ID: 900263778

View in Genome Browser
Species Human (GRCh38)
Location 1:1746707-1746729
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 2, 1: 1, 2: 5, 3: 56, 4: 483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900263773_900263778 -6 Left 900263773 1:1746690-1746712 CCCGGAGCTGCGGGGGGCGGGGC 0: 2
1: 0
2: 7
3: 89
4: 747
Right 900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG 0: 2
1: 1
2: 5
3: 56
4: 483
900263774_900263778 -7 Left 900263774 1:1746691-1746713 CCGGAGCTGCGGGGGGCGGGGCC 0: 2
1: 0
2: 7
3: 49
4: 448
Right 900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG 0: 2
1: 1
2: 5
3: 56
4: 483
900263759_900263778 28 Left 900263759 1:1746656-1746678 CCCAGCCTGAGGGAAAGCTGCTC 0: 2
1: 0
2: 1
3: 18
4: 149
Right 900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG 0: 2
1: 1
2: 5
3: 56
4: 483
900263761_900263778 23 Left 900263761 1:1746661-1746683 CCTGAGGGAAAGCTGCTCTGACA 0: 2
1: 0
2: 0
3: 16
4: 202
Right 900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG 0: 2
1: 1
2: 5
3: 56
4: 483
900263760_900263778 27 Left 900263760 1:1746657-1746679 CCAGCCTGAGGGAAAGCTGCTCT 0: 2
1: 0
2: 2
3: 26
4: 192
Right 900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG 0: 2
1: 1
2: 5
3: 56
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900092110 1:925077-925099 CGAGGCCTCCGCGCGCGGCGGGG - Intronic
900135956 1:1117024-1117046 CTGGGCCAGCGCGCAGGGTGGGG + Intergenic
900254956 1:1693168-1693190 ACGGGCTGCCGCGGGGGGTGGGG - Intronic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263705 1:1746448-1746470 ACGGGCTGCCGCGGGGGGTGGGG - Intergenic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
900349263 1:2227253-2227275 AGGGGCCGGCGGGCGGGGCGGGG + Intergenic
900376003 1:2355079-2355101 CGGGGGGCCCGCGCGGGGTAGGG + Intronic
900786688 1:4654433-4654455 CGGGGTCGCCGCGGGTGGTGGGG - Intergenic
901242647 1:7704275-7704297 CGGGGCGGCCCCGCGGGAAGGGG + Intronic
901540195 1:9910399-9910421 CGGGGCCTGCGGGCGGGGCGGGG + Intergenic
901673072 1:10867214-10867236 CACGGCCCCCGCGCGGGCTGCGG - Intergenic
901930813 1:12595437-12595459 CGGGGCTGCAGTGCCGGGTGGGG + Intronic
902072298 1:13749920-13749942 CGGGCCCGCCGCGCAGGACGCGG + Intronic
902089583 1:13892864-13892886 CGGGGTGGCGGCGCGGGCTGGGG + Intergenic
902348213 1:15834948-15834970 CGCGGCCGAGGGGCGGGGTGTGG - Intergenic
902764177 1:18603876-18603898 CGGGGCCTCAGTGAGGGGTGGGG - Intergenic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903153301 1:21428266-21428288 CGGGGCCCGGGCGCGGGGCGCGG - Intergenic
903413952 1:23168718-23168740 CGGGAGCGCGGCGCGGGGAGGGG - Intronic
903883711 1:26529620-26529642 CGGGGCCGGCCCTCGGGGCGCGG + Intergenic
903950715 1:26994431-26994453 CGGGGCCGCGGGGCGGGCTGCGG - Exonic
905369207 1:37474419-37474441 CGGGGCCGCGACGCGAGGAGCGG + Intergenic
905449432 1:38047069-38047091 CGCGGCCGCCACGTGGGGAGTGG + Intergenic
905685185 1:39902374-39902396 CCGAGCCGCCGCGAGGGGTAGGG + Intergenic
905862671 1:41361598-41361620 CAGGGCCGGCGCCCGGGGAGCGG + Intergenic
907364169 1:53945976-53945998 CGAGGCCGCCGCGAGGGGGCGGG - Intergenic
908473810 1:64470108-64470130 CTGGGCCGCCGCGGCGGCTGCGG - Intergenic
909475244 1:76074683-76074705 CGGGGCCGCGGCTCGGGGGGCGG + Intergenic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
912993450 1:114510974-114510996 CGGGCCCGCCGCGCAGGAGGCGG - Exonic
915213340 1:154325584-154325606 CGGGGCCGCAGCTGGGGGGGCGG + Intronic
915340160 1:155173031-155173053 AGGGGTTGCCGCGCGGTGTGGGG - Intronic
915355975 1:155255351-155255373 CGGGGCCGCCTGGTGGGGAGAGG + Exonic
915629208 1:157138575-157138597 CGGGGCGGATGCGCGGGATGCGG - Intergenic
920021131 1:202957801-202957823 CGAGGCCGCCGCGCGTGGGGAGG - Intronic
921029703 1:211326766-211326788 CGGGGCCGGGGCGCGGGCGGAGG - Intronic
921172048 1:212558810-212558832 CGGGCCCGGCCCGAGGGGTGGGG - Intergenic
922250488 1:223845529-223845551 CGGCCCCTCCGCGCGGGCTGCGG + Intronic
922250582 1:223845822-223845844 AGGGCCCTCCGCGCGGGCTGGGG + Exonic
922766397 1:228158683-228158705 GGGGGCCGCGGCGCGGGGGCGGG - Exonic
923506153 1:234608642-234608664 CGGGGCCGCCGAGCTGAGCGCGG - Exonic
923506308 1:234609261-234609283 CGAGGCCGCGGCGCCGGGTGGGG + Exonic
923744403 1:236686815-236686837 CGGGCCGCCCGCGCGTGGTGGGG + Intronic
924436588 1:244048649-244048671 CGGAGCCGCCGGGCCGGGTGGGG - Intergenic
924527226 1:244863565-244863587 CGGGAGGCCCGCGCGGGGTGGGG - Intronic
924527265 1:244863696-244863718 CGGTGGCGCCGCCCGGGGCGAGG - Exonic
1062854251 10:771794-771816 CGGGGCCGATGGGAGGGGTGGGG + Intergenic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1063994972 10:11611178-11611200 TGGGGGCGCCGCGCGGGGTGCGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064418279 10:15168816-15168838 CGGGGCCGGCGGGCTGGGCGCGG - Intergenic
