ID: 900264802

View in Genome Browser
Species Human (GRCh38)
Location 1:1751835-1751857
Sequence CCCGGCGCCCGCGTCTTCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900264802_900264812 21 Left 900264802 1:1751835-1751857 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900264812 1:1751879-1751901 CACAGCTGCCGGTGCTGGGCAGG 0: 1
1: 2
2: 1
3: 25
4: 362
900264802_900264810 17 Left 900264802 1:1751835-1751857 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900264810 1:1751875-1751897 GCTCCACAGCTGCCGGTGCTGGG 0: 1
1: 1
2: 2
3: 16
4: 162
900264802_900264807 10 Left 900264802 1:1751835-1751857 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900264807 1:1751868-1751890 TCCACGTGCTCCACAGCTGCCGG 0: 2
1: 0
2: 2
3: 18
4: 196
900264802_900264809 16 Left 900264802 1:1751835-1751857 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900264809 1:1751874-1751896 TGCTCCACAGCTGCCGGTGCTGG 0: 1
1: 1
2: 2
3: 14
4: 156
900264802_900264813 25 Left 900264802 1:1751835-1751857 CCGTGGAAGACGCGGGCGCCGGG 0: 2
1: 0
2: 1
3: 6
4: 96
Right 900264813 1:1751883-1751905 GCTGCCGGTGCTGGGCAGGCTGG 0: 1
1: 1
2: 9
3: 58
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900264802 Original CRISPR CCCGGCGCCCGCGTCTTCCA CGG (reversed) Exonic