ID: 900256134

View in Genome Browser
Species Human (GRCh38)
Location 1:1699225-1699247
Sequence CCCGGCGCCCGCGTCTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900256134_900256145 25 Left 900256134 1:1699225-1699247 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900256145 1:1699273-1699295 GCTGCTGGTGCTGGGCAGGCTGG 0: 1
1: 2
2: 8
3: 109
4: 791
900256134_900256142 17 Left 900256134 1:1699225-1699247 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900256142 1:1699265-1699287 GCTCCACAGCTGCTGGTGCTGGG 0: 1
1: 1
2: 4
3: 22
4: 261
900256134_900256141 16 Left 900256134 1:1699225-1699247 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900256141 1:1699264-1699286 TGCTCCACAGCTGCTGGTGCTGG 0: 1
1: 1
2: 1
3: 39
4: 355
900256134_900256139 10 Left 900256134 1:1699225-1699247 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900256139 1:1699258-1699280 TCCACGTGCTCCACAGCTGCTGG 0: 2
1: 0
2: 2
3: 18
4: 196
900256134_900256144 21 Left 900256134 1:1699225-1699247 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900256144 1:1699269-1699291 CACAGCTGCTGGTGCTGGGCAGG 0: 1
1: 1
2: 4
3: 63
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900256134 Original CRISPR CCCGGCGCCCGCGTCTTCCA CGG (reversed) Intronic