1064418286 10:15168834-15168856 CGGGGCCGGCGGGCAGGGCGGGG - Intergenic
1065025313 10:21534889-21534911 CGCGGCCGCGGCACGGGGCGGGG - Intronic
1065099925 10:22321954-22321976 CGGCGGCGCGGCGCGGGCTGCGG - Intronic
1066022573 10:31318833-31318855 CCGGGCAGCCGCGGCGGGTGTGG + Intronic
1067479453 10:46585462-46585484 CGGGGCCGCAGCACTGTGTGAGG + Intronic
1067615285 10:47756336-47756358 CGGGGCCGCAGCACTGTGTGAGG - Intergenic
1071630686 10:87216287-87216309 CGGGGCCGCAGCACTGTGTGAGG - Intergenic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1072562184 10:96586703-96586725 CGGGGCGGCCGCGCCGGCCGGGG + Intronic
1074377398 10:112951326-112951348 CGGGGCCGGGGCGCGCGGGGCGG - Intronic
1074780403 10:116798171-116798193 CGGGGCGGTGGGGCGGGGTGGGG + Intergenic
1074786953 10:116849776-116849798 CGTTGCCGCAGCGCGGGGCGGGG - Intronic
1074864172 10:117535346-117535368 TGGGGCCGCCTCGCTGGCTGCGG + Intergenic
1075501732 10:122980717-122980739 CTGGGCCGCGGGGCGGGGCGGGG + Intronic
1075616081 10:123891699-123891721 CGGGGGCGCCGGGCGGGCTGCGG + Exonic
1075645451 10:124093279-124093301 CGGGAGCGCCGCGGGGAGTGAGG + Intronic
1076613232 10:131739069-131739091 TGGGGCAGGAGCGCGGGGTGGGG - Intergenic
1076683483 10:132186807-132186829 CGGGGCTGATGGGCGGGGTGAGG + Intergenic
1076749886 10:132537415-132537437 CGCAGCCGCGGCGCGGGGGGCGG + Intergenic
1076850057 10:133088296-133088318 CGGGCCGGGCGCGCGGGGCGGGG - Intronic
1076985976 11:236364-236386 CGGGGCCGGGGCGCCGGGGGCGG - Exonic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077026549 11:442365-442387 GGGGGCCGTGGCCCGGGGTGGGG - Intergenic
1077026585 11:442429-442451 GGGGGCCGTGGCCCGGGGTGGGG - Intergenic
1077026597 11:442449-442471 GGGGGCCGTGGCCCGGGGTGGGG - Intergenic
1077159861 11:1107784-1107806 GGAGGCTGCCGCCCGGGGTGGGG + Intergenic
1077217557 11:1401324-1401346 CGGGGCTCACGCCCGGGGTGCGG + Intronic
1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG + Intergenic
1077322261 11:1947652-1947674 CGGTGCCCCCGCGTGGGGAGTGG + Intronic
1078180092 11:9004095-9004117 CGAGGGAGCCGCGCGGGGCGTGG - Intergenic
1079035187 11:17014414-17014436 CGGAGCCGCCGCGGGGTGGGGGG + Intronic
1080496968 11:32829960-32829982 CGGGGAACACGCGCGGGGTGAGG - Exonic
1080802139 11:35618783-35618805 CGGGGCCGCCGCTCCGGGCCGGG - Exonic
1081812687 11:45922514-45922536 CGGGGGCTCCTCGCGGGCTGGGG + Intronic
1081873115 11:46392062-46392084 CGGCGCCCCCTCGCGGGCTGGGG + Intergenic
1081938138 11:46918595-46918617 CGGGGCTGCGGCGCGGGGGGCGG - Exonic
1083609633 11:63998805-63998827 CGGGGCCGCCGCACGGGGCGAGG + Intronic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083642723 11:64154043-64154065 AGGGGCCGCTGCATGGGGTGTGG - Intronic
1083747704 11:64744836-64744858 CGGGGCCGCGGCGTGGAGAGCGG - Intronic
1083886516 11:65576003-65576025 CGGGGCTCCGGCGCGGGGCGGGG - Intergenic
1083922130 11:65786816-65786838 CGGGGCGGCCGGGCGGGGCGGGG - Intergenic
1083970253 11:66070209-66070231 CGGCCCCTCCGCGCTGGGTGGGG + Intergenic
1083997230 11:66278431-66278453 CCGGGCCGCCGCCCGGCGCGGGG + Exonic
1084186637 11:67476175-67476197 CGGGCCGGCCGCTCGGAGTGCGG - Intergenic
1084319535 11:68365722-68365744 CGGGGCGGGCGGGCGGGGCGGGG + Intronic
1084385723 11:68841719-68841741 CGGGGCGGCCCTGCGGGCTGCGG - Intronic
1084554653 11:69868602-69868624 CGGGGCGGCTGCCCGGGGTGGGG - Intergenic
1084758085 11:71251781-71251803 CGGGGCCGGCGCGCCTGGTGCGG - Intronic
1084888105 11:72223782-72223804 CGGGACCGAGGCGCGGGGCGGGG + Intronic
1085123618 11:73982879-73982901 CGGGGGCGGGGCCCGGGGTGGGG + Exonic
1085423174 11:76380944-76380966 CAGGGCCGACGCGCGGGGGAGGG + Intronic
1086993424 11:93330585-93330607 CGGCGGCGCCGCGCGCGGGGAGG + Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1089398872 11:118153063-118153085 CGGGACCGCGAGGCGGGGTGCGG - Intergenic
1089499824 11:118925511-118925533 CGGGGCCGGGGCGCGGGGCCGGG + Intronic
1090473978 11:127003539-127003561 CGGGGGCGGCGCGCGGGGGAAGG + Intergenic
1091327451 11:134701731-134701753 CGGGGCCCCGGCACTGGGTGTGG - Intergenic
1202805279 11_KI270721v1_random:2965-2987 CGGTGCCCCCGCGTGGGGAGTGG + Intergenic
1091718517 12:2795856-2795878 AGGGGGCGCCGCGCGGCGAGTGG - Intronic
1091888096 12:4031317-4031339 CCGGGCCGCCGGGCGCGGGGAGG - Intergenic
1092250255 12:6891145-6891167 CTGGGCGGCTGCGCGGGGCGGGG - Intronic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1095561591 12:43572150-43572172 CAGGGCCGACGCGCGGGGGAGGG + Intergenic
1095891120 12:47235804-47235826 CGTGGCCGACGCCTGGGGTGTGG + Exonic
1096178749 12:49539354-49539376 CGGGGACTCCGCGCCGGGGGAGG - Exonic
1096191522 12:49623337-49623359 CGGGTCCGCCCCCCGGGGGGCGG - Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096465698 12:51847035-51847057 CCGGGCGGCCGCGCGAGCTGCGG - Intergenic
1096466166 12:51848604-51848626 CGGGGCGGCGGCGCGGGCCGGGG + Intergenic
1097872080 12:64610358-64610380 GGTCGCGGCCGCGCGGGGTGGGG + Intergenic
1098897810 12:76083965-76083987 GGGGGCGGCCGCGCGGGGAGGGG - Intronic
1101466912 12:104958333-104958355 CGGGGCTGCCGCGCGGGGGCGGG - Intronic
1103828709 12:123762141-123762163 CGGGGCCGGGGCGTGGGCTGCGG + Intergenic
1104021219 12:124993751-124993773 CGGGGTCGCGATGCGGGGTGAGG - Exonic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104444705 12:128823831-128823853 GCGGGCCGGCGCGCGGCGTGCGG - Exonic
1104691028 12:130826486-130826508 CGTGGCCTCCGCGTGGGTTGGGG - Intronic
1104854333 12:131894966-131894988 CGGGGGCGCGGGGCGGGGGGTGG - Exonic
1106109105 13:26761018-26761040 CGGGGCCGCCGGCTGGGGTGGGG - Intergenic
1106517263 13:30465727-30465749 TCCGGCCGCCGCGCGGGCTGGGG + Intronic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1107412640 13:40172222-40172244 AGGGGGAGCTGCGCGGGGTGAGG + Intergenic
1111951219 13:94711191-94711213 CGGGGCCGCCTCGCGAGGACCGG - Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1112580713 13:100674626-100674648 CCGGGCCGCCGTGCGGGGCTCGG + Intronic
1112652652 13:101416130-101416152 CGGGGGCCCCGCGCGGGGGAGGG - Intronic
1113379151 13:109786825-109786847 CGGCCCGGCCGGGCGGGGTGGGG + Intergenic
1115235833 14:31207803-31207825 CGGGGTCGCCGCCGGGGGAGTGG - Intronic
1115474506 14:33800452-33800474 CGTCGGCGCCGGGCGGGGTGAGG - Exonic
1115474571 14:33800612-33800634 GGGGGCGGCGGCGCGGGGGGCGG + Exonic
1116828279 14:49693135-49693157 CGAGGCCGCCGGGCGGGCAGGGG + Exonic
1118270533 14:64338686-64338708 CGGGGCGGCCTCGCGGGGGGTGG - Intergenic
1118809037 14:69260519-69260541 CTCGGCCGCCGCGCAGGGTCTGG - Intronic
1119821003 14:77616376-77616398 AGGGGCGGCCGGGCGGGGCGAGG - Intronic
1121368026 14:93332663-93332685 CTGGGGCGCCGGGCGGGGAGGGG - Intronic
1122137956 14:99645474-99645496 CGCGGCCACCGGGCGGGGCGGGG + Intronic
1122162359 14:99793547-99793569 AGGGGCGGCCGCGCGGGGCCGGG + Intronic
1122444962 14:101761611-101761633 CGGGGCGGCCGGCCGGGGGGTGG + Intergenic
1122558011 14:102592006-102592028 GGGGGCCGCGGCGCGGGGGACGG - Intergenic
1122582020 14:102777233-102777255 CGGCGCCGCGGCGCGGGGCGGGG - Intergenic
1122621064 14:103057760-103057782 CTGGGGAGCGGCGCGGGGTGGGG + Intergenic
1122917314 14:104865169-104865191 CGGCGGGGCGGCGCGGGGTGCGG + Intergenic
1122940401 14:104978539-104978561 CGGGCCGGGGGCGCGGGGTGGGG - Intergenic
1122975408 14:105168829-105168851 CGGGGCCGCGCCGCGGGGTGGGG + Intergenic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1125709614 15:41774418-41774440 CGGAGCCGACGCGAGGGGCGCGG - Intronic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1127103195 15:55588075-55588097 CGGGGCGGCGGGGCGGCGTGCGG + Intronic
1129082129 15:73051548-73051570 CGGGGCCCCCGCACGAGCTGAGG + Intergenic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1132480597 16:164748-164770 CGGGGTCGCGGGGCGGGGCGGGG + Intronic
1132480618 16:164789-164811 CGGGGTCGCGGGGCGGGGCGGGG + Intronic
1132480691 16:164925-164947 CGGGGTCGCGGGGCGGGGCGCGG + Intronic
1132490731 16:229209-229231 CGAGGCCGCCGGGCGGCCTGAGG - Intronic
1132719747 16:1309797-1309819 CGGGGCCGCGGGGCGGGGGTCGG + Intronic
1136111072 16:28063810-28063832 GGGGGCCGCCACGCCGGGCGCGG + Intergenic
1136143340 16:28301200-28301222 CGGGGCAGCCCCCAGGGGTGTGG - Intronic
1136275531 16:29177327-29177349 CTGGGGCGCCGAGCAGGGTGGGG + Intergenic
1137707725 16:50547581-50547603 CGGGGAGGTCGCGCGGGGGGAGG - Intergenic
1139534418 16:67562695-67562717 AGCGGGCGCCGCGGGGGGTGTGG + Exonic
1139574741 16:67833765-67833787 CGGGGTCGCCGCGGGGTGCGCGG + Exonic
1140096908 16:71883677-71883699 CGGGCGCGGGGCGCGGGGTGCGG - Intronic
1141116692 16:81315334-81315356 CGGGGCGGCCGGGCCGGGCGTGG + Intronic
1141483004 16:84319305-84319327 CGAGGCCGCCTCTCTGGGTGAGG + Intronic
1142079889 16:88143393-88143415 CTGGGGCGCCGAGCAGGGTGGGG + Intergenic
1142136181 16:88453031-88453053 CGGGGCCGCAGCGCTGGGGTCGG + Intergenic
1142136214 16:88453143-88453165 CGTGGCCGCGGCGCTGGGGGCGG + Intergenic
1142136237 16:88453203-88453225 CGGGGCCGGAGCGCCGGGGGCGG + Intergenic
1142188595 16:88706576-88706598 CTGGGCCGCGGCGCCGGGGGCGG - Exonic
1142211806 16:88811952-88811974 CGGGACCGCCACGAGGGGTGGGG + Intergenic
1142271923 16:89094194-89094216 CGGGGCCCCCGCGCGGGGTGCGG + Intronic
1142279681 16:89141412-89141434 CGGGGCCGCCCCTTTGGGTGGGG + Intronic
1203120106 16_KI270728v1_random:1529202-1529224 CGGTGTTGGCGCGCGGGGTGTGG + Intergenic
1142509656 17:385829-385851 CGGGGACGCGGCGGGGGGTGGGG - Intronic
1142670648 17:1486010-1486032 CGCGGCGGCCGCGCGGGTTCCGG - Intronic
1142749190 17:1977523-1977545 CCAGGCCGGCGGGCGGGGTGGGG - Intronic
1142764078 17:2056119-2056141 GGCGGCGGCCGCGCGGGGAGCGG - Intronic
1142876223 17:2853469-2853491 CGGGGCCGCCGGCGGGAGTGCGG + Intronic
1143539696 17:7561775-7561797 CGGGGCCGCCACGCGCGGCCGGG + Intergenic
