ID: 900261044

View in Genome Browser
Species Human (GRCh38)
Location 1:1729705-1729727
Sequence AAAAAAGAAATGGAAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1887
Summary {0: 1, 1: 0, 2: 15, 3: 165, 4: 1706}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900261038_900261044 24 Left 900261038 1:1729658-1729680 CCTGAGCTACCGCAGCCGGTCTT 0: 1
1: 0
2: 2
3: 29
4: 242
Right 900261044 1:1729705-1729727 AAAAAAGAAATGGAAACCCAGGG 0: 1
1: 0
2: 15
3: 165
4: 1706
900261040_900261044 9 Left 900261040 1:1729673-1729695 CCGGTCTTCTATTAGTTTTTGAG 0: 2
1: 0
2: 2
3: 30
4: 456
Right 900261044 1:1729705-1729727 AAAAAAGAAATGGAAACCCAGGG 0: 1
1: 0
2: 15
3: 165
4: 1706
900261039_900261044 15 Left 900261039 1:1729667-1729689 CCGCAGCCGGTCTTCTATTAGTT 0: 1
1: 0
2: 1
3: 8
4: 68
Right 900261044 1:1729705-1729727 AAAAAAGAAATGGAAACCCAGGG 0: 1
1: 0
2: 15
3: 165
4: 1706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900261044 Original CRISPR AAAAAAGAAATGGAAACCCA GGG Intronic