ID: 900265341

View in Genome Browser
Species Human (GRCh38)
Location 1:1754369-1754391
Sequence CACCTCATTCAGGACCTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900265336_900265341 -9 Left 900265336 1:1754355-1754377 CCTCTGTCAATCACCACCTCATT 0: 1
1: 0
2: 1
3: 22
4: 221
Right 900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG 0: 1
1: 0
2: 3
3: 17
4: 178
900265328_900265341 29 Left 900265328 1:1754317-1754339 CCAGGTAGACATCCACATTGGAC 0: 1
1: 0
2: 1
3: 7
4: 71
Right 900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG 0: 1
1: 0
2: 3
3: 17
4: 178
900265332_900265341 17 Left 900265332 1:1754329-1754351 CCACATTGGACAGGTAGGAGGAG 0: 1
1: 0
2: 1
3: 19
4: 204
Right 900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG 0: 1
1: 0
2: 3
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900265341 Original CRISPR CACCTCATTCAGGACCTGGA GGG Exonic
900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG + Exonic
900511239 1:3062113-3062135 CACCTCTTTGAGGACCTAGGTGG - Intergenic
900587883 1:3442148-3442170 GTCCTCATTCAGGACAGGGAAGG + Intergenic
900639314 1:3681285-3681307 CACCTCACCGAGGACCTGGGAGG + Intronic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
901735834 1:11311576-11311598 CCCCTTATTCCAGACCTGGAGGG + Intergenic
902954873 1:19918742-19918764 CACAGCATTCAGGACCTTGAGGG - Intergenic
903844905 1:26273400-26273422 CACCTCTTTCAAGTCCTGTAAGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905940964 1:41863033-41863055 CACCTCCTCCAGTTCCTGGAAGG + Intronic
906480619 1:46197117-46197139 CACCTCCTTCAGATCCTAGAGGG + Intronic
908480521 1:64534816-64534838 CACCTTCTTCAGCTCCTGGAAGG + Intronic
911339304 1:96617800-96617822 CACCTCACTCAGGAAGTGCAAGG - Intergenic
912624471 1:111196042-111196064 CACTTCATCCAGGATCTGCAGGG + Exonic
915592106 1:156876392-156876414 CGCCTCCTTCAGTGCCTGGATGG - Exonic
916521729 1:165569570-165569592 CACATCATTTAGGGCCTGGTGGG - Intergenic
917534295 1:175863318-175863340 CTCCTCATCCAGAACCTGGGGGG + Intergenic
918119097 1:181521970-181521992 CACATCATTCAGGGCCTCGTTGG + Intronic
919924099 1:202183376-202183398 CACCTCCTTCAGCTCCTGCAGGG - Intergenic
920123415 1:203675456-203675478 ATCCTCATCCAGGGCCTGGAGGG - Intronic
923285052 1:232486132-232486154 CTCCTCATTTAAGAGCTGGATGG - Intronic
924617144 1:245621422-245621444 CACTTTATTAAGCACCTGGAAGG - Intronic
1063433136 10:6008484-6008506 GACCTCATTGAGTTCCTGGAGGG + Intergenic
1063671084 10:8100706-8100728 CTCCTCTTGCAGGACCTAGAGGG + Intergenic
1063756374 10:9014594-9014616 AACCTCATTTAAGACCTTGATGG + Intergenic
1067579639 10:47434083-47434105 CACCTCATCCAGGAAGTGCAAGG - Intergenic
1069728370 10:70595683-70595705 CACCTCACTAGGGACATGGAGGG + Intergenic
1072470223 10:95706807-95706829 CACCACCTTCAGGCCATGGAGGG - Intergenic
1076316173 10:129543312-129543334 CTCATCATTCACGACTTGGAAGG - Intronic
1076793997 10:132790043-132790065 CACCTTGCTCAGGACATGGATGG + Intergenic
1079111743 11:17609159-17609181 GACTTCATCCAGGACCTGGGGGG - Exonic
1081916003 11:46730570-46730592 CACTTCCTTTAGGGCCTGGAAGG + Intronic
1082558175 11:54587259-54587281 CACCTCATCCAGGAAGTGCAAGG - Intergenic
1084783756 11:71429653-71429675 CACCTCACTCAGCATCTGAAAGG - Intronic
1084960658 11:72714526-72714548 CACCTCATTCAGGCCAAAGAGGG - Intronic
1086411988 11:86552723-86552745 GACTTTATTCAGGAGCTGGAGGG - Intronic
1086796082 11:91104124-91104146 CACCTAACACAGGACCTGGCAGG - Intergenic
1091597010 12:1884984-1885006 CACCTGCTTCAGGATCTGGAAGG + Exonic
1091613995 12:2035215-2035237 GGCCTCCTTCAGGACTTGGAAGG - Intronic
1093983770 12:25504315-25504337 CACCTCATTCATCACCAGGCTGG - Intronic
1096818752 12:54217783-54217805 CAAGTCATTGAGGACATGGAGGG + Intergenic
1097694419 12:62762860-62762882 CACCTCATTGATGACCGAGAAGG + Intronic
1101625879 12:106440627-106440649 CACCTAAGTGAAGACCTGGAGGG - Intronic
1101957358 12:109222996-109223018 CACCCCACTGAGCACCTGGAGGG - Intronic
1102469537 12:113152004-113152026 CACCTCCTTCTGGGCCTGCAGGG - Exonic
1105024052 12:132837021-132837043 CTCCTCATTCAGCTCCTGCAGGG - Intronic
1105934290 13:25084989-25085011 GACCTTATTCAGGATCTGGCTGG + Intergenic
1110498040 13:76191678-76191700 CTCTTCATTCAGCACATGGAAGG - Intergenic
1112511200 13:100010934-100010956 CAACTCATACAGGCACTGGATGG - Intergenic
1112710692 13:102124658-102124680 CTCCTCATCCAGGAGCAGGAGGG + Intronic
1112801219 13:103111575-103111597 CAATTCATCCAGAACCTGGAAGG - Intergenic
1113164403 13:107422499-107422521 CATCACATTCAGGACATTGATGG + Intronic
1113196534 13:107814357-107814379 CTTCTCTTCCAGGACCTGGATGG - Intronic
1117988002 14:61407538-61407560 CTCCTCAGTGAGGACCTGGTGGG + Intronic
1121724585 14:96137985-96138007 GACCACATTGAGGAACTGGAGGG - Intergenic
1122022783 14:98853219-98853241 CCCCTCAGTCAGTGCCTGGATGG - Intergenic
1124005724 15:25793982-25794004 TACCTCATTCAGGATGTGTATGG + Intronic
1124103305 15:26715095-26715117 CAGCTCCTTGAGGACCTGGGGGG + Intronic
1124828108 15:33119980-33120002 CACCTCATTCAGGAATGCGATGG + Intronic
1125324879 15:38526424-38526446 CACCTGAGTTAGGCCCTGGAGGG + Intronic
1126273786 15:46851554-46851576 CACCTCTTGGAGGCCCTGGAAGG - Intergenic
1126722817 15:51600214-51600236 GACCACATTGAGGACCTGGGAGG - Intronic
1128256821 15:66202921-66202943 CAGTTCCTTCAGGCCCTGGAGGG - Intronic
1128315898 15:66659287-66659309 GACCTGATTCAGGACCTGGATGG + Intronic
1128697808 15:69781549-69781571 GACCTCATACAGGCCCTGAAGGG + Intergenic
1129300653 15:74623691-74623713 CTCCTCTCTCAGGAGCTGGAGGG + Intronic
1129312468 15:74722327-74722349 CTTCTCATTCAGGTCCTTGAAGG + Exonic
1130251142 15:82301030-82301052 TACTTCATTCAGCCCCTGGACGG + Intergenic
1131385420 15:92002376-92002398 CTCCTCATTCAGGACCTGTCTGG + Intronic
1133398180 16:5464930-5464952 CACCTCCTTTAGGAGCTTGAGGG + Intergenic
1137507308 16:49065426-49065448 GCCCTCATTCAGGCCCTGGCAGG - Intergenic
1139347758 16:66315311-66315333 CACCTCTTTCAGAATCTGGGAGG + Intergenic
1142413191 16:89926366-89926388 AACCGCATTCGGGTCCTGGAGGG + Intronic
1144715888 17:17435707-17435729 CACCTCATTTACCACCTTGAGGG - Intergenic
1147851765 17:43449239-43449261 CACCTCCTCCAGGAGGTGGAGGG - Intergenic
1147883971 17:43672146-43672168 CACCTCCTCCAGGACTTGGATGG - Intergenic
1150152440 17:62821542-62821564 CACCTCATGCAGCACGAGGAGGG - Intergenic
1152719209 17:81914688-81914710 CACCACATGCTGCACCTGGAAGG + Exonic
1155563404 18:27105616-27105638 CACCTCTTTCAAGTCCTGCAAGG + Intronic
1160159819 18:76462461-76462483 CACCTCATTAAAGACCTGCCTGG + Intronic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1161066112 19:2238499-2238521 AAACTCATTCAGGATATGGAAGG - Intronic
1162794368 19:13078907-13078929 CACCTCATCGAGGACCAGGCCGG + Intronic
1165443359 19:35843553-35843575 CACCTCAGTGGGGTCCTGGAGGG + Exonic
1165834150 19:38744118-38744140 CTCCTCATCCACGAGCTGGATGG + Exonic
1166284114 19:41813134-41813156 TCCCTCTCTCAGGACCTGGAGGG - Intergenic
927027906 2:19089435-19089457 CACCTCATGCAGGAAGTGCAAGG + Intergenic
927689948 2:25201507-25201529 CACATCATTTCGTACCTGGATGG - Intergenic
929947437 2:46381703-46381725 CACCCCGCTCAGGTCCTGGAAGG - Exonic
931440748 2:62288511-62288533 TACATCATTCTGGCCCTGGAAGG - Intergenic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
936974779 2:118207966-118207988 GCCCTCAATCAGGACCTGCATGG + Intergenic
939577281 2:143911473-143911495 CAACTCAGTCAGGAGCTGGCTGG - Intergenic
940384557 2:153055467-153055489 GAGCTCATTGAGGACCTGGTAGG + Intergenic
944360146 2:198844575-198844597 CTCCTTATTCTGTACCTGGATGG + Intergenic
944540378 2:200748598-200748620 CACCTTATTCTGGATCTGGGGGG + Intergenic
945213892 2:207412974-207412996 CACATGATTAAGGAGCTGGAGGG - Intergenic
945984231 2:216341197-216341219 CATCTCAGTCAGGACATGGAAGG - Intronic
948120880 2:235529590-235529612 CACAAAATCCAGGACCTGGAAGG + Intronic
1169279773 20:4257089-4257111 CATCTTATTCATGAGCTGGAGGG - Intergenic
1171024752 20:21619736-21619758 CATTTCATTGAGGACATGGATGG + Intergenic
1172029164 20:31969205-31969227 CAGCTCATTCACAACCTGCAAGG + Intronic
1173116350 20:40247324-40247346 TAAGTCATTCAGGACCTGTAAGG + Intergenic
1173944705 20:46941266-46941288 CACCTCACAGAGGAGCTGGAAGG + Intronic
1174546746 20:51331460-51331482 CACCTCTTTCAGGCCCTGGATGG + Intergenic
1175140257 20:56855585-56855607 CAGCCCAGTCATGACCTGGAGGG - Intergenic
1175466658 20:59194206-59194228 CACTTAGTTCAGGACATGGAGGG + Exonic
1176141907 20:63548565-63548587 CACCCCACTCAGGACCCGGAGGG - Intronic
1177863100 21:26478499-26478521 CAACTCATGCAGTACCTTGAAGG + Intronic
1180571281 22:16723166-16723188 AACCACATTCAGGAAATGGAAGG - Intergenic
1182162118 22:28133415-28133437 CACCTCACTCAGGAAGTGCAAGG + Intronic
1184349903 22:43936718-43936740 CACCTAGCTCAGGGCCTGGAAGG + Intronic
1184617395 22:45647285-45647307 CATATCATTCAGGACCTTCATGG - Intergenic
1185037812 22:48489100-48489122 CACCGCAGCCAGGGCCTGGAAGG - Intergenic
949605815 3:5652331-5652353 CAGCTCATTCAGAACCATGAAGG - Intergenic
949688332 3:6604155-6604177 CTACTCCTTCAGGAGCTGGATGG + Intergenic
949842955 3:8340036-8340058 CACATCATTCAGGACCTTATAGG - Intergenic
951150401 3:19282816-19282838 CAGCTGATTCAGAACGTGGATGG - Intronic
952341131 3:32448604-32448626 CATCTCATCCAGGGCCTGCAAGG + Intronic
955137706 3:56236376-56236398 CTTCACATTCAGGGCCTGGATGG - Intronic
957106910 3:75901245-75901267 AACCACATTCAGGAAATGGAAGG + Intergenic
958742936 3:98096367-98096389 CACCTCATCCAGGAAGTGCAAGG - Intergenic
961056253 3:123791090-123791112 CACCTAGAACAGGACCTGGAGGG + Intronic
962084462 3:132175463-132175485 CGCCTCATCCAGAACTTGGATGG - Intronic
962975089 3:140439164-140439186 CACCACATTCCGTTCCTGGAAGG - Intronic
963139739 3:141937584-141937606 CCCCTCCCTCAGCACCTGGAAGG + Intergenic
963305436 3:143647106-143647128 CACCTAAATCAGGGCCTGGTGGG - Intronic
966834192 3:184036794-184036816 AACCTCATTCAGAACAAGGAGGG + Exonic
967882500 3:194311827-194311849 CTCCTCATTCAGAACCTGGCAGG - Intergenic
968756270 4:2417957-2417979 CTCCTCATCCCGGTCCTGGACGG - Intronic
971137917 4:23889954-23889976 GGCGTCATTCAGGAGCTGGATGG - Exonic
972148868 4:36064467-36064489 CACCCCATTCACTACCTGCAGGG - Intronic
973686881 4:53378824-53378846 CACATCATCAAGGACCTGCATGG - Intronic
975219481 4:71797614-71797636 CACCTCAGTCAGGAGGTGCAAGG - Intronic
981839531 4:149094522-149094544 CACCTCATCCAGGAAGTGCAAGG - Intergenic
984024878 4:174530886-174530908 CAACTCGTTCATGACCAGGAGGG - Intergenic
984274875 4:177597568-177597590 CATCTCAATCTGCACCTGGAGGG - Intergenic
986333613 5:6736353-6736375 CACCTCTTACAGGACCTGCCAGG - Intronic
986664306 5:10086986-10087008 CTCCTCATTCAGAACTTGGGTGG - Intergenic
988131916 5:27117691-27117713 GACTTCATTCAGGAGGTGGAAGG - Intronic
993579232 5:89639064-89639086 CACCTCCTCCAAGACCTGAATGG + Intergenic
994164838 5:96597873-96597895 CACCCCAGTGAGGATCTGGAGGG + Intronic
995785811 5:115826169-115826191 CGCCTCATGCAGGAAGTGGAAGG - Intergenic
995968653 5:117940527-117940549 CACCTCATTCAGGTCCTGACAGG - Intergenic
996669999 5:126106682-126106704 AACATCATTCAGAAGCTGGAAGG + Intergenic
996910959 5:128656240-128656262 CACCTCATCCAGGAAGTGCAAGG - Intronic
999090956 5:148935451-148935473 CACCTCCTTCAGTTGCTGGAGGG - Intronic
1000261305 5:159591199-159591221 CACAACATTCAGAACATGGAAGG + Intergenic
1001756143 5:174171766-174171788 CACCTGATTCAGGACCCAGGTGG - Intronic
1005206265 6:23408809-23408831 CTCCTCTTTTAGTACCTGGAAGG - Intergenic
1007159284 6:39775635-39775657 CCCCTCATTTAGGACCTAGAGGG + Intergenic
1013767055 6:113587187-113587209 TCTCTCATTCAGGACCTGGAAGG - Intergenic
1018082610 6:160271318-160271340 CCCCTCATTAAGGAACGGGAAGG + Intronic
1022079781 7:27008384-27008406 CACCTCATCCAGGAAGTGCAAGG - Intergenic
1022454523 7:30546734-30546756 CACATCAGTCAGGATCTGGCAGG - Intronic
1022468446 7:30666692-30666714 CGCCTCATTCCTGACCTGAAAGG - Intronic
1023766983 7:43520972-43520994 CACCTGCCTCAGGACCTGAAGGG - Intronic
