ID: 900261043

View in Genome Browser
Species Human (GRCh38)
Location 1:1729704-1729726
Sequence AAAAAAAGAAATGGAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3045
Summary {0: 1, 1: 2, 2: 22, 3: 307, 4: 2713}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261038_900261043 23 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261043 1:1729704-1729726 AAAAAAAGAAATGGAAACCCAGG 0: 1
1: 2
2: 22
3: 307
4: 2713
900261039_900261043 14 Left 900261039 1:1729667-1729689 CCGCAGCCGGTCTTCTATTAGTT 0: 1
1: 0
2: 1
3: 8
4: 68
Right 900261043 1:1729704-1729726 AAAAAAAGAAATGGAAACCCAGG 0: 1
1: 2
2: 22
3: 307
4: 2713
900261040_900261043 8 Left 900261040 1:1729673-1729695 CCGGTCTTCTATTAGTTTTTGAG 0: 2
1: 0
2: 2
3: 30
4: 456
Right 900261043 1:1729704-1729726 AAAAAAAGAAATGGAAACCCAGG 0: 1
1: 2
2: 22
3: 307
4: 2713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261043 Original CRISPR AAAAAAAGAAATGGAAACCC AGG Intronic