1143565290 17:7717211-7717233 CGGGGGGGCGGCGCGGGGCGGGG - Intergenic
1143610693 17:8016034-8016056 CGGGGCCTCCGGGAGGGGTTGGG - Intronic
1144021005 17:11240484-11240506 CGGGAGCGCCGCGAGGGGAGGGG - Intergenic
1144758643 17:17694817-17694839 CGGGGCCGCGGGGCGGGGCGGGG + Intronic
1144775315 17:17782199-17782221 CGGAGCCGCCGAGCGAGGTGAGG + Intronic
1144851689 17:18247133-18247155 CGGGACCGGGGCGCGGGGGGGGG - Intronic
1145041275 17:19579872-19579894 CGGGACCGCAGCGCGGTGTGGGG - Intergenic
1145236897 17:21214577-21214599 GGGGGCCGCCGCGCTGTCTGCGG + Exonic
1145278646 17:21453067-21453089 GGGGGCAGCCGAGCGGGGAGAGG + Intergenic
1145765517 17:27456269-27456291 CGCGGCCGCCGGGAGGGGAGGGG + Intergenic
1145878867 17:28339736-28339758 TGGGGCTGCCGCTCGGGGTGGGG + Intronic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1146398593 17:32487107-32487129 CGGGGCCGCGGCGCGCATTGCGG + Exonic
1147285841 17:39401979-39402001 AGGGGCCCCCGCGCAGAGTGCGG - Intronic
1148081063 17:44967927-44967949 CCGGGGCCCCGCGCGGGGTAGGG + Exonic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148323745 17:46771813-46771835 CGCGGCGGCCGCGCGGTGGGGGG + Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148648025 17:49230412-49230434 TGGGGTCCCGGCGCGGGGTGGGG - Intronic
1148698984 17:49576879-49576901 CGGAGCCGGCGCACGGGGAGCGG - Intronic
1148710611 17:49678139-49678161 GGAGGAGGCCGCGCGGGGTGGGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1150108557 17:62479014-62479036 CCGGGCGGCCGCGGGGGGCGCGG - Exonic
1151453409 17:74212749-74212771 CGGTGCCTGCGCTCGGGGTGAGG + Intergenic
1151797095 17:76353631-76353653 CGGGGCGGGCGCGCGGGACGCGG + Exonic
1151954399 17:77373290-77373312 CGGGGGCGCAGCGCGCGGGGAGG + Intronic
1152370937 17:79888231-79888253 CTGGGCCGCCCAGCTGGGTGCGG - Intergenic
1152751728 17:82065480-82065502 CCGGGCCGCCTGGCCGGGTGCGG - Exonic
1153805360 18:8705491-8705513 CGGGGCCGGGGTGCGGGGGGCGG + Intergenic
1153855123 18:9137286-9137308 CGGGGGCGCTGCGCGGGGCGGGG + Intronic
1154196543 18:12271437-12271459 CAGGGCCGCCGTGGGGGCTGCGG - Intronic
1154358629 18:13641699-13641721 CGGGGCCGCCAGTCGGCGTGGGG + Intronic
1158695141 18:59697145-59697167 CGCGCCCGGCTCGCGGGGTGCGG - Intronic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1160453451 18:78980173-78980195 CGGGCGCGCGGCGCGGGGCGCGG - Intergenic
1160567811 18:79798068-79798090 CGGGGCCGCAGTGGGCGGTGGGG + Intergenic
1160590326 18:79940982-79941004 CAGGGCCGCCACGAGGGGTAGGG - Intronic
1160719067 19:589753-589775 CGGAGGCGGCGCGCGGGGAGGGG + Intergenic
1160775520 19:853402-853424 AGGTGCCGCCGGGCGGGGCGGGG + Exonic
1160853504 19:1205931-1205953 CGCGGCCGCCGCGCGTGTGGAGG - Intronic
1160861283 19:1238105-1238127 CTCGGCCGCCGCGGCGGGTGCGG - Intergenic
1161150052 19:2702735-2702757 CGGGGCCGACACTCGGGGGGCGG + Intergenic
1161210448 19:3062662-3062684 GGGGGCCGCTGCCCGGGGCGGGG - Intronic
1161252113 19:3285862-3285884 CTGGGCCGCTGGGCGGGGAGGGG - Intronic
1161450636 19:4343616-4343638 CGGGGCGGAGGCGCGGGGCGCGG + Intronic
1161791302 19:6361800-6361822 CGGGGGCTCCGGGCTGGGTGGGG + Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162426879 19:10602428-10602450 CGGGGCCGGGGCCCGGGGCGGGG + Intergenic
1162561857 19:11421851-11421873 CGGGTCAGCCGAGAGGGGTGGGG + Intronic
1162567546 19:11452764-11452786 TGGGGCCGCTGAGTGGGGTGGGG + Exonic
1162758440 19:12874266-12874288 GGGGGTCGTCGCGCGGGGTGGGG - Exonic
1162944162 19:14032151-14032173 CGGAGCCCCGGGGCGGGGTGGGG + Intronic
1163021419 19:14482807-14482829 CGGGGCCGCAGGGCTGGGGGAGG + Exonic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163631284 19:18419251-18419273 AGTGCCCGCCGCGGGGGGTGGGG - Intronic
1163666550 19:18606463-18606485 GGGGGCAGCCGCGGGGGGAGGGG - Intronic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1165453609 19:35898880-35898902 CGGGGGTGGCGCGCGGGGAGTGG + Intronic
1165738793 19:38193716-38193738 CGGGGCCGACGGGCGGGTGGGGG - Exonic
1165784478 19:38453076-38453098 CGGGGCCACGGCGCTGGGCGGGG + Intronic
1165792295 19:38499699-38499721 CGGACCCGCCCTGCGGGGTGAGG + Exonic
1166117217 19:40663336-40663358 GGGGGCGGCCGCGAGGGGCGGGG + Intergenic
1166773366 19:45297884-45297906 CGGGGCCGCCCGGCGGGCAGGGG - Exonic
1166827084 19:45616422-45616444 CGGGGTGGCGGCGCGGGCTGGGG + Intronic
1166851981 19:45765581-45765603 GGGGGCCACCGCAGGGGGTGAGG - Exonic
1167040610 19:47020814-47020836 CGGGGCTGGCGCTCCGGGTGAGG - Intronic
1167114171 19:47479490-47479512 AGGGGCCACAGAGCGGGGTGAGG + Intronic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167471264 19:49677583-49677605 CGTGGCCGCTGCGCGGTGGGTGG + Intronic
1167934980 19:52898259-52898281 CAGGGCCACCGCCTGGGGTGCGG + Intergenic
1168078241 19:53991980-53992002 CGGGGCCTCCCCGAGGGCTGGGG - Intergenic
1168252652 19:55149246-55149268 CGGGCCCGCCCCGAGGGGAGAGG + Exonic
1168336518 19:55600336-55600358 CGGGGCCGGCGCGTGGGAAGGGG - Intronic
1168343854 19:55641167-55641189 AGAGGCCGCCGCACGGGGTACGG + Intronic
1168459070 19:56538827-56538849 CGGGGCAGCGGGGAGGGGTGGGG + Intergenic
924962323 2:46134-46156 CGGGGCCGGGGCGCGGGCCGGGG + Exonic
925609347 2:5691418-5691440 CAGGGACGCCGGGCGGGGCGCGG + Intergenic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
926202672 2:10812810-10812832 AGGGGCGGCCGCGCGGGGGCGGG + Intronic
926268295 2:11345026-11345048 GGGGGCCGCGGCGGGGGGCGCGG - Intronic
927168768 2:20350947-20350969 CGCTGCCGCCGCGCGGGCCGGGG + Intronic
927472117 2:23384923-23384945 GGGGGCCACCGCGGGGGGCGGGG + Intergenic
927679271 2:25129343-25129365 CGGGGGCGGGGCGTGGGGTGGGG + Intronic
927679783 2:25131941-25131963 CGGGGCCGAGGCGCGGAGTGGGG + Intronic
927881493 2:26692819-26692841 CGGGGCCGAGGCGCGGGCCGGGG + Exonic
928518208 2:32063675-32063697 CGGGGCCGGCGGGCAGCGTGCGG + Exonic
929604701 2:43226657-43226679 CGGGGCGGGCGCGCCGGGGGAGG + Intergenic
930198277 2:48530091-48530113 CGGGGCCGCCGAGTGGAGGGCGG - Intronic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931487326 2:62706084-62706106 CGGGGCCGGGGCTCGGGGTCCGG + Intronic
931614643 2:64144020-64144042 CGGGGCCGCCGAGGGGCGCGGGG - Intronic
931727975 2:65129703-65129725 AGGGGCGGCCGCGCGGGGGAGGG - Intronic
932416488 2:71576547-71576569 CCAGGCCGCAGGGCGGGGTGGGG + Intronic
934588545 2:95526772-95526794 CGGCGGCGCGGCGAGGGGTGGGG + Intergenic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
934966884 2:98731181-98731203 CGGGGCGGCCCGGCGGGGCGGGG - Intergenic
935112013 2:100103717-100103739 CGGGGCGCCCGGGTGGGGTGGGG + Intronic
936221727 2:110610030-110610052 CGGGGCGCCCGGGTGGGGTGGGG + Intergenic
936433404 2:112482844-112482866 CGGGTCCGCCGCGCTGGGCGCGG + Intronic
937208628 2:120252997-120253019 CGCGGGCCCCGGGCGGGGTGGGG + Intronic
937221443 2:120345082-120345104 CCGGGCCGCGGCACGGAGTGCGG - Intergenic
937252576 2:120533933-120533955 AGGGGCCACAGCCCGGGGTGGGG + Intergenic
937418611 2:121737033-121737055 CGGGGGCGGGGCACGGGGTGTGG + Intergenic
938073080 2:128318577-128318599 CGGGGCCCGGGCGCGGGGCGCGG + Exonic
938077292 2:128346537-128346559 CGGGGCAGCGGTGCGGTGTGGGG + Intergenic
942314048 2:174682437-174682459 CGGGGCCGCCCCGTGGGGCTCGG - Intronic
944114291 2:196171106-196171128 CTGGGGCTCCGCGCGGGGGGCGG - Intronic
945110627 2:206356925-206356947 CGGGGCGGCCGGCCGGGCTGAGG + Intergenic
945314817 2:208360321-208360343 GGAGGCCGCCGCTCCGGGTGTGG - Intronic
945649275 2:212538644-212538666 CGGGCGCGGCGCGCGCGGTGTGG + Exonic
945955415 2:216081873-216081895 CGCGGCCGGCGGGCGGGGCGGGG - Exonic
947612045 2:231530516-231530538 AGGGGGCGCCGCCCGGGCTGCGG - Intergenic
947632304 2:231662146-231662168 CGTGGCCGCCTCGCGGGCCGGGG - Intergenic
947860485 2:233354457-233354479 CGGGGCCGGCGGGAGGGGCGGGG - Intergenic
948140701 2:235670250-235670272 CGGGGCCGCCGAACCGGGCGTGG - Intronic
948216543 2:236237343-236237365 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216558 2:236237368-236237390 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216573 2:236237393-236237415 CGGGGCCGGGGCGCGGGGCGGGG + Intronic
948216586 2:236237418-236237440 CGGGGCCGGGGCGCGGGGCGAGG + Intronic
948368941 2:237475337-237475359 CGGGGCCGGGCCGCGGGGGGCGG + Intergenic
948824630 2:240568365-240568387 CGGGGCCGGGGCGCCGGGCGGGG - Intronic
948824637 2:240568378-240568400 CGGGGCCGGGGCGCGGGGCCGGG - Intronic
948835956 2:240626091-240626113 CGGGGTCTCAGAGCGGGGTGAGG + Intronic
1168756775 20:324182-324204 CGGCTCCGCGGCGCGGGGGGCGG - Intergenic
1168800882 20:642572-642594 GGCGGCGGACGCGCGGGGTGAGG + Intergenic
1170889803 20:20367865-20367887 CGGGGCGGCGGCGCCGGGCGGGG + Intergenic
1171858917 20:30376988-30377010 CGGGGCTGCCGGGCGCGCTGTGG - Intergenic
1172117966 20:32583296-32583318 CGGGCCGGGCCCGCGGGGTGAGG - Intronic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1172774233 20:37397893-37397915 CGGAGCTGCCACACGGGGTGGGG - Intronic
1173788545 20:45812764-45812786 CGGGGGCGCCGCCCGGGGTCCGG + Exonic
1174053954 20:47785558-47785580 CTGGGGCGGCGCGCGGGGAGGGG - Intronic
1174287382 20:49482845-49482867 AGGGGCCGCCCCTCGGGGCGGGG + Intergenic
1174386400 20:50190592-50190614 CGGGGCGGCCGGGCGGGGGTGGG + Intergenic
1174447743 20:50602040-50602062 CAGGGCCACCGCCCGGGGCGGGG + Intronic
1175267075 20:57709591-57709613 CGGCGGCGCGGCGCGGGGCGCGG + Exonic
1175847491 20:62066157-62066179 GGGGGCCGCCGGGCGGGGCGCGG + Intergenic
1176015029 20:62926521-62926543 CGGCGCCCCCGCGCGGCGGGCGG + Intronic
1176062354 20:63177981-63178003 CGGGCCCGCTGCGCGCGGAGAGG + Intergenic
1176068845 20:63215813-63215835 CGGGGCCGAGGCGCGGGGTCTGG - Intronic
1176125349 20:63472505-63472527 CGGGGGCGGAGCGCGGGGGGCGG + Exonic
1176128954 20:63488201-63488223 CCGGACCGGCGCGCGGGGCGGGG + Exonic
1176156939 20:63626804-63626826 AGGGGCGGCCGCGCGGGCGGCGG - Intronic
1179243835 21:39613076-39613098 CGGGGCTGGGGCGCGGGGCGCGG + Intronic
1179534362 21:42041887-42041909 GGGGGCAGCCCCGGGGGGTGTGG - Intergenic
1179561571 21:42219156-42219178 CTCAGCCGCTGCGCGGGGTGCGG - Exonic
1179563968 21:42234926-42234948 CGGAGCGGCGGCGCGGGGAGCGG + Intronic
1179586421 21:42376515-42376537 CGGGGCCGCAGCGGTGGGCGAGG - Intronic
1179810006 21:43864754-43864776 GGGGGCCGGGGCGCGGGGTGGGG - Intergenic
1180915107 22:19480243-19480265 CGGGGCCGGCGCGCGAGGTGAGG + Intronic
1180960598 22:19760718-19760740 CGGGGCCGGCCTGCGGTGTGGGG + Intronic
1181147491 22:20859023-20859045 CGGGGTCGGCGGGCGGGGCGAGG + Exonic
1181467581 22:23118478-23118500 CAAGGCAGCCGCGGGGGGTGGGG - Intronic
1181639512 22:24189288-24189310 TGTGGCCGCCTCGTGGGGTGGGG + Intergenic
1182249927 22:28992166-28992188 CGGGGCCGGGGCGGGGGGTTGGG - Intronic
1183780237 22:39994855-39994877 CGTGGCCGTCGGGCGGGGAGGGG - Intergenic
1184034108 22:41910490-41910512 CGGGGCCCCCGCGCGGCCCGCGG - Exonic
1184086811 22:42270409-42270431 GGGCGGCGCTGCGCGGGGTGGGG + Intronic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
1184523136 22:45007531-45007553 CGGGGGCGCGGCGCGGGCGGGGG + Intronic
1185037920 22:48489430-48489452 CGCGGGCGCGGCGCGGGGCGCGG + Intergenic
1185056150 22:48579303-48579325 CAGGGCCGCAGCGTGGGGTCCGG + Intronic
1185216374 22:49602067-49602089 CGGCTCCGCCTCGCTGGGTGGGG - Intronic
1185285875 22:49999705-49999727 CGGGGGCGGGGCGCGGGGGGTGG + Intronic
1185288348 22:50012221-50012243 CAGAGCAGCCGAGCGGGGTGGGG + Intronic
1185317634 22:50185886-50185908 TGGGGCCGCGGGGCGGGGCGGGG - Intergenic
1185420354 22:50731365-50731387 CGAGCCCGCGGCCCGGGGTGGGG - Intergenic
950683871 3:14602875-14602897 CGCGCGCGCGGCGCGGGGTGCGG - Intergenic
950911901 3:16604594-16604616 GGGGGCCTCAGCGTGGGGTGTGG - Exonic
952816765 3:37453033-37453055 CAGCGCCGCTGCGCGGGGTGGGG + Intronic
953385237 3:42502513-42502535 CGGGGCCGCCGCGCAGGTATGGG - Intronic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954256547 3:49411634-49411656 CGGGGTCGCCGCTTGGGGCGCGG + Intronic
954664754 3:52245867-52245889 GGCGGCCGCGGCGCGGGGAGCGG - Intronic
954733473 3:52685604-52685626 CGGGCCGGGCGCGCGGGGTTGGG - Intronic
954795902 3:53161280-53161302 CCGGGCCTCCGCGCGGCGGGCGG - Exonic
956797106 3:72727298-72727320 GGGGGCAGCCGCATGGGGTGGGG - Intergenic
959539446 3:107523378-107523400 CGCGGCGGCCGCGCCGGCTGGGG + Intronic
961385999 3:126523932-126523954 AGGGGACACCGCCCGGGGTGGGG + Intergenic
961827566 3:129606853-129606875 CGGGGCCGGGGCGGGGAGTGAGG - Intergenic
963066197 3:141266346-141266368 CGGGGCTGCCACCCTGGGTGGGG + Intronic
963091399 3:141486931-141486953 CGGGGCCGCGGCGGGCGGGGCGG + Intergenic
963133220 3:141876953-141876975 CGGGGGCGCCGGGCGCGGTCTGG + Intronic
964819575 3:160755510-160755532 CGGGGCGAGCGCGCGGGGGGCGG + Intergenic
966684826 3:182682729-182682751 CCGGGCCGGCGCGCGGGGGGCGG - Intergenic
968434067 4:576082-576104 GGCGGCGGGCGCGCGGGGTGCGG - Intergenic
968511385 4:997373-997395 GGGGGAGACCGCGCGGGGTGGGG - Intronic
968512992 4:1003484-1003506 CCGGGCCGCGGCGCGGGTTAGGG - Intronic
968660140 4:1795428-1795450 CGGGGGCGCCGCCCCGGGGGAGG - Intronic
968674964 4:1872009-1872031 CGGGGCGGCCGCGGTGGGAGGGG + Intronic
968935336 4:3607359-3607381 CAGGGCAGCTGCGTGGGGTGAGG - Intergenic
968965123 4:3765848-3765870 CGGGGCGGGCGCGCGGGGCGGGG - Intergenic
969344824 4:6563905-6563927 CGGGTGCGGGGCGCGGGGTGCGG + Intergenic
973279143 4:48341454-48341476 CTGGGCCGGCCCGCGGGGGGCGG + Exonic
973888415 4:55346209-55346231 CGGTGACGCGGCGCGGGGCGGGG - Exonic
976704618 4:88007789-88007811 CGGGTCCGGCGCGCGGGGCGCGG - Exonic
978619312 4:110622848-110622870 CAGGGCTGCCGCGTGGGGGGGGG - Exonic
981033689 4:140151071-140151093 CGGGGCCGCTGGGCTGGGAGGGG - Intronic
984639240 4:182144446-182144468 AGGGGCCGGCGGGCGGGGAGAGG + Intronic
984928388 4:184826107-184826129 CGGGGCCTGCGGGCGGGGCGGGG - Intronic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985549131 5:524379-524401 CTGGGCCGACGCGCGGGGCTGGG + Intergenic
985574362 5:666621-666643 CGGGGCCGCCTGGCGGGTTTTGG - Intronic
985703235 5:1386129-1386151 TGGGGCCGGCGCGGGGAGTGAGG + Intergenic
985714010 5:1445729-1445751 CGGGGCAGCCCCCAGGGGTGCGG - Intergenic
985714242 5:1446537-1446559 CGGGGCGGGCGCAGGGGGTGGGG - Intergenic
985743506 5:1633757-1633779 CGGGGCGGCTGCGCGGGAGGCGG + Intergenic
985760774 5:1747504-1747526 GGGGGCTGCAGCGAGGGGTGGGG - Intergenic
986733288 5:10650156-10650178 CGGGGCCGCAGGGCTGGGCGCGG + Exonic
987099739 5:14581666-14581688 CGGGGCCTCCGCGCGCTGTCGGG - Intergenic
988564806 5:32312616-32312638 CGGGGCAGCCAGGCGGGCTGAGG - Intronic
989229967 5:39074435-39074457 CGGGCGCGGCGCGCGGGGAGGGG - Intergenic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
