ID: 900265494

View in Genome Browser
Species Human (GRCh38)
Location 1:1755107-1755129
Sequence ACAGAAGTGTCGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1485
Summary {0: 1, 1: 0, 2: 26, 3: 209, 4: 1249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900265494_900265499 23 Left 900265494 1:1755107-1755129 CCGCGCCCGGCCGACACTTCTGT 0: 1
1: 0
2: 26
3: 209
4: 1249
Right 900265499 1:1755153-1755175 TCACTTCTGCCCAACACACATGG 0: 1
1: 0
2: 1
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900265494 Original CRISPR ACAGAAGTGTCGGCCGGGCG CGG (reversed) Intronic
900015883 1:149385-149407 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
900046147 1:507982-508004 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
900068349 1:749694-749716 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
900152894 1:1187134-1187156 AAAGAACTTTTGGCCGGGCGCGG - Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
900292967 1:1932104-1932126 AGAAAAATGTAGGCCGGGCGCGG + Intronic
900982827 1:6056333-6056355 GGGGAAGTGTAGGCCGGGCGCGG - Intronic
901247183 1:7741271-7741293 TTAGAAATGTTGGCCGGGCGCGG + Intronic
901343985 1:8522579-8522601 AATGAAGTGTCAGCCGGGCAGGG + Intronic
901466983 1:9428329-9428351 AATGAAGTATCGGCCAGGCGTGG - Intergