ID: 900263643

View in Genome Browser
Species Human (GRCh38)
Location 1:1746226-1746248
Sequence GCCTCTCCGCGGCCGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900263643 Original CRISPR GCCTCTCCGCGGCCGCCTGG TGG Intergenic
900094657 1:935413-935435 GCCTCTTCCCGGGCGCCCGGTGG + Intronic
900180532 1:1309079-1309101 GCCGCTCGGCGGCCTCCTGCAGG - Exonic
900254894 1:1692947-1692969 GCCTCTCCGCTGCCGCCTGGTGG + Intronic
900263643 1:1746226-1746248 GCCTCTCCGCGGCCGCCTGGTGG + Intergenic
900489241 1:2938680-2938702 GCCTCTCCGCAGCCCCTTGGAGG - Intergenic
900489576 1:2940484-2940506 CCCTCTCCGCAGCCCCTTGGAGG - Intergenic
901059690 1:6466217-6466239 GCCTCCCCCCGCCCGCCAGGCGG - Exonic
902690542 1:18107964-18107986 GCCTGGCCGCGGCGGCATGGGGG + Exonic
905366682 1:37455398-37455420 GCCTCTGCCCAGCCGCCTGCAGG + Intergenic
905943583 1:41883661-41883683 GCCTGTCAGAGGCAGCCTGGTGG + Intronic
907178826 1:52552784-52552806 GCGTCTCAGCCGCCCCCTGGGGG - Intronic
912449541 1:109760668-109760690 GCCTCTCCTCGGCTGGCTAGGGG + Intronic
912565414 1:110584157-110584179 ACCTCTCCTCTGCCGGCTGGTGG - Intergenic
913545125 1:119860427-119860449 GCCTCTCCTCTGCAGGCTGGAGG - Intergenic
914677007 1:149913425-149913447 GCCTCCCCCCGGCCCCCAGGGGG + Exonic
915328288 1:155092548-155092570 GCCTCTCAGAGGCAGGCTGGTGG - Intergenic
915559377 1:156677443-156677465 CCCTCTTCCCGCCCGCCTGGCGG - Intergenic
916259038 1:162822480-162822502 CCCTCACTGCGGCCGCCGGGCGG + Intergenic
916717061 1:167455274-167455296 GCCTCCCCGCGTCCGGCTTGGGG + Intronic
922766457 1:228158885-228158907 GCCTCCCTGCGGCCTCCCGGGGG + Exonic
924441555 1:244089706-244089728 GCCTCTCAGCAGCTGCCTTGGGG - Intergenic
1062787504 10:277890-277912 GCCTCTTTGCTGCTGCCTGGAGG + Intronic
1070147470 10:73785596-73785618 GCGGCTCCGCAGCCGCCTAGAGG + Intronic
1070752722 10:78973630-78973652 TCCGCTCCGCGACCTCCTGGCGG - Intergenic
1070895775 10:79982131-79982153 GGCTCTCCGGGCGCGCCTGGCGG + Intronic
1072582336 10:96750326-96750348 CCATCTCCTGGGCCGCCTGGCGG + Intergenic
1073268335 10:102241555-102241577 GGCTCGCCGCGGCGGGCTGGGGG - Intergenic
1073363514 10:102918600-102918622 GCCGCCCCGCAGCCGCCTGCAGG - Exonic
1074830162 10:117241955-117241977 GCCCCGGCGCGGCAGCCTGGAGG - Intronic
1075040634 10:119104398-119104420 GCCCGCCCGCGGCCGCCTGTGGG + Intronic
1078361951 11:10675955-10675977 GCCTCTCCCCTGCCTCATGGAGG + Intronic
1081566432 11:44263884-44263906 GCCCCTCCGCATCCTCCTGGAGG + Exonic
1083033464 11:59615432-59615454 GCCCCTGCGCCGCCGACTGGGGG - Exonic
1083843138 11:65315745-65315767 CCGGCTCCGCGGCCGCCAGGTGG - Intronic
1083879354 11:65540453-65540475 GCTTCCCCACGGCCGCCGGGGGG + Intronic
1084087531 11:66861428-66861450 GCCTCACCTCGGCTGCCCGGTGG - Intronic
1084185268 11:67468040-67468062 GCCTCTCCGGAGCCGGATGGGGG - Exonic
1084284220 11:68121180-68121202 GCGCCTCCTCGGCCGCCTGTCGG - Exonic
1084528618 11:69713282-69713304 GCCTCTTCGCTGCAGCCGGGTGG - Intergenic
1084892922 11:72245209-72245231 CCCTCTCCGCAGCCCCGTGGAGG - Intronic
1086455615 11:86956072-86956094 GCCTCCCCGCTGGCGGCTGGAGG - Intergenic
1089273209 11:117315690-117315712 GCCCCTGCGCAGCGGCCTGGGGG - Exonic