990376196 5:55173295-55173317 CGGGGCCGCGGCGCGCGCCGGGG - Intergenic
992530110 5:77645247-77645269 AGGGGCCCCCGGGCGGGGAGGGG - Intergenic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
995764596 5:115602053-115602075 GGGGGCCGCCGCCGGGGGCGCGG - Intronic
997265021 5:132490406-132490428 CCGGGCCTCCGCGCGGGCTCCGG - Intronic
997513138 5:134466601-134466623 CGGGGCAGCCGGGCAGGGCGGGG - Intergenic
998018990 5:138753872-138753894 CGGGGCTGCCGCGCGCGCCGAGG - Intronic
998143166 5:139711098-139711120 AGGGGGCGCCACGCGGCGTGAGG - Intergenic
999791197 5:154940950-154940972 CTGGGCCGGCGCTCGAGGTGTGG - Intergenic
1000212351 5:159119257-159119279 CGGGCCCGCCGCTCTGAGTGCGG - Intergenic
1001529949 5:172454595-172454617 CGGGCCGGCGGCGCGGGGGGCGG - Intergenic
1001530002 5:172454708-172454730 CTGAGCCGCCGCGCCGGGGGAGG + Intergenic
1001928754 5:175658179-175658201 CGGGGCCTCGGCTCGGGGTGGGG + Intronic
1002082178 5:176743609-176743631 AGGGGCCGCCGGCCGGGCTGGGG - Intergenic
1002170316 5:177371040-177371062 CCGGGCCGCGGGGCGGGGCGGGG + Intronic
1002355878 5:178627996-178628018 GGGGGACGGCGGGCGGGGTGGGG + Intronic
1002622098 5:180494938-180494960 CGGGGGCGCGGCCCGGGGCGGGG - Intronic
1002929603 6:1624288-1624310 TGGGGCCGACACCCGGGGTGGGG - Intronic
1003097982 6:3157270-3157292 CGAGGCCGCCGGGCGGGGTCCGG - Intronic
1003099034 6:3163115-3163137 AGGGGCCGCGGCGCAGGGGGAGG + Intergenic
1003506689 6:6745951-6745973 CCGGTCCGCCGCTCGGAGTGCGG + Intergenic
1003872166 6:10412230-10412252 GGGGGCCGCGGCGCGGCGTCTGG + Intronic
1004690335 6:17987660-17987682 AGGGGCGGGCGCGCGGGGCGGGG + Intergenic
1005584264 6:27260440-27260462 CGGCTCCCTCGCGCGGGGTGCGG - Intergenic
1005605511 6:27473145-27473167 CGGCGCCGGCGTGCGGGGCGGGG - Intergenic
1006119384 6:31795038-31795060 CAGGGCCGGCAGGCGGGGTGGGG + Exonic
1006179871 6:32148430-32148452 CGGGGCCGCCGAGGGGAGCGGGG + Exonic
1007371380 6:41428514-41428536 CGGAGGAGCCGCGCCGGGTGCGG + Intergenic
1007371382 6:41428522-41428544 CGGGGCCGCCGCACCCGGCGCGG - Intergenic
1007431512 6:41779902-41779924 CGCGGCCGCGGGGCGGGGCGGGG - Intronic
1007532368 6:42554277-42554299 CCGGCCCGCCGCGCAGAGTGCGG - Intergenic
1010043984 6:71420120-71420142 CGGGGCCGCAGCGCGGCCGGTGG - Intergenic
1010703299 6:79077760-79077782 CGGGGCCGCGGCCCGGGGCGCGG - Intronic
1014098172 6:117482568-117482590 AGGGGCCGACGTGCGGGGCGGGG + Intronic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1016386712 6:143536955-143536977 CGGGGCCGGAGCACCGGGTGGGG - Intronic
1017738209 6:157381909-157381931 CGGCGCCGCGGCTCGGGGGGCGG + Exonic
1017793638 6:157823070-157823092 CGGGGCGGCGGCGCGGCGCGGGG + Intronic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1018871653 6:167788381-167788403 CGGGGCCGGGGGGTGGGGTGGGG + Intronic
1018959975 6:168441226-168441248 CCGGGCCGCCGGGAGCGGTGGGG + Exonic
1019343176 7:518053-518075 CTGGGCCGGAGCCCGGGGTGGGG - Intronic
1019421919 7:954593-954615 CGGAACCGGCGCGCGGGCTGAGG - Intronic
1019450571 7:1095646-1095668 CGGGGCTGCTGTGAGGGGTGGGG - Intronic
1019509670 7:1411569-1411591 CGGGGGCGGCGGACGGGGTGGGG + Intergenic
1019536083 7:1530623-1530645 CGTGGCCGCGGGGCGGGGAGGGG + Intergenic
1019563224 7:1667947-1667969 CGCAGCCTCCGCTCGGGGTGGGG + Intergenic
1019563980 7:1670692-1670714 GGGGGGCGCCGGGCAGGGTGCGG - Intergenic
1021312668 7:19112593-19112615 CGGGCCCGGCTCGCGCGGTGGGG - Intronic
1023846430 7:44123532-44123554 CGGGGCAGGCGCGCGGGGATTGG - Intronic
1024216700 7:47254558-47254580 CGGGCTCGCCGGGCGGGGCGGGG - Intergenic
1025940904 7:66075748-66075770 CGCGGCCGTCGCCAGGGGTGGGG + Intergenic
1026772860 7:73213200-73213222 TGGGGCTCCCGCGGGGGGTGGGG + Intergenic
1026797869 7:73377556-73377578 CGGGGCGGCCGGGCGGGCGGCGG - Intergenic
1027001642 7:74658189-74658211 GCGGCCCGCCGCGCGCGGTGTGG + Intronic
1027390170 7:77696394-77696416 CGGGCCCTCCGCGAGGGGTAGGG - Intergenic
1028622222 7:92836732-92836754 TGGGGCGACCGTGCGGGGTGGGG + Intergenic
1029589635 7:101498866-101498888 CAGGGGTGCCGCGCGCGGTGGGG - Intronic
1032298830 7:130668472-130668494 CCGGGCAGCCGCGAGGGGAGGGG + Intronic
1033361252 7:140640503-140640525 CGGAGCCGCCGCCCGCGGGGAGG - Exonic
1034488752 7:151381835-151381857 CGGGGCCGCCGCCCGTGGGAGGG - Intronic
1034560623 7:151877327-151877349 TGGGGCCGCGGCGCGGCGGGGGG - Intergenic
1034617921 7:152435512-152435534 CGGCGCCCCCCGGCGGGGTGGGG - Intronic
1035431830 7:158828814-158828836 CGGGGCCGGGGGGCGGGGCGGGG + Intronic
1035437518 7:158870170-158870192 AGGGGCCGCAGCGGTGGGTGGGG + Intronic
1036785295 8:11681463-11681485 CCCGGTCCCCGCGCGGGGTGCGG + Intronic
1037313148 8:17577199-17577221 CGCGGCGGCTGCGCGGGGCGGGG - Exonic
1038883507 8:31639664-31639686 CGCGGCGGCGGCGCGGGGGGTGG + Intronic
1038883509 8:31639666-31639688 CGGCGGCGGCGCGGGGGGTGGGG + Intronic
1039454615 8:37698458-37698480 CGGGGGCGGCGGGCGGGGGGAGG - Exonic
