGCAAGCAGAAAGTGG - Intergenic
926294517 2:11559255-11559277 CTCGTCCTGCCAGGAGACCTGGG + Intronic
929845490 2:45521136-45521158 CACGTCCTGCAAGGGGAGTCAGG + Intronic
933170040 2:79115023-79115045 CATGTCCTGAAAGGAGCCTGTGG - Intergenic
933750422 2:85599507-85599529 CCCGTCCTGAAAGGATACTGAGG + Exonic
934902494 2:98171882-98171904 CACATCCTGCAAGGGGACAAGGG - Intronic
936885971 2:117310332-117310354 CACATCCTGCAAGGAGAATCAGG - Intergenic
938482781 2:131675446-131675468 CAAGTCCTGCTTGGAGAGGGTGG - Intergenic
945377634 2:209097426-209097448 CATGTCCTGCAAGGAGGATGAGG + Intergenic
947948012 2:234123109-234123131 CTCGTCCTGCATTGAGAGGGAGG + Intergenic
948942207 2:241202285-241202307 CACGTCATGCAGGGGGAAGGCGG - Exonic
1168824596 20:801347-801369 CATGTCCTGCAAGGAGAATCAGG + Intergenic
1170485194 20:16808322-16808344 CACTTCCTGAAATGAGATGGAGG - Intergenic
1171356435 20:24549447-24549469 CACGTCCTGCAAGGGGAATCAGG - Intronic
1171427749 20:25058843-25058865 CACGTCCTGCTGGGGGTCGGTGG + Intronic
1175710453 20:61216445-61216467 GAAGTCCTCCAAGGAGACAGAGG - Intergenic
1176448895 21:6845243-6845265 CAAGTCCTGCTTGGAGAAGGTGG - Intergenic
1176827064 21:13710266-13710288 CAAGTCCTGCTTGGAGAAGGTGG - Intergenic
1177120330 21:17129805-17129827 CACGGCCTGTAAGGAGGCTGAGG + Intergenic
1179152571 21:38821569-38821591 CACTTCCTGCGGGGAGAGGGAGG - Exonic
1179419268 21:41222756-41222778 CACCTCCTCCAAGGAGTCTGTGG - Intronic
1183978937 22:41528462-41528484 CAGGGGCTGCAAGGAGAAGGTGG - Exonic
951435697 3:22661106-22661128 CAAGTCATGAAAGGAGATGGAGG + Intergenic
952154311 3:30626531-30626553 CACTTCCTTCAAGGAAACAGAGG + Intronic
953507227 3:43498225-43498247 CAGGTACAGCAAGGAGACAGTGG + Intronic
955640280 3:61075275-61075297 CTCCTCCTGCAAGAAGAGGGTGG + Intronic
959376362 3:105593385-105593407 CACGTCCTGCTAGGAGAATCAGG - Intergenic
968562026 4:1289280-1289302 CCCGCCCTGCAAGGAGAGGGCGG + Intergenic
969183111 4:5456887-5456909 CACGTGGTGCAAGGGGATGGTGG + Exonic
976188923 4:82470498-82470520 CACCACTTGGAAGGAGACGGGGG - Intergenic
976890320 4:90039234-90039256 CACGTCCTGCAAGGGGAATCAGG - Intergenic
983588501 4:169382351-169382373 CACGCCCTGCAAGGAGAATAAGG - Intergenic
983621291 4:169763918-169763940 CACGTCCTGCCAGGATACATAGG + Intergenic
990222768 5:53611791-53611813 AATGTCCTGAAAGGAGACTGAGG - Intronic
994988995 5:106974654-106974676 AAGGTTCTGCAAGGAGAGGGGGG + Intergenic
1006443857 6:34068140-34068162 GACGTGCTGGAGGGAGACGGGGG + Intronic
1008328380 6:50215122-50215144 CAAGTGCTGCAGGGAGAAGGAGG + Intergenic
1010011445 6:71052010-71052032 CACGTTCTGGAAGTAGATGGTGG - Intergenic
1011317361 6:86050861-86050883 CAGGGCCTGTAAGGAGATGGGGG + Intergenic
1011352891 6:86442311-86442333 GACTTCCTGCAAGGAAACGGGGG + Intergenic
1011515087 6:88144995-88145017 CTCGTCCTTCAAGGAGAATGAGG - Exonic
1018914752 6:168126229-168126251 AACGTCCTGGAAAGAGATGGCGG - Intergenic
1021678487 7:23105740-23105762 CACTTCGCGCAAGGAGGCGGGGG - Intronic
1022112288 7:27239185-27239207 CACGGCCTGGAAGATGACGGAGG + Intergenic
1023927038 7:44676929-44676951 CACGGGCTGGTAGGAGACGGAGG + Intronic
1027844438 7:83354409-83354431 CACATCCTGCAAGAATACGCAGG - Intergenic
1029429951 7:100523384-100523406 CCCGTCCGGGAAGGAGGCGGGGG - Intergenic
1034858520 7:154576768-154576790 CACGACCTGCACGGAGACCCTGG + Intronic
1035399448 7:158555308-158555330 CAGGTCCTTCCAGGAGAAGGCGG + Intronic
1036411602 8:8506725-8506747 CACGTCCTGCAAGGGGAATAAGG + Intergenic
1045459278 8:102412376-102412398 CACGCCCGGCAGGGAGGCGGCGG - Exonic
1045547368 8:103140800-103140822 CCCGGCCCGCAAGGAGGCGGCGG - Exonic
1047542669 8:125785391-125785413 CACGTCCTGCTAGGGGACAAGGG + Intergenic
1049557594 8:143290927-143290949 GGCGTCCTGCAGGGAGGCGGGGG + Intronic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1058451976 9:105105595-105105617 CACTTCCTGGAAGGAAAGGGAGG + Intergenic
1061450833 9:130666208-130666230 CAGGTCCTGCAAGGAGGTGAAGG - Intronic
1203520294 Un_GL000213v1:39274-39296 CAAGTCCTGCTTGGAGAAGGTGG + Intergenic