ID: 900263318

View in Genome Browser
Species Human (GRCh38)
Location 1:1744618-1744640
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 2, 1: 1, 2: 3, 3: 46, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900263316_900263318 4 Left 900263316 1:1744591-1744613 CCTTTCTGAACCTCATCTCAGAA 0: 2
1: 0
2: 4
3: 23
4: 292
Right 900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG 0: 2
1: 1
2: 3
3: 46
4: 278
900263313_900263318 22 Left 900263313 1:1744573-1744595 CCAGGACAGGAGCCCAGGCCTTT 0: 1
1: 1
2: 6
3: 50
4: 372
Right 900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG 0: 2
1: 1
2: 3
3: 46
4: 278
900263314_900263318 10 Left 900263314 1:1744585-1744607 CCCAGGCCTTTCTGAACCTCATC 0: 1
1: 1
2: 2
3: 24
4: 248
Right 900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG 0: 2
1: 1
2: 3
3: 46
4: 278
900263315_900263318 9 Left 900263315 1:1744586-1744608 CCAGGCCTTTCTGAACCTCATCT 0: 1
1: 1
2: 2
3: 40
4: 438
Right 900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG 0: 2
1: 1
2: 3
3: 46
4: 278
900263317_900263318 -6 Left 900263317 1:1744601-1744623 CCTCATCTCAGAAGTGACATCCT 0: 2
1: 9
2: 33
3: 138
4: 463
Right 900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG 0: 2
1: 1
2: 3
3: 46
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900254566 1:1691343-1691365 CATCCTTCCCTTCTGCTGTCTGG + Exonic
900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG + Intronic
901644330 1:10708628-10708650 CATCCAGCCCTTCTCCTGGCCGG + Intronic
902885978 1:19405113-19405135 CATCCGTCCCTTCTCATCTCTGG + Intronic
905254751 1:36673156-36673178 AATTCCTCCCTACTGCTGTCTGG - Intergenic
905882470 1:41473791-41473813 CCTCCTTCCGGTCTGCTGTCAGG + Intergenic
906778986 1:48555716-48555738 CATTCTTCCTGTCTGCAGTCTGG - Intronic
907011552 1:50968450-50968472 CGGCCTGCCCTTCTGCTGGCGGG - Exonic
907988692 1:59557771-59557793 CATCCTTTTCTTGAGCTGTCAGG + Intronic
910802422 1:91159508-91159530 AATCTTTCCCATCTGCAGTCAGG + Intergenic
911166891 1:94732257-94732279 CATCCTTCCCTGCTTCAGCCAGG - Intergenic
911440610 1:97921175-97921197 CCTCCCTCCCTTCTGCTTGCAGG - Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
911796023 1:102077074-102077096 CATCCCTCACTTCTGCTTCCTGG + Intergenic
913250619 1:116909909-116909931 GGTTCTTCCCTTCTGCTTTCGGG + Intergenic
914981216 1:152415990-152416012 CATCCTGCCCTCCTGCAGTCTGG - Intergenic
916260530 1:162837543-162837565 CAGACTTCCCTACTGCTGCCTGG + Intronic
919613642 1:199777901-199777923 CTTCCTGCCCTCCTGCTGTGTGG + Intergenic
919920631 1:202164638-202164660 CACCCTGCCCCTCTGCTGCCCGG + Intergenic
920387574 1:205579733-205579755 CACCCTTCCCTCCTGCAGCCTGG + Exonic
920872284 1:209805015-209805037 CACCCTTCCCTTCTGCTGGATGG + Intronic
921816463 1:219569437-219569459 GTTCCTTCCATTCTGCTGGCAGG - Intergenic
922975453 1:229779978-229780000 CATCTTTCCCATCTGCTGATGGG - Intergenic
923182096 1:231529301-231529323 CATCCTTCCCTTCTCTTCTTTGG - Exonic
1062965575 10:1605180-1605202 CTTCCTTCTCTTCTTCTGGCTGG + Intronic
1066345638 10:34582876-34582898 CTTTCTTCCTTTCTGCTGCCTGG + Intronic
1066467890 10:35669449-35669471 CATCCTCCCCTTCTGCACCCTGG + Intergenic
1068419624 10:56773303-56773325 CCTCCTTCCCTGCTGGGGTCTGG + Intergenic
1068741747 10:60481381-60481403 CAGCCTTACATTCTGCTGCCTGG + Intronic
1070354795 10:75629355-75629377 CCTCCTCCCCTTCTCCTTTCTGG + Intronic
1072197809 10:93131602-93131624 CATCCTGCCCTTCTGTGGCCTGG + Intergenic
1072298082 10:94031584-94031606 AATACTGCCCTTCTGCTGTCAGG - Exonic
1073134608 10:101213573-101213595 CCTCTTTCCCTCCTGCTGTGGGG - Intergenic
1074113324 10:110437891-110437913 GATCTGTCCCTTCTGCTCTCCGG + Intergenic
1074121044 10:110494821-110494843 CATGCCACCCTTCTGCTTTCTGG + Intergenic
1074597930 10:114884570-114884592 CATCCTTCCCTTCATTTGTCAGG + Intronic
1074946983 10:118289637-118289659 CATCCTTCCCTACCCCTCTCTGG + Intergenic
1075222632 10:120598425-120598447 CCTGCTTCCCAGCTGCTGTCTGG - Exonic
1075299335 10:121307413-121307435 CATCCTTCCCTTCTGCTCCCTGG + Intergenic
1076032767 10:127173612-127173634 CATCTTTCTCTTTTGCTGTCTGG + Intronic
1076144102 10:128103280-128103302 CCTCCTTCACTTCTACTTTCTGG + Exonic
1076406135 10:130213634-130213656 CTTCGTTCCCTTCAGCTTTCAGG + Intergenic
1077057015 11:598738-598760 CATTGTTCCCCTCTGCTTTCTGG + Intronic
1077190748 11:1255133-1255155 CAGCCATCCTTTCTGCTGTCGGG - Exonic
1077334467 11:1997286-1997308 CATCCTGCCCCTCTGCTGGGAGG + Intergenic
1081058370 11:38439748-38439770 CATCCTTAATTTCTGCTGGCTGG - Intergenic
1082785807 11:57315805-57315827 CTGCCTCCCCTTCTGCTATCAGG + Intronic
1083204441 11:61139668-61139690 CCTGCTTCCTTTCTGCTGACAGG + Intronic
1084459424 11:69287992-69288014 CAACCCTCCTTTCTGCTCTCTGG - Intergenic
1084909654 11:72378173-72378195 GTGCCTTCTCTTCTGCTGTCAGG - Intronic
1085803388 11:79612179-79612201 CAGTCTTCCCTTGTGCTGACTGG + Intergenic
1087389596 11:97516301-97516323 CATGCCTCCATTCTGCTGCCAGG + Intergenic
1087664761 11:101031374-101031396 CTGCCTTCCCAGCTGCTGTCTGG + Exonic
1087828289 11:102791211-102791233 CATCCTTTCCTTCAGATGGCTGG - Intronic
1089138166 11:116266024-116266046 CAGCCTTCCCTTCCCCTCTCTGG + Intergenic
1090429458 11:126634027-126634049 CATCCTTCCCTCCTGCTCTGGGG + Intronic
1202817450 11_KI270721v1_random:52468-52490 CATCCTGCCCCTCTGCTGGGAGG + Intergenic
1091917523 12:4280576-4280598 CTTCCTTCCCTTCTGCTGTCTGG + Intronic
1092205325 12:6611358-6611380 CAACCTTCCCTTCAGCTCCCTGG + Intergenic
1095976997 12:47946716-47946738 CATGCTGCCCTTGTGCAGTCTGG - Intergenic
1096519002 12:52173731-52173753 CATCCTTCACCTGTGCTGCCAGG + Exonic
1096536731 12:52279647-52279669 CCTCCTCCCCTCCTGCTGTGAGG + Intronic
1096815676 12:54200359-54200381 CACCCTTCCCTTCTGATGCGGGG + Intergenic
1097507525 12:60494516-60494538 CAACCTTCCTTTCTGCTCTGTGG - Intergenic
1100004793 12:89881725-89881747 CATCCTGCCCTTGTGCAGTGGGG + Intergenic
1100718148 12:97327483-97327505 CAACCTTTCCTTCTGCTACCTGG + Intergenic
1101083140 12:101209304-101209326 CATCTTTCCCTTCTACTGAGAGG - Intronic
1101514768 12:105424619-105424641 AATCCTTCCCTTCTGCTCTTGGG + Intergenic
1102168568 12:110824860-110824882 CTGCCTTCCCTCCTGCTGTGTGG + Intergenic
1102513503 12:113431279-113431301 CATGCTTCCCTAGTGCTCTCAGG - Intronic
1103899090 12:124294336-124294358 CATCCTTCCATTCTGCAAGCGGG - Intronic
1104010259 12:124925275-124925297 CATCCTGCTCTTCTGCTGCCAGG - Intergenic
1104014494 12:124952952-124952974 CATCCTTCCCTTCTCTTGCCTGG + Intronic
1104305784 12:127610025-127610047 CAACCTTCCCCTGTGCAGTCTGG - Intergenic
1105379481 13:19873797-19873819 CATTCTTTCCTGCTGCTCTCAGG + Intergenic
1106394787 13:29369071-29369093 TAACCTTTTCTTCTGCTGTCTGG - Intronic
1108257240 13:48622572-48622594 ACTCCTTCTCTTATGCTGTCAGG - Intergenic
1108295175 13:49009605-49009627 CAGGCTTTCCTTCTGCTATCAGG - Intronic
1108350216 13:49585204-49585226 CATCCTTCCCTCCTCCTCGCAGG + Intronic
1110921819 13:81097516-81097538 CATCCTTCCTTTCTGCTCTTAGG + Intergenic
1111979443 13:95001766-95001788 CTTCCTTCCCATGTGCTGTCTGG + Intergenic
1112759767 13:102680988-102681010 CATCCTCCTCTTCTGGTTTCCGG - Intergenic
1113895268 13:113760088-113760110 CATCCCTCCCTCCAGCCGTCAGG - Intronic
1113981972 13:114283765-114283787 TTTCCTTCTCTTCTCCTGTCAGG + Intronic
1114743531 14:25122370-25122392 CATCCTGTCTTTTTGCTGTCTGG + Intergenic
1116056644 14:39872427-39872449 CATACTTCAGTTCTGCTGTGTGG + Intergenic
1117652278 14:57919493-57919515 CATACTTCACTTCTGCAGGCAGG + Intronic
1118363771 14:65077038-65077060 CATCCTTTCCTGCTGTTGTGTGG - Intronic
1118492284 14:66272892-66272914 CCTCCTTCTCTTCTCCTGGCTGG + Intergenic
1119206372 14:72797125-72797147 CAAGCTTCCCTTCTGCTCTCCGG + Intronic
1120011157 14:79416216-79416238 CAACCTTCTCTTTTGCTGCCTGG + Intronic
1120975899 14:90248055-90248077 CATGCTTCCCTTCTGCTGCCAGG - Intergenic
1122632519 14:103113521-103113543 CATCTCTCCCTCCTGGTGTCTGG + Intergenic
1122895374 14:104753978-104754000 CTTCCTTCCCTTCCTCTGCCTGG - Intronic
1123460240 15:20463777-20463799 CAACCTTGCCCTCTGCTGTCTGG - Intergenic
1123657822 15:22536640-22536662 CAACCTTGCCCTCTGCTGTCTGG + Intergenic
1123983639 15:25625031-25625053 CAGCCTTCCCCTCAGCTGCCCGG - Intergenic
1124062998 15:26312825-26312847 CATCGTTCCCTTCTTTTCTCGGG + Intergenic
1124143686 15:27100437-27100459 TTTCCTTCTCTTCTGCTTTCTGG - Intronic
1124266461 15:28239506-28239528 CAACCTTGCCCTCTGCTGTCTGG - Intronic
1124311731 15:28631838-28631860 CAACCTTGCCCTCTGCTGTCTGG + Intergenic
1124465308 15:29933794-29933816 CATCCTCTCCCTCTGCTTTCAGG - Intronic
1124881178 15:33644312-33644334 CTTCGTGCCCATCTGCTGTCTGG + Exonic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1127577425 15:60305471-60305493 CAACCTTCCCTTCAGCTCTCTGG + Intergenic
1129856875 15:78831010-78831032 CGTGCTTCCCTTCAGCTGGCCGG + Intronic
1129878950 15:78994666-78994688 CATCATTCCCTTATTCCGTCTGG + Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130223421 15:82040484-82040506 CCCCCTTTCCTTCAGCTGTCTGG - Intergenic
1132336316 15:101050654-101050676 CCACCTTCCCTGATGCTGTCTGG - Intronic
1133919794 16:10141814-10141836 CATCATTCCCTTCTGAGCTCTGG - Intronic
