ID: 900255974

View in Genome Browser
Species Human (GRCh38)
Location 1:1698387-1698409
Sequence CCCGAGGGGTGGTGTCGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900255974_900255983 14 Left 900255974 1:1698387-1698409 CCGAGTCGACACCACCCCTCGGG 0: 2
1: 0
2: 0
3: 3
4: 34
Right 900255983 1:1698424-1698446 GTCTACCCCTACCCCCGCCAGGG 0: 2
1: 0
2: 0
3: 13
4: 141
900255974_900255982 13 Left 900255974 1:1698387-1698409 CCGAGTCGACACCACCCCTCGGG 0: 2
1: 0
2: 0
3: 3
4: 34
Right 900255982 1:1698423-1698445 TGTCTACCCCTACCCCCGCCAGG 0: 2
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900255974 Original CRISPR CCCGAGGGGTGGTGTCGACT CGG (reversed) Intronic