ID: 900261039

View in Genome Browser
Species Human (GRCh38)
Location 1:1729667-1729689
Sequence AACTAATAGAAGACCGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261039_900261043 14 Left 900261039 1:1729667-1729689 CCGCAGCCGGTCTTCTATTAGTT 0: 1
1: 0
2: 1
3: 8
4: 68
Right 900261043 1:1729704-1729726 AAAAAAAGAAATGGAAACCCAGG 0: 1
1: 2
2: 22
3: 307
4: 2713
900261039_900261044 15 Left 900261039 1:1729667-1729689 CCGCAGCCGGTCTTCTATTAGTT 0: 1
1: 0
2: 1
3: 8
4: 68
Right 900261044 1:1729705-1729727 AAAAAAGAAATGGAAACCCAGGG 0: 1
1: 0
2: 15
3: 165
4: 1706
900261039_900261042 5 Left 900261039 1:1729667-1729689 CCGCAGCCGGTCTTCTATTAGTT 0: 1
1: 0
2: 1
3: 8
4: 68
Right 900261042 1:1729695-1729717 GGAAAGCAGAAAAAAAGAAATGG 0: 2
1: 6
2: 81
3: 885
4: 4793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261039 Original CRISPR AACTAATAGAAGACCGGCTG CGG (reversed) Intronic