1134035234 16:11024974-11024996 CATCCTTCCCCTCTGCTGCATGG + Intronic
1134590472 16:15448843-15448865 CATCCTCGCCTTCTGCTTTGAGG + Intronic
1136704655 16:32176952-32176974 CAACCTTGCCCTCTGCTGTCTGG - Intergenic
1136763258 16:32752454-32752476 CAACCTTGCCCTCTGCTGTCTGG + Intergenic
1136804842 16:33117932-33117954 CAACCTTGCCCTCTGCTGTCTGG - Intergenic
1137415362 16:48272760-48272782 CAACCTGCCCTTGTGCTGTTGGG + Intronic
1137977539 16:53044038-53044060 CATCCTTGCAGTCTGCTGCCTGG + Intergenic
1139078975 16:63490779-63490801 CATCCTTCCCTTTTCCTGATGGG + Intergenic
1139341908 16:66272926-66272948 AATCCTTCACTCTTGCTGTCTGG - Intergenic
1141938157 16:87255620-87255642 CCTCCATCCCTTCCTCTGTCTGG - Intronic
1142417672 16:89951731-89951753 CATCCCTGCCTCCTGCTGCCTGG - Intronic
1203065409 16_KI270728v1_random:1012776-1012798 CAACCTTGCCCTCTGCTGTCTGG + Intergenic
1142877880 17:2863220-2863242 CAACCTTCCCTTCTCCTTCCAGG + Intronic
1143287717 17:5802716-5802738 TATCCTTCCCTTGGCCTGTCTGG + Intronic
1143310853 17:5987789-5987811 CATCCCTCCCTCCTGCCTTCTGG - Intronic
1144754157 17:17669334-17669356 CAGCCTTCCCTTCTGCTCAGTGG - Intergenic
1144758335 17:17693617-17693639 CCTCCTTCCCTTCAGCTGGCTGG + Intronic
1145990187 17:29074631-29074653 CACCCTGACCTTCTTCTGTCAGG - Exonic
1146432422 17:32810214-32810236 CAGCCTCCCTGTCTGCTGTCTGG - Intronic
1147540300 17:41351741-41351763 CTTCCTTCCCTTCTTCAGACAGG + Intergenic
1147584755 17:41647855-41647877 CATCCTTTTCTGCTGCTGCCGGG - Intergenic
1147587792 17:41662689-41662711 CTTCCTTCCCTGCTGCTGTTAGG + Intergenic
1150387344 17:64772793-64772815 CCTCCTTGCCTTCTCCTGGCTGG - Intergenic
1151852299 17:76698190-76698212 CATCCTTGCCTGCTGCAGGCAGG - Intronic
1152250973 17:79212385-79212407 CTTCCTTCCCTCCTGCAGCCGGG + Intronic
1153776696 18:8460703-8460725 CATCATTCACTTCTGCTCTGAGG - Intergenic
1155063978 18:22253286-22253308 CATCCTTCCTTGCTCCTGGCAGG - Intergenic
1156902427 18:42316048-42316070 CTACCTTCCCTTCTGCCCTCTGG + Intergenic
1157399286 18:47373603-47373625 CACCCTTCCCTCCTGCTCTGTGG + Intergenic
1159020015 18:63135730-63135752 CATCCTTCCTTTCTGACCTCAGG + Intronic
1159895381 18:73991162-73991184 CTCTCTTCCCTTCTGCTGGCTGG + Intergenic
1160008014 18:75082565-75082587 CATCCTTGCCTTGCGCTGTTGGG - Intergenic
1160690738 19:459922-459944 TAACCTTCCCCTCTGCTGACGGG - Intronic
1163476546 19:17529462-17529484 CATAGTTCCATTCTGCTGCCCGG - Intronic
1165013852 19:32866805-32866827 CCTCCATCCCCTCTGCTGCCAGG + Intronic
1168233573 19:55048075-55048097 TGTCCTTCCCTGCTGCTGTTGGG - Intronic
1202702475 1_KI270712v1_random:174942-174964 AATGCTGCCCTTATGCTGTCGGG + Intergenic
927044732 2:19265471-19265493 TTTCCTCCCTTTCTGCTGTCTGG - Intergenic
927196998 2:20554969-20554991 CATCCTGCCCTTCTGCCATGCGG + Intergenic
927884323 2:26709400-26709422 CCTCCTTCCCATCTCCTGGCAGG - Intronic
929528182 2:42725822-42725844 CACACTTCCCCTTTGCTGTCTGG - Intronic
929880941 2:45836905-45836927 TTCCCTTCCCATCTGCTGTCAGG - Intronic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
