ID: 900263803

View in Genome Browser
Species Human (GRCh38)
Location 1:1746798-1746820
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900263793_900263803 9 Left 900263793 1:1746766-1746788 CCGGGGCGGGGCCTTCGTATCCA 0: 2
1: 0
2: 1
3: 3
4: 56
Right 900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG 0: 2
1: 0
2: 0
3: 7
4: 94
900263796_900263803 -2 Left 900263796 1:1746777-1746799 CCTTCGTATCCAGGCTGGCGTCG 0: 2
1: 0
2: 0
3: 11
4: 428
Right 900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG 0: 2
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900126028 1:1069308-1069330 TGGCGCTGCAGCGGCACATCCGG + Intergenic
900187661 1:1339888-1339910 GGGGGCTGCTGGGGGACATGCGG - Intronic
900187674 1:1339927-1339949 AGGGGCTGCTGGGGGACATGCGG - Intronic
900255060 1:1693532-1693554 CGGGGCTGCCGCGGGACATCCGG + Intronic
900263803 1:1746798-1746820 CGGGGCTGCCGCGGGACATCCGG + Intergenic
902295775 1:15466013-15466035 CGGCCCTGCTGCAGGACATCAGG - Exonic
908354960 1:63319857-63319879 CGGCGCGGGCGCGGGACGTCGGG + Intergenic
1062890573 10:1056775-1056797 CGGGACTGGGGCGGGACTTCCGG + Intronic
1067078059 10:43199221-43199243 TGGCGCTGCCGGGGGACAGCAGG + Intronic
1075817403 10:125275437-125275459 CAATGCTGCCGTGGGACATCAGG + Intergenic
1076705367 10:132298442-132298464 AGGGGCTGCCGTGGGACCTGTGG - Intronic
1077155126 11:1087691-1087713 CGGGTGTGCCCCGGGACACCTGG + Intergenic
1084363775 11:68684920-68684942 GGGCGCTGCCTCGGGCCATCTGG - Exonic
1091777210 12:3192349-3192371 AGGGGCTGCCGCAGGACCCCAGG + Intronic
1096459407 12:51814122-51814144 CGGGGCTGCCGGGCGACGCCCGG + Intergenic
1103322436 12:120099923-120099945 CGGGGCTGCCGCCTGGCCTCCGG - Intronic
1112760524 13:102689479-102689501 CGGGGCTCCCTCAGGTCATCTGG - Intronic
1119379477 14:74219471-74219493 GGGGGCTGCCATGGGACCTCAGG - Intergenic
1119808540 14:77498416-77498438 CCGGGCTGCCGCGGACCAGCCGG - Intronic
1122657919 14:103274182-103274204 CGGGGCTGCTGCGGGGCTGCTGG - Intergenic
1127606001 15:60589479-60589501 CTCCGCTGCCGCGTGACATCTGG + Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1132635864 16:946235-946257 CGTGGCTGCTGCGGCACATGGGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1141481977 16:84312979-84313001 CGGGGCTGCCGGGGGCCGCCGGG - Exonic
1141699028 16:85634017-85634039 CGGGGCTGCCGCTGGGCACCAGG - Exonic
1142187249 16:88700484-88700506 CAGGGCAGCCCCTGGACATCTGG + Intronic
1146398482 17:32486698-32486720 CGCGGCTGCGGCGGGACACGCGG - Exonic
1148463905 17:47853151-47853173 CGGAGATGCCGCCTGACATCGGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148861045 17:50604489-50604511 CGGGGCTGCCGAGAGGCTTCAGG + Intronic
1151911126 17:77083978-77084000 CGGGGCTGCTGCCTGGCATCTGG - Intergenic
1152275291 17:79353028-79353050 AGGGACTGCCTCGGGACATCAGG + Intronic
1152284163 17:79402875-79402897 CGGGGCAGCCCCACGACATCCGG - Intronic
1152867612 17:82733830-82733852 CAGGGCTGCCGCAGAACAGCAGG - Intergenic
1156481707 18:37440439-37440461 CAGGGCTGCCCTGGGACAGCGGG - Intronic
1157580627 18:48771917-48771939 CGTGGCTGCCGCTGGAAAGCTGG + Intronic
1161659786 19:5539193-5539215 CGCATCTGCCACGGGACATCAGG + Intergenic
1163862924 19:19751648-19751670 CGGTGCTGCTGAGGCACATCAGG - Intergenic
1166748376 19:45152736-45152758 CGTGGCTGCCGGGGGACGCCGGG - Exonic
1167429544 19:49446662-49446684 TGGGGCTGTCGCTGGAGATCGGG - Exonic
1202701893 1_KI270712v1_random:170854-170876 TGGGGCTGCCGCGGGCCTTGAGG + Intergenic
926901182 2:17753664-17753686 CGGGGCTGCCGTGGTACGACCGG + Exonic
932428942 2:71661956-71661978 AGGGGCTGGCGCAGGACCTCAGG + Intronic
937293018 2:120793409-120793431 AGGGGCTGCCTGGGGACAGCAGG - Intronic
938379192 2:130827163-130827185 AGGGGCTGCTGCGGGATGTCTGG - Intergenic
946402535 2:219476036-219476058 GGGGGCTGGCGGGGGACACCTGG + Intronic
1170460571 20:16573406-16573428 TGGGGCTGCCGCGGAACTCCAGG - Exonic
1172587129 20:36092747-36092769 CGGGGCAGCCGCCGGACACCAGG + Intronic
1174174435 20:48636061-48636083 CAGGGATGCTGCTGGACATCCGG - Intronic
1175856065 20:62121878-62121900 CGGGGCTGCCCGGGAACACCCGG + Intergenic
1175982978 20:62750047-62750069 CGGGTCTGCTGAGGGACACCTGG - Intronic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1180962632 22:19768917-19768939 CAGGGCCGCCGCTGGCCATCCGG + Intronic
1183961306 22:41413494-41413516 GGGGGCAGCCGCGGGGCCTCGGG + Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
962213686 3:133501609-133501631 TGGGGCTGCTGCTGGTCATCGGG + Intergenic
979231298 4:118352185-118352207 CGGGGCGGCCGCGGAAACTCCGG - Intronic
981567079 4:146113212-146113234 CATGGCTGCCGCAGGACAGCGGG + Intergenic
984935984 4:184889730-184889752 CAGGGCTGCCCTGGGACCTCCGG - Intergenic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
993557605 5:89360649-89360671 CAGGGATGCCACTGGACATCTGG - Intergenic
993900909 5:93584070-93584092 CGAGGCTGCCGCCGGCGATCAGG - Exonic
999727025 5:154446036-154446058 AGGGGCTGCCGCGGGACTCGGGG + Exonic
1002256915 5:177964702-177964724 CGGGGCGGTGGTGGGACATCGGG - Intergenic
1003824897 6:9942273-9942295 CGGGGCTGGCGGGGGCCAGCCGG - Intronic
1004024506 6:11805776-11805798 TGGGGCTGCCGCTGCTCATCTGG + Intronic
1006284248 6:33080954-33080976 CGGGGCTGCCCTGGGACCGCCGG - Intronic
1006601921 6:35231913-35231935 AGGGGCTGCTGAGGGACAGCTGG - Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1010107069 6:72182608-72182630 CGTGCCTGGCGCGGGACACCCGG - Exonic
1010506734 6:76669832-76669854 CAGGTCTGCCGTGGCACATCTGG - Intergenic
1013290822 6:108717420-108717442 CGGGGCAGCTGCTGGACTTCGGG + Intergenic
1017616429 6:156251514-156251536 CAGGGCTGGCGCGGGGGATCTGG + Intergenic
1018945740 6:168345909-168345931 GGGGGCAGCCGGGGGACAGCTGG + Intergenic
1019621630 7:1995304-1995326 CGGGGCTGCTGAGGAAGATCAGG + Intronic
1020830730 7:13091681-13091703 CAGGGCTGCCTCTGGACATAGGG - Intergenic
1021614516 7:22488286-22488308 CAGGGCTCCCGCAGGAAATCTGG - Intronic
1022105449 7:27193186-27193208 CGGGGCTGCGGCAGGACGGCTGG - Intergenic
1023865539 7:44236506-44236528 CAGGGCTGCCTTGGGACATCAGG - Intronic
1026045318 7:66902659-66902681 CGGGGCTGCCGCGAGGCAGGGGG - Intergenic
1026045596 7:66903791-66903813 CGGGGCTGCCGCGAGGCAGGCGG - Intergenic
1027111396 7:75442622-75442644 CGGGGCTGCGGCGGGCCGGCCGG - Intronic
1027202481 7:76072547-76072569 CGGGGCTGCCGCGAGGCAGGTGG + Intergenic
1035269442 7:157711083-157711105 CCGGGCTGCCCCGGAACCTCCGG - Intronic
1035297597 7:157875980-157876002 CGGGGCTGCAGAGGGTCAGCAGG + Intronic
1036752525 8:11452364-11452386 CTGGGCTACAGCCGGACATCAGG + Intronic
1037089680 8:14898369-14898391 CGAGGCTGCCGCTGAACCTCTGG + Intronic
1040017212 8:42709303-42709325 CGGGGCTGCCTAGGGACAGCAGG - Intronic
1040323175 8:46328622-46328644 TGGGGCTGCCCAGGGACTTCTGG + Intergenic
1049237173 8:141518210-141518232 CGGGGGCGCCGCGGGACCTGCGG - Exonic
1049409178 8:142464861-142464883 CGGCCCTGCCGCGGGACCCCTGG + Exonic
1049607139 8:143534945-143534967 GGGGGCTGCCGCGGGAGGGCAGG - Intronic
1057466408 9:95317869-95317891 CGGGGCTTCCGCGCGAAACCGGG - Intergenic
1057700461 9:97360203-97360225 CCAGGCCTCCGCGGGACATCAGG + Intronic
1062624400 9:137436341-137436363 CGGGGCTGGCGTGGGTCATCCGG - Intronic
1062624418 9:137436393-137436415 CGGGGCTGGCGTGGGTCATCCGG - Intronic
1062624440 9:137436445-137436467 CAGGGCTGGCGTGGGTCATCCGG - Intronic
1192528499 X:71867788-71867810 CGGGACTGCCCTGGGACAGCTGG - Intergenic
1195753431 X:108178782-108178804 CGGGGCAGCCCTGGGACACCAGG - Exonic
1200232281 X:154449986-154450008 TGGGGCAGCAGCGGGACATTGGG + Intronic
1202368634 Y:24183060-24183082 CGGGGCTGGGGCGGGGCCTCAGG - Intergenic
1202502151 Y:25487057-25487079 CGGGGCTGGGGCGGGGCCTCAGG + Intergenic