1023866361 7:44240268-44240290 CAGCTCATCCAGAACTTGGAAGG + Intronic
1025042752 7:55662415-55662437 CTCCTCCTTCAGGCCCTGGACGG - Intergenic
1026294333 7:69038033-69038055 AATCTCATGCATGACCTGGAAGG + Intergenic
1030016270 7:105225441-105225463 TACTTCATTCAGGACATGGAGGG - Intronic
1030325938 7:108218199-108218221 CACCTCACTCAGGAAGTGCAAGG - Intronic
1033216923 7:139500035-139500057 CACCTCATCCGGGCCCTGGTGGG - Intergenic
1033349049 7:140546925-140546947 CACCTCATCCAAGATCTGCAAGG + Exonic
1036294917 8:7528059-7528081 GACCCCACTCAGGACTTGGAAGG - Intergenic
1036296552 8:7542640-7542662 GACCCCACTCAGGACTTGGAAGG - Intergenic
1036326014 8:7778379-7778401 GACCCCACTCAGGACTTGGAAGG + Intergenic
1036327646 8:7792932-7792954 GACCCCACTCAGGACTTGGAAGG + Intergenic
1036804534 8:11820812-11820834 CACCTCATCCAGGAAGTGCAAGG - Intronic
1037937845 8:22927352-22927374 CACCTCTCCCAGGACCAGGAGGG - Intronic
1039931232 8:41991511-41991533 GTTCTCTTTCAGGACCTGGATGG + Intronic
1042946114 8:74156378-74156400 CACCTCATCCAGGAAGTGCAAGG + Intergenic
1043800896 8:84608330-84608352 CACCTCATGCAGGACTGGGATGG + Intronic
1045552976 8:103189071-103189093 CAACTAATTCAGTGCCTGGAAGG + Intronic
1047236810 8:123048845-123048867 CACATCATATAGGGCCTGGAAGG - Intronic
1049374156 8:142281135-142281157 CAGCTCAGTCAGGGCATGGAGGG + Intronic
1049469435 8:142768878-142768900 CTGCTCATTCAGGGCCTGGGAGG + Intronic
1049782374 8:144434875-144434897 CACCTCAGCCAACACCTGGAAGG + Exonic
1050370785 9:4919887-4919909 CACCTCCATCAGGACCTTTAAGG + Intergenic
1053420031 9:37971509-37971531 CATCTCACTCAGGAGCTGGAGGG - Intronic
1053480155 9:38410614-38410636 CCCCTCATTCAGGACCCAGCTGG - Intronic
1055436209 9:76294769-76294791 CACCTCCTTCTGGACCTCCAAGG - Intronic
1057074755 9:92132612-92132634 CACCTCCTTCAGCTCCTGCAGGG - Intergenic
1057907931 9:98996752-98996774 CACCTCTTTCAGGCCCTGGGAGG + Intronic
1058839808 9:108895321-108895343 CACCTCACCCAGTCCCTGGAGGG + Intronic
1059725591 9:117005479-117005501 GACCACATTGAGGAACTGGAAGG - Intronic
1060196182 9:121625008-121625030 CCCCTCATCCATGCCCTGGACGG - Intronic
1060914968 9:127382878-127382900 AGCCTCATTCAGGACAAGGATGG - Intronic
1062099864 9:134722430-134722452 CACCTTATGCAGGGCCTGCAAGG + Intronic
1062618930 9:137410932-137410954 GACCTCACTCAGGCCCTGGGGGG - Intronic
1203435147 Un_GL000195v1:130925-130947 CATCTCAGGAAGGACCTGGAAGG + Intergenic
1187412207 X:19061382-19061404 GACATCATTCAGGTCCTAGAGGG - Intronic
1189039844 X:37530726-37530748 CACCTCACTCAGGAAGTGCAAGG - Intronic
1191907439 X:66108251-66108273 CACCTCATCCAGGAAGTGCAAGG - Intergenic
1192270920 X:69578550-69578572 CACTGCCTCCAGGACCTGGAGGG + Intergenic
1197702468 X:129609682-129609704 CACCTCCCTCAGGACCTGGGAGG + Intergenic
1198581783 X:138073600-138073622 CACCTCACCCAGGACGTGCAAGG + Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic
1201992622 Y:20043668-20043690 CACCTCACTCAGGAAGTGCAAGG - Intergenic