ID: 900261038

View in Genome Browser
Species Human (GRCh38)
Location 1:1729658-1729680
Sequence AAGACCGGCTGCGGTAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261038_900261044 24 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261044 1:1729705-1729727 AAAAAAGAAATGGAAACCCAGGG 0: 1
1: 0
2: 15
3: 165
4: 1706
900261038_900261043 23 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261043 1:1729704-1729726 AAAAAAAGAAATGGAAACCCAGG 0: 1
1: 2
2: 22
3: 307
4: 2713
900261038_900261042 14 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261042 1:1729695-1729717 GGAAAGCAGAAAAAAAGAAATGG 0: 2
1: 6
2: 81
3: 885
4: 4793
900261038_900261041 -7 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261041 1:1729674-1729696 CGGTCTTCTATTAGTTTTTGAGG 0: 1
1: 1
2: 0
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261038 Original CRISPR AAGACCGGCTGCGGTAGCTC AGG (reversed) Intronic