930026771 2:47033874-47033896 CTTCCTTCCCTGCCTCTGTCAGG - Intronic
930936196 2:56955149-56955171 CCTCCTTCCCTGCTGTTCTCAGG + Intergenic
931013248 2:57943671-57943693 CTTCCTTCCCTTTTGTTGTCTGG - Intronic
931964968 2:67523093-67523115 CATCCTGCCGGTCTGCTATCAGG + Intergenic
932355953 2:71068607-71068629 CCTCCTTCCCTCCAGCTGTCTGG - Exonic
932403620 2:71499563-71499585 CCTCCTTCCCTTCTGCCATACGG + Intronic
933689787 2:85171082-85171104 CTCCTTTCCCTTCTGCTGTGAGG - Intronic
933969685 2:87460338-87460360 CTTCCTTCCTCTCTTCTGTCTGG - Intergenic
934614181 2:95761199-95761221 CACCCTTCCCTTTCACTGTCAGG + Intergenic
934632223 2:95939732-95939754 TATCATTCGCTTCTGCTGGCAGG + Intronic
934801279 2:97163550-97163572 TATCATTCGCTTCTGCTGGCAGG - Intronic
934988173 2:98902173-98902195 CATTCTTCCCTTGTGCCGTATGG - Intronic
935987678 2:108690240-108690262 CACCCCTCCATTCTGCAGTCTGG - Intergenic
936126506 2:109792941-109792963 CACCCCTCCATTCTGCAGTCTGG - Intronic
936218187 2:110578527-110578549 CACCCCTCCATTCTGCAGTCTGG + Intergenic
936324100 2:111490159-111490181 CTTCCTTCCTCTCTTCTGTCTGG + Intergenic
938120162 2:128627406-128627428 CATGCCTCCCTTCTGCTCTTCGG + Intergenic
938568737 2:132543268-132543290 CATCCTTCCAGTGTGCTTTCAGG + Intronic
938630374 2:133160209-133160231 GATCCTTCCCTACTGCCTTCAGG - Intronic
939813672 2:146867724-146867746 GAGCCTCCCCTTTTGCTGTCAGG + Intergenic
940883933 2:158972416-158972438 CATCCTTCCCTTATGCTGTTGGG + Intronic
941503135 2:166306440-166306462 CATCCTTTCCTTTTCCTGCCAGG - Intronic
942087629 2:172458077-172458099 CATCGTTCCCTACCTCTGTCTGG + Intronic
942118122 2:172749065-172749087 CCTCCTTCCCTGCTGCTTTTAGG + Intronic
942875881 2:180797032-180797054 CTTCCTTCCCTTTTGCTATGTGG + Intergenic
943441898 2:187935417-187935439 CACTCTTCACTCCTGCTGTCTGG + Intergenic
943720205 2:191196357-191196379 CTGCCTTCCAGTCTGCTGTCTGG - Intergenic
945393274 2:209291002-209291024 CATCCTCACCTCCTGCTGTGTGG + Intergenic
949045536 2:241871150-241871172 CATCCTTCCCCTCAGCTGGCAGG + Intronic
1168848402 20:960435-960457 CTTCCTGCCCTTCTTCTGGCCGG + Exonic
1168918324 20:1509870-1509892 CATTCTGCTCTTCTGCTGCCAGG - Intergenic
1168937150 20:1675122-1675144 CATTCTCCCCTTGGGCTGTCAGG - Intergenic
1169017348 20:2302639-2302661 TCTTCTTCCATTCTGCTGTCTGG - Intronic
1169196503 20:3685726-3685748 CATCTTTCCCAGGTGCTGTCAGG - Intergenic
1169222559 20:3833988-3834010 CCTCCTTCCCTCCCTCTGTCAGG + Intergenic
1171043563 20:21789208-21789230 CTTCCATCCCTGCTGCAGTCCGG + Intergenic
1171406869 20:24917652-24917674 CGTCCCTCCCATCTGCTTTCTGG + Intergenic
1172500303 20:35421478-35421500 CCCCCTTCCCTTCTTCTTTCTGG - Intergenic
1172747909 20:37227229-37227251 CTTCCTTCCCTTGTGCTATTTGG - Intronic
1172833014 20:37852671-37852693 CACCCTCCCCTCCTGCAGTCAGG + Intronic
1172967172 20:38845119-38845141 CTTCCTTGCATTCTGCTTTCTGG - Intronic
1174050052 20:47761256-47761278 CATCCCTGCCATCTTCTGTCTGG - Intronic
1174985295 20:55444765-55444787 CATCCTTCCTTTCTGCCATCCGG - Intergenic
1175344861 20:58265589-58265611 CATCCTCCCATTCTGCCATCTGG - Intergenic
1176417593 21:6486843-6486865 CGTCCTTCAGTTCTGCTGGCTGG + Intergenic
1177016262 21:15791906-15791928 TATCCTTTCCTTCTGCTTTTAGG + Intronic
1178917332 21:36713769-36713791 CATCCTTCTCTTCTGATGTATGG + Intronic
1179693089 21:43095174-43095196 CGTCCTTCAGTTCTGCTGGCTGG + Intronic
1179861489 21:44191801-44191823 CATCCTCACCTCCTGCTGTGCGG - Intergenic
1179902685 21:44402125-44402147 CATCCTTCCCTCCTGGAGACCGG + Intronic
1183060927 22:35335950-35335972 CATCTTTCCCAGCTGCTGTGCGG - Intronic
1183622334 22:38981905-38981927 AAGCCTTCCCTTGTGCTGTGCGG + Intronic
1184004836 22:41700153-41700175 CCTCATTCCCTTCAGCTGTCGGG + Intronic
1184120147 22:42444686-42444708 CATCAATCTCCTCTGCTGTCAGG - Intergenic
1184358050 22:43995826-43995848 CATCCTTCCTTCCTGGGGTCAGG + Intronic
1185219607 22:49622784-49622806 CTTTCTTCCCCTCTCCTGTCTGG - Intronic
950344503 3:12280194-12280216 CAACCGTGGCTTCTGCTGTCAGG + Intergenic
950361215 3:12450651-12450673 CATCCTCCCCCTCTGGTTTCTGG - Intergenic
950488139 3:13284976-13284998 CCTCCTCCCCTTATGGTGTCTGG - Intergenic
952203986 3:31160828-31160850 CATTCTTCCATTCTGCTTCCTGG - Intergenic
953454804 3:43032848-43032870 GATCCCTGCCTTCTGCTGTATGG - Exonic
954883008 3:53848360-53848382 CATCCTTCCCTGCTGCAAGCAGG - Intronic
955364897 3:58302526-58302548 CACACTTCCCCTCTGCTGTGTGG - Intergenic
955538501 3:59950124-59950146 CATCCTTCTCTTCTTCTCTCTGG + Intronic
955841524 3:63117870-63117892 CTTCCTTTCCTGCTTCTGTCTGG + Intergenic
957333522 3:78796723-78796745 CTTCCTTCCTTTCTCCTGACTGG + Intronic
959056428 3:101572285-101572307 CATCCTTAACTTCTGCAGTGTGG + Intergenic
959858531 3:111190000-111190022 CATCCCTGCCTCCTGCTGTGTGG - Intronic
961787014 3:129353422-129353444 TTTCCTTCCCTTCTGCTGGGAGG + Intergenic
962410064 3:135133133-135133155 CATCCTGCCCGTGTACTGTCAGG + Intronic
964787641 3:160415966-160415988 CATCCTTCTCTCCTGATTTCAGG - Intronic
965549449 3:169949431-169949453 CACACTTTCCTTCTGCTGTTTGG - Intergenic
966836455 3:184053069-184053091 CCTCCTTCCATTCTTCTTTCTGG - Exonic
968255554 3:197266862-197266884 CTTCCTTCCCCTTTGCTTTCAGG - Intronic
969320566 4:6409943-6409965 CTTCCCTGCCTTCTGCTCTCAGG + Intronic
970006302 4:11414111-11414133 CATGCTTAGCTTCTGCAGTCAGG + Intronic
970102195 4:12537489-12537511 CATGCAGCCCTGCTGCTGTCTGG - Intergenic
970509245 4:16764302-16764324 CTTGCTTCCATTCTGTTGTCTGG + Intronic
971068233 4:23059440-23059462 CATCCTGCCCCACTGCTGTTGGG + Intergenic
972298413 4:37762234-37762256 CATCCTTCCCTGCTGTGATCAGG - Intergenic
974594385 4:63997454-63997476 CATGCCTCCCTTCTGCTGACAGG + Intergenic
974954150 4:68617754-68617776 CAACCTTCCTTTCTGCAGTCAGG + Intronic
983335043 4:166380061-166380083 TTTCCTTCGCTTCTGCTGGCAGG + Intergenic
983982048 4:174009871-174009893 CATCTTGCCCTTCTGCTTTTAGG + Intergenic
984157186 4:176207283-176207305 CATCCCTCCCCTCTGTTGTGAGG + Intergenic
985220993 4:187705354-187705376 CTTCCTTTCCTTCTGGTGTGGGG + Intergenic
985361459 4:189179825-189179847 CATCCCTCCCCTCTGGTGTGGGG + Intergenic
985509652 5:305614-305636 CATCCTTCCCTGCTGGTGTGTGG + Intronic
985785345 5:1890311-1890333 AACACTGCCCTTCTGCTGTCAGG - Intergenic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG + Intronic
987731130 5:21774275-21774297 CATCATTCCCTTGTGCTGGATGG + Intronic
987999335 5:25330055-25330077 CATCCTGCTCTTTTGCTGGCAGG - Intergenic
992137628 5:73763271-73763293 CATCCTTTCCTTCACCTGTAAGG - Intronic
992167870 5:74072909-74072931 CCTCTTTCCCTTCTTCTCTCTGG + Intergenic
995648032 5:114335248-114335270 TTTCCTCCCCTTCAGCTGTCTGG + Intergenic
996639598 5:125736270-125736292 CATCCCTCCAGCCTGCTGTCTGG - Intergenic
996912725 5:128673837-128673859 CATTCTTCAATTCTGCTTTCTGG - Intronic
998427469 5:142040981-142041003 CATTCTTTCCTTCTGGTGTGAGG - Intergenic
998461990 5:142316671-142316693 GATCCTGCCCCTCTGCTGTTAGG + Intronic
999447795 5:151654650-151654672 CACCCTCCCCTTCTCCTCTCAGG + Intergenic
1002024287 5:176386361-176386383 CATCCTTCCCCTTACCTGTCAGG - Intronic
1003127194 6:3364714-3364736 CATGCTGCGCTTCTCCTGTCAGG - Intronic
1003393073 6:5729927-5729949 CATCCCTGGCTTCTGCTGACTGG + Intronic
1003631059 6:7787861-7787883 CATCCTTCCTTTTTGCTGATAGG + Intronic
1004502712 6:16223232-16223254 CGTCCTTTCCTTTTGCTGTGTGG - Intergenic
1004924604 6:20404157-20404179 CTTCCTTCCCTTGTGCTGGAGGG + Intronic
1005489813 6:26337217-26337239 CATCCTTGCCTTCTGGCTTCTGG - Intergenic
1005563588 6:27066609-27066631 CATCCTTCTCCTCTGCTGTGAGG - Intergenic
1006392156 6:33764792-33764814 CATCGTTCCCTCCAGCTGTGTGG + Intergenic
1007321631 6:41032311-41032333 CATCCTTTCCTGCTTCTGTGGGG + Intronic
1007770193 6:44185992-44186014 CAGCCTCCCCTTCTGGTTTCTGG + Intergenic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1010997860 6:82554010-82554032 TATCCTGCTCTTCTGCTGGCAGG - Intergenic
1012972898 6:105750537-105750559 CATGCTTCCCTTCTGATTTCTGG + Intergenic
1013060205 6:106626143-106626165 CTACCTTCCCTCCTGCTGTATGG - Intronic
1014513178 6:122349779-122349801 CATCCTTCACTACTTCTCTCTGG - Intergenic
1017216619 6:151915246-151915268 CATTCTCCCTTTCTGCTGTTGGG + Intronic
1018581191 6:165309589-165309611 CTTCCTTCCCTCCAGCTGCCTGG + Exonic
1022351004 7:29566100-29566122 CTTTCCTCCCTTATGCTGTCTGG - Intronic
1023036305 7:36134350-36134372 CATCCTTCCCCCTTGCTGCCTGG - Intergenic
1023675340 7:42622882-42622904 CACCCTTTCCTACAGCTGTCAGG + Intergenic
1023843463 7:44108948-44108970 CCTCCTTCTCTTCGTCTGTCTGG - Exonic
1024242227 7:47444559-47444581 CCTCCTTCCCTCCTGCCGTCAGG - Intronic
1026269287 7:68822466-68822488 CAACCTCCCCTTCTCATGTCAGG + Intergenic
1028955879 7:96689782-96689804 CATCCTTGTCTTCTGCTATGGGG + Intronic
1030250306 7:107436123-107436145 CATCCTTCCCAACTTCTGTCTGG - Intronic
1031895195 7:127340199-127340221 CTTCCTTCCCTTTTTCTTTCTGG + Intergenic
1031971365 7:128067368-128067390 CATCATTTCCATGTGCTGTCTGG - Intronic
1033029459 7:137811201-137811223 ACTCCTTACCTACTGCTGTCAGG + Intronic
1033479084 7:141721248-141721270 TTTCTTTCCCTTCTGTTGTCAGG + Intronic
1035079408 7:156203742-156203764 GAAGCTTCCCTTCCGCTGTCTGG + Intergenic
1036289833 8:7477648-7477670 CACTCTTCCCTTCTCCTTTCAGG - Intergenic
1036331646 8:7833879-7833901 CACTCTTCCCTTCTCCTTTCAGG + Intergenic
1037656151 8:20885952-20885974 CATCCTTCTTTTCTTCTCTCTGG - Intergenic
1037778983 8:21854939-21854961 CCTCCTTCACTGCTGCTCTCTGG - Intergenic
1039971789 8:42326564-42326586 CCTCCTGCCTTTCTGCTGCCAGG + Intronic
1040840486 8:51779572-51779594 CATCCTTTCTTTCTGCTGCCTGG - Intronic
1042408605 8:68435450-68435472 CATGCTTCCCTGCTGCAGGCTGG - Intronic
1043307031 8:78807146-78807168 CATACTTCAATGCTGCTGTCAGG - Intergenic
1045266343 8:100621814-100621836 CTTCCTTTCCTCCTCCTGTCTGG + Intronic
1048674108 8:136757703-136757725 CATCTTTCCTTCCTGCTGTATGG + Intergenic
1048942652 8:139415214-139415236 GTTCCTTCCCTTCTGCTCTAAGG - Intergenic
1049148871 8:141021540-141021562 CCTCCTTCCCTTTTGCGATCTGG - Intergenic
1049612915 8:143563759-143563781 CAGCCTTCCCCACTTCTGTCAGG + Intergenic
1049815232 8:144596136-144596158 CAGCCGTCCCCTCTGCTGCCAGG - Intronic
1051605215 9:18911642-18911664 CATTCTTCCCTACTGCTTTAAGG + Intergenic
1052915068 9:33918873-33918895 CCTCCTTCCATTCTGATCTCAGG + Exonic
1053000847 9:34576678-34576700 CTTCCTTCACCTCTCCTGTCTGG - Intronic
1053122163 9:35555501-35555523 ACTCCTGTCCTTCTGCTGTCCGG + Exonic
1053618198 9:39791542-39791564 CAGCCTTCCCTTATGCTGCTGGG + Intergenic
1053876372 9:42550912-42550934 CAGCCTTCCCTTATGCTGCTGGG + Intergenic
1053896299 9:42743783-42743805 CAGCCTTCCCTTATGCTGCTGGG - Intergenic
1054265958 9:62915887-62915909 CAGCCTTCCCTTATGCTGCTGGG - Intergenic
1055249136 9:74281413-74281435 CATCCATTTCCTCTGCTGTCAGG + Intergenic
1055392894 9:75842360-75842382 CAGCCTTCTCTTCTGCTTTTTGG - Intergenic
1055796145 9:79976871-79976893 CATCATTCCCTCCTCCTGGCTGG - Intergenic
1057440423 9:95079036-95079058 CCTCCTTCCCTTTTGCTCTGAGG + Intronic
1057875246 9:98748585-98748607 TCTCCTTCCATCCTGCTGTCTGG + Intronic
1059205962 9:112465798-112465820 CATCTTTTGTTTCTGCTGTCTGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062150157 9:135013984-135014006 CCTCCTTCCCTTCCCCTTTCTGG + Intergenic
1062209209 9:135354314-135354336 CATCGTTCCCTGCTACTGCCTGG - Intergenic
1186338925 X:8622551-8622573 CATCATTTCATTCTGATGTCGGG + Intronic
1187272764 X:17793648-17793670 CATCCTTCCCTTCCACTGAAGGG - Intergenic
1189465581 X:41275837-41275859 CCTCCCTCCCTCCTGCTGGCTGG + Intergenic
1191736574 X:64394567-64394589 CTTCCCTCCTTTCTCCTGTCTGG - Intronic
1192139661 X:68636947-68636969 CTTCCTTCCCTTCTGATATAAGG + Intergenic
1192202409 X:69074954-69074976 CATTCTTCCCCTCTGGTCTCAGG + Intergenic
1192369717 X:70503420-70503442 CTGCTTTCCCTTCTGCTGACAGG - Exonic
1193675982 X:84453464-84453486 CATTGTTCTCTTCTGCTGACAGG - Intronic
1195218083 X:102720559-102720581 CAGCCTTCCTTCCAGCTGTCTGG + Intergenic
1195485481 X:105400036-105400058 CATCTCTCCCTTCTGCTGCCTGG - Intronic
1197276282 X:124483242-124483264 CAGTCTTCCCTTCTCCAGTCTGG + Intronic
1199172083 X:144744167-144744189 CATTCCTCCCTTCTGCTGCCAGG - Intergenic
1202103861 Y:21340584-21340606 CCTCCTTCTCTCCTGCAGTCTGG - Intergenic