1039842521 8:41304094-41304116 CAGGGCAGGCGGGCGGGGTGGGG + Intronic
1039903165 8:41767288-41767310 CGGGGCCGGGGCGCGGGGATCGG - Intronic
1040052806 8:43033049-43033071 CGGGGCGGCTGGGGGGGGTGGGG + Intronic
1040656721 8:49519115-49519137 CTGGGCCTCTGCGCAGGGTGAGG + Intergenic
1041066279 8:54085775-54085797 CGGGGCGGCTGGCCGGGGTGGGG - Intronic
1042216369 8:66432583-66432605 CGGGGCCGGCGGGCGGGCAGGGG + Intronic
1042695193 8:71547759-71547781 CGGGGCGGCCGAGCGGGGCGGGG + Intronic
1043303383 8:78762539-78762561 CAGGGCCGACGCGCGGGGGAGGG + Intronic
1043527450 8:81112083-81112105 CGGAGCAGCCGCGCGGGGAGCGG + Intergenic
1045063579 8:98427360-98427382 CCGGGCAGCCCCGCTGGGTGAGG + Intronic
1045571383 8:103371828-103371850 CGGGACCGCCGCGCTGGTGGAGG + Intronic
1045663937 8:104466555-104466577 CAGGGCCGCCTCGCGCGGCGCGG - Intronic
1046871282 8:119208347-119208369 CGGGCGCGCCGCGCGGGAGGAGG - Intronic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1048964961 8:139608621-139608643 CGGGGGGGCGGGGCGGGGTGGGG + Intronic
1049419579 8:142510843-142510865 CGGAGCCGCCGCTCGGGGGCCGG + Intronic
1049552448 8:143266917-143266939 TGGGGCCCCCGCGAGGGGAGCGG + Intronic
1049673165 8:143878537-143878559 CGGGGCCCCGACGCGGGGCGGGG + Intergenic
1049745435 8:144261240-144261262 CGGGGCTGCCGGGCGGCGTGGGG - Intronic
1050972304 9:11893234-11893256 TGGGGCTGCTGTGCGGGGTGGGG + Intergenic
1052740095 9:32384597-32384619 CGGGGCCGCCGCGCGATGGGCGG - Intronic
1054454849 9:65424544-65424566 CAGGGCAGCCACGTGGGGTGAGG + Intergenic
1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG + Intergenic
1057313510 9:93955417-93955439 GGGGGCGGCGGCGCGGGGCGGGG - Intergenic
1057488558 9:95505893-95505915 CGCGGCCGCCGCGCTGGGGAGGG - Intronic
1057489237 9:95508752-95508774 AGGGGTCGCGGCGCGGGGCGGGG - Intronic
1057801273 9:98192682-98192704 CGGGGCCGGAGGGCGGGGCGGGG + Intergenic
1058019111 9:100068580-100068602 CGGGGCAGCCGGCCGGGCTGGGG - Intronic
1059208253 9:112486782-112486804 CGGGGCCGGCGAGCGGGGCGGGG - Intronic
1060742466 9:126108586-126108608 AGGGGCGGCGGGGCGGGGTGGGG - Intergenic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1061127997 9:128689029-128689051 AGGGGACGCGGCGCGGGGGGCGG + Intronic
1061217074 9:129227629-129227651 CAGGGCTCCCGCGTGGGGTGGGG + Intergenic
1061293718 9:129666175-129666197 CGGGGCCGGGGCGCGGGGTCCGG + Intronic
1061307030 9:129738059-129738081 CGGGGCAGCCCCGCAGGGAGGGG + Intergenic
1061500368 9:130998234-130998256 CGGGGCCCCAGCGCTGAGTGTGG - Intergenic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061541062 9:131278002-131278024 CGGGGCCGGCGAGCGGGCGGCGG - Intergenic
1062269568 9:135702385-135702407 CGGGGCCTCCCCGCGTGGGGAGG - Intronic
1062364731 9:136203220-136203242 CGGGGCCGCGGGGCGGGGCGGGG + Intronic
1062389197 9:136327399-136327421 CGGGGCGGACGCGGGGGGAGGGG - Intergenic
1062414229 9:136439705-136439727 CGGGGACGCCGCTCGGGGAGAGG + Exonic
1062414275 9:136439861-136439883 CGGGGCCGGGGCGCGGGGCGGGG - Intergenic
1062461868 9:136665706-136665728 CGGGGCCGCCAGGTGGGGCGGGG + Intronic
1062467293 9:136686933-136686955 CGGGGCCAGGGCGGGGGGTGGGG + Intronic
1062526050 9:136978516-136978538 CGGGGCCACCTCCCGGGGCGGGG + Intronic
1062696262 9:137877767-137877789 CGGGGCCGCGGAGTCGGGTGAGG + Exonic
1203782040 EBV:106060-106082 CGGGGCCACCGGCCGTGGTGGGG - Intergenic
1203449631 Un_GL000219v1:99819-99841 CGGGGCTGCCGGGCGCGCTGTGG + Intergenic
1185877686 X:3713528-3713550 GGGGGCCGCGGCCCGGGCTGGGG + Exonic
1187332653 X:18354728-18354750 CGGGCCGGCCGCGCGGGGGGCGG - Intergenic
1187363689 X:18649972-18649994 CGGGGCGGCGGCGGCGGGTGGGG - Intronic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1187826117 X:23334552-23334574 CGGGGAGGCCGCGGGGGGTGGGG + Exonic
1188443125 X:30232013-30232035 CGGAGACCCCGAGCGGGGTGTGG + Intronic
1189446728 X:41086489-41086511 AGCGGCCGCCGGGCGGGGGGCGG - Intronic
1195728047 X:107937200-107937222 CAGGGCCGGGGCGCGGGGCGGGG - Intergenic
1197745912 X:129932236-129932258 GGGGGACGCCTCGCGGGGAGGGG - Intergenic
1197754303 X:129983704-129983726 GGGGGCCGCCGGGCCGGGCGCGG + Intronic
1197754434 X:129984102-129984124 CGGGGCGGGCGGGCGGGGCGTGG + Intronic
1198005466 X:132489306-132489328 CGGGGCCGGCCGGCGGGCTGTGG + Intronic
1198750367 X:139932360-139932382 CGAGCCCGCCGCGCGGGGGAAGG + Intronic
1200003468 X:153073425-153073447 CGTGGCCGGCGCCCTGGGTGTGG + Exonic
1200004255 X:153076584-153076606 CGTGGCCGGCGCCCTGGGTGTGG - Intergenic
1200074376 X:153543923-153543945 TGGGGCCAGTGCGCGGGGTGTGG + Intronic
1200110428 X:153738064-153738086 AGGGGCCGCTGCGAGCGGTGAGG - Intronic
1200205047 X:154309605-154309627 TGGGGCAGCCGCCCGAGGTGGGG - Intronic
1200216817 X:154371705-154371727 CAGGGCCCCTGCGGGGGGTGGGG + Intronic
1200239569 X:154486632-154486654 CGGGGCGGCGGCGCGCGGCGGGG - Exonic