ID: 900261040

View in Genome Browser
Species Human (GRCh38)
Location 1:1729673-1729695
Sequence CTCAAAAACTAATAGAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 2, 1: 0, 2: 2, 3: 30, 4: 456}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261040_900261044 9 Left 900261040 1:1729673-1729695 CCGGTCTTCTATTAGTTTTTGAG 0: 2
1: 0
2: 2
3: 30
4: 456
Right 900261044 1:1729705-1729727 AAAAAAGAAATGGAAACCCAGGG 0: 1
1: 0
2: 15
3: 165
4: 1706
900261040_900261043 8 Left 900261040 1:1729673-1729695 CCGGTCTTCTATTAGTTTTTGAG 0: 2
1: 0
2: 2
3: 30
4: 456
Right 900261043 1:1729704-1729726 AAAAAAAGAAATGGAAACCCAGG 0: 1
1: 2
2: 22
3: 307
4: 2713
900261040_900261042 -1 Left 900261040 1:1729673-1729695 CCGGTCTTCTATTAGTTTTTGAG 0: 2
1: 0
2: 2
3: 30
4: 456
Right 900261042 1:1729695-1729717 GGAAAGCAGAAAAAAAGAAATGG 0: 2
1: 6
2: 81
3: 885
4: 4793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261040 Original CRISPR CTCAAAAACTAATAGAAGAC CGG (reversed) Intronic