ID: 900261041

View in Genome Browser
Species Human (GRCh38)
Location 1:1729674-1729696
Sequence CGGTCTTCTATTAGTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261033_900261041 18 Left 900261033 1:1729633-1729655 CCTCCCAAAGTGCTGGGATTAGA 0: 2826
1: 319470
2: 266870
3: 145698
4: 131355
Right 900261041 1:1729674-1729696 CGGTCTTCTATTAGTTTTTGAGG 0: 1
1: 1
2: 0
3: 4
4: 118
900261036_900261041 14 Left 900261036 1:1729637-1729659 CCAAAGTGCTGGGATTAGAGGCC 0: 58
1: 7388
2: 247448
3: 279831
4: 179399
Right 900261041 1:1729674-1729696 CGGTCTTCTATTAGTTTTTGAGG 0: 1
1: 1
2: 0
3: 4
4: 118
900261030_900261041 28 Left 900261030 1:1729623-1729645 CCATCTGCAGCCTCCCAAAGTGC 0: 7
1: 340
2: 8622
3: 112717
4: 234468
Right 900261041 1:1729674-1729696 CGGTCTTCTATTAGTTTTTGAGG 0: 1
1: 1
2: 0
3: 4
4: 118
900261035_900261041 15 Left 900261035 1:1729636-1729658 CCCAAAGTGCTGGGATTAGAGGC 0: 1958
1: 240019
2: 277704
3: 178275
4: 139439
Right 900261041 1:1729674-1729696 CGGTCTTCTATTAGTTTTTGAGG 0: 1
1: 1
2: 0
3: 4
4: 118
900261038_900261041 -7 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261041 1:1729674-1729696 CGGTCTTCTATTAGTTTTTGAGG 0: 1
1: 1
2: 0
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261041 Original CRISPR CGGTCTTCTATTAGTTTTTG AGG Intronic