1089555736 11:119315248-119315270 GCCTCTCCGGGCACACCTGGGGG + Exonic
1090013259 11:123062917-123062939 CCCACCCCGCGGCGGCCTGGCGG - Intronic
1090817777 11:130314425-130314447 GCCTCGCCGCCCCAGCCTGGCGG - Exonic
1091599270 12:1908218-1908240 GCCTCTCCGCGCCGGCCTCCTGG - Intronic
1091758539 12:3072088-3072110 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1093157170 12:15700112-15700134 GCCTCTGCACTGCAGCCTGGGGG + Intronic
1094528818 12:31252539-31252561 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1096101238 12:48971612-48971634 GCGCCGCCGCGGCCGCCGGGAGG + Exonic
1100260656 12:92929338-92929360 GCCCGCCCGCGGCCGCCGGGGGG + Intergenic
1103309393 12:119992437-119992459 GCCACTCCACTGCAGCCTGGGGG - Intronic
1103800578 12:123534360-123534382 GCCTCTGCAAGTCCGCCTGGTGG - Intergenic
1104585131 12:130042378-130042400 GCATCTCCGCGGCAGCTTGCAGG + Intergenic
1104633514 12:130424285-130424307 GCCTCTCCGGGCCGGGCTGGGGG + Intronic
1105520123 13:21124072-21124094 GCCTCGCAGCGGGTGCCTGGAGG + Intergenic
1106422319 13:29594891-29594913 GACTCTGCCCGGCCGCCCGGAGG - Intronic
1107935170 13:45340606-45340628 TCCTCCCCGCCGCCTCCTGGCGG - Intronic
1108828156 13:54441255-54441277 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1113378259 13:109783419-109783441 GCCTAGCGGCGGCCGCCCGGAGG - Exonic
1113869344 13:113548568-113548590 GCCTCTGCGTGCCCCCCTGGAGG - Intronic
1116620820 14:47201044-47201066 CCATCTCCTGGGCCGCCTGGCGG - Intronic
1117441700 14:55766215-55766237 CCATCTCCTGGGCCGCCTGGCGG + Intergenic
1118604436 14:67492372-67492394 GCCTCTCAGCCGCTGCCTGATGG - Intronic
1122082401 14:99274649-99274671 GCCTCTCCCCGGCTGCCGCGAGG - Intergenic
1122209441 14:100165572-100165594 GCCCGTCCGCGGCCGCCCGGTGG - Intergenic
1122635374 14:103127264-103127286 GCCCCGCCGCCGCCGCCTGGCGG - Exonic
1122888888 14:104723714-104723736 GGCTCTTCGCGGCCGCCAGGGGG + Intergenic
1123039949 14:105486399-105486421 GCATCTCCGAGCCGGCCTGGGGG + Intergenic
1125688076 15:41575451-41575473 GCCTCACCCAGGCAGCCTGGTGG + Intronic
1126034920 15:44537029-44537051 GCGTCGCCGCCGCCGCCTGAGGG + Intergenic
1130613485 15:85381337-85381359 GCCTCTCCGCGGCTTCTCGGGGG + Intronic
1132575734 16:662953-662975 GGCTCGCAGCGGCCGCCTTGGGG + Intronic
1133209998 16:4258153-4258175 GCCTGTCCGCAGCTGCCCGGAGG - Exonic
1136518839 16:30783883-30783905 GCTTCTCCGCCCCCGCCGGGCGG + Exonic
1139394219 16:66627060-66627082 GCCTCTGCACTGCAGCCTGGGGG + Intronic
1139959972 16:70711911-70711933 GCCTCTCAGAGGCCGCCGTGAGG - Intronic
1140205177 16:72927671-72927693 GCCCCTCCGGAGCCGCCCGGGGG + Intronic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1142239549 16:88938965-88938987 GCCTCGCCGCTGCCGCCTCTGGG - Intronic
1142888533 17:2928445-2928467 GCGTGTCCGGGGTCGCCTGGGGG + Intronic
1143015845 17:3890788-3890810 CCCTCTCCTCTGCTGCCTGGAGG + Intronic
1143495069 17:7308012-7308034 GCCCCGGCGTGGCCGCCTGGCGG - Intronic
1145750061 17:27349236-27349258 TCCTCCCAGCGGCCTCCTGGCGG - Intergenic
1145765510 17:27456262-27456284 GCCTCGCCGCGGCCGCCGGGAGG + Intergenic
1146332259 17:31937192-31937214 TGCTCTCCGGGGCCGCCCGGCGG + Exonic
1150060626 17:62065464-62065486 GCCGCGCCGCGCTCGCCTGGCGG + Intergenic
1151850117 17:76685039-76685061 GCCCCTTCGCTGGCGCCTGGCGG - Intronic
1152237967 17:79148285-79148307 GCCTCTCGGCTGCCTCCTGCAGG + Intronic
1154246363 18:12702907-12702929 CCCTCTTCGCGGCCACCCGGCGG + Exonic
1159559982 18:69983728-69983750 GACTTTCCGGGGCTGCCTGGAGG - Intergenic
1159560078 18:69984261-69984283 GACTTTCCGGGGCTGCCTGGAGG + Intergenic
1160823625 19:1069313-1069335 GGCTGTCAGCGGCCGCGTGGAGG - Intronic
1161395637 19:4043659-4043681 CCCTCGCCGGGGCTGCCTGGAGG - Intergenic
1162079564 19:8209933-8209955 ACCTCACCCCGGCCGCCTGATGG - Intronic
1162581868 19:11536219-11536241 GCCCCTCCCGGGCCGCCAGGGGG + Intergenic
1162585997 19:11558982-11559004 GCCTCCCGACGGCCGCCGGGAGG + Intronic
1163793377 19:19321221-19321243 GCCGCTCCTCGGCGACCTGGGGG + Intronic
1167164683 19:47790554-47790576 GCCTCTCTGCTGCCCCCTGGTGG - Intergenic
1167437777 19:49489873-49489895 CCATCTCCTGGGCCGCCTGGCGG + Exonic
1168651944 19:58097497-58097519 GCCTCTCCCCAGTCACCTGGGGG - Intronic
925191818 2:1891352-1891374 GGTTCTCCCCAGCCGCCTGGTGG + Intronic
925191824 2:1891364-1891386 GCCTCGCCGAGGCCACCAGGCGG - Intronic
927869700 2:26615703-26615725 GCCTTGCCGCTGCCACCTGGCGG - Intronic
930356278 2:50324787-50324809 GCCTCTCCAGGGCCATCTGGTGG - Intronic
934649847 2:96084629-96084651 CACTCTCCACGACCGCCTGGAGG - Intergenic
937917363 2:127105787-127105809 CCCGCTGCGCGGCCGCCGGGTGG - Intronic
940751158 2:157628647-157628669 GCCCCGGCGCGGCCGCCTGGTGG - Exonic
940878667 2:158923555-158923577 GCCTCTCTGCAGGCGACTGGGGG + Intergenic
947592934 2:231395586-231395608 CCCGCCCCGCCGCCGCCTGGCGG - Exonic
948116719 2:235498805-235498827 TCCTCTCATCGGCCACCTGGTGG - Intronic
948194505 2:236085368-236085390 AGCTCTCCCCAGCCGCCTGGAGG + Intronic
1175085912 20:56458684-56458706 GCTTCTCAGCCTCCGCCTGGAGG - Exonic
1175847594 20:62066480-62066502 GCTTCCCCGCGGCGGCTTGGAGG - Intergenic
1176242826 20:64083018-64083040 CCCTCTCCCTGGCCCCCTGGTGG + Intronic
1179891815 21:44339085-44339107 GCCTGGCCGCGGCCGCCCCGGGG - Intronic
1180737009 22:18024613-18024635 GCAGCTCCGCGGCCTCCTGGGGG - Intergenic
1182445587 22:30387505-30387527 AGCTCTCCGCGGCCACCAGGGGG - Intronic
1182583097 22:31327043-31327065 GGCTCTCGGGGGCCCCCTGGGGG - Exonic
1183140003 22:35928517-35928539 GCCTCTCTGCTGAGGCCTGGTGG - Intronic
1183441464 22:37825351-37825373 GCGTCTCCGGGGCAGCCGGGTGG - Exonic
1184059626 22:42074166-42074188 GGATCTCCGAGGCCGCCTCGAGG - Intergenic
1184276442 22:43411856-43411878 GCCTCTCCGCGCCCGGCCGCCGG - Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
950683896 3:14602979-14603001 GCATCCCCGCGGCCGCCCTGCGG + Intergenic
952421146 3:33132371-33132393 GGGTCTCCACGGCAGCCTGGAGG - Intronic
953890914 3:46750907-46750929 CCGTCTCCGCAGCCGCCAGGTGG - Intronic
956179134 3:66501104-66501126 CGCGCTCCGCGGCCGCCTGCTGG + Intronic
960395639 3:117133286-117133308 GCCTCTCCCCTGAAGCCTGGGGG - Intronic
961552209 3:127675963-127675985 GCCTCGCAGCGGGCTCCTGGGGG - Exonic
966831933 3:184017541-184017563 CCCTGGCCGCGGCCGCCAGGGGG - Intronic
968603348 4:1520655-1520677 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603367 4:1520696-1520718 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603406 4:1520778-1520800 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603465 4:1520901-1520923 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603484 4:1520942-1520964 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603522 4:1521024-1521046 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603541 4:1521065-1521087 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603560 4:1521106-1521128 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603579 4:1521147-1521169 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603598 4:1521188-1521210 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
969053179 4:4386813-4386835 GCCGCTCCGAGACCCCCTGGGGG + Exonic
970441458 4:16083804-16083826 GCCCCTCCGCGGCCGGCAGTGGG - Intronic
971330302 4:25676313-25676335 GCCTCTCGCTGGCCGGCTGGCGG + Exonic
972543120 4:40056635-40056657 GCCTCGGCGCGGCGGCCCGGGGG - Intergenic
981429794 4:144645867-144645889 GCCTCGCCGCGGCCCCCGGGTGG - Intergenic
985627148 5:995017-995039 GCCTCACTGTGGCCGCCTGGTGG + Intergenic
989146978 5:38258679-38258701 GCGTCTCCGGGGGCGCGTGGGGG - Exonic
990537418 5:56736471-56736493 GCCTTTCCACAGCAGCCTGGGGG + Intergenic
993118579 5:83746929-83746951 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
997253728 5:132411051-132411073 GCCCCTTCGCGGCCGCCTCGCGG + Intronic
997870140 5:137499111-137499133 ACCTCCCCGCGGCCGCCTAGGGG - Intronic
1000197982 5:158978232-158978254 GCCTCACAGCGGCCGCATGTCGG - Intronic
1001576163 5:172765333-172765355 CCCTCCCCGCGCCCGCCGGGTGG - Intergenic
1002193761 5:177491666-177491688 GCCCCACCCCGGCCGCCAGGGGG + Intronic
1002456025 5:179345693-179345715 GCTTCTCTGCCGCCGCCTCGGGG - Intergenic
1006340365 6:33443373-33443395 CCCCCTCCATGGCCGCCTGGGGG - Exonic
1015525798 6:134174963-134174985 GCCCCGCCCCGGCCGCCTCGCGG + Intronic
1018790506 6:167144260-167144282 GCCTCTCAGCTGCCTCCTGCAGG + Intergenic
1020192166 7:6008859-6008881 GCCACTCCGGGGCCTCCAGGGGG + Intronic
1021868344 7:24980108-24980130 CCCTCTCCCGGGCCGGCTGGCGG + Exonic
1022103986 7:27185494-27185516 GCCTCTCCGCGCGCGCCGGGAGG - Intergenic
1029362990 7:100100712-100100734 CTCTCTCCGCGGCCGCCGCGCGG + Intronic
1030086401 7:105819530-105819552 CCATCTCCTGGGCCGCCTGGCGG + Intronic
1033300047 7:140177190-140177212 TCCTCTCCGCGACGGCCGGGCGG + Intergenic
1035169711 7:157010626-157010648 GCCTCCGCGCGGTCGCCTGAGGG - Exonic
1036665293 8:10733485-10733507 GCCTCTCCGCCTCTGCTTGGCGG - Intronic
1038319361 8:26513704-26513726 GCCTCTGCCCCGCCGCATGGCGG - Intronic
1043439678 8:80266095-80266117 CCATCTCCTGGGCCGCCTGGCGG - Intergenic
1049724199 8:144137943-144137965 GCCGCACCGCCGCCGCCTGCAGG - Exonic
1049726395 8:144148389-144148411 GCCCCTCCGCGGGAGCCCGGTGG + Intronic
1051171545 9:14322625-14322647 GGCTCTTCGCTTCCGCCTGGCGG + Intronic
1059119207 9:111627036-111627058 GCCTCTCCCCAGGCTCCTGGTGG + Intergenic
1062384988 9:136305662-136305684 GCCACTCAGCAGCTGCCTGGAGG + Intronic
1200092916 X:153644224-153644246 GCGTCCCCGCGGCCTCCAGGGGG + Intronic
1200277775 X:154750880-154750902 GGCTCCCCGCGGCCGCCCCGCGG + Intronic