ID: 900264642

View in Genome Browser
Species Human (GRCh38)
Location 1:1750997-1751019
Sequence CCCGAGGGGTGGTGTCGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900264642_900264650 13 Left 900264642 1:1750997-1751019 CCGAGTCGACACCACCCCTCGGG No data
Right 900264650 1:1751033-1751055 TGTCTACCCCTACCCCCGCCAGG 0: 2
1: 0
2: 1
3: 14
4: 161
900264642_900264651 14 Left 900264642 1:1750997-1751019 CCGAGTCGACACCACCCCTCGGG No data
Right 900264651 1:1751034-1751056 GTCTACCCCTACCCCCGCCAGGG 0: 2
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900264642 Original CRISPR CCCGAGGGGTGGTGTCGACT CGG (reversed) Intergenic