ID: 900261042

View in Genome Browser
Species Human (GRCh38)
Location 1:1729695-1729717
Sequence GGAAAGCAGAAAAAAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5767
Summary {0: 2, 1: 6, 2: 81, 3: 885, 4: 4793}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261039_900261042 5 Left 900261039 1:1729667-1729689 CCGCAGCCGGTCTTCTATTAGTT 0: 1
1: 0
2: 1
3: 8
4: 68
Right 900261042 1:1729695-1729717 GGAAAGCAGAAAAAAAGAAATGG 0: 2
1: 6
2: 81
3: 885
4: 4793
900261038_900261042 14 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261042 1:1729695-1729717 GGAAAGCAGAAAAAAAGAAATGG 0: 2
1: 6
2: 81
3: 885
4: 4793
900261040_900261042 -1 Left 900261040 1:1729673-1729695 CCGGTCTTCTATTAGTTTTTGAG 0: 2
1: 0
2: 2
3: 30
4: 456
Right 900261042 1:1729695-1729717 GGAAAGCAGAAAAAAAGAAATGG 0: 2
1: 6
2: 81
3: 885
4: 4793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261042 Original CRISPR GGAAAGCAGAAAAAAAGAAA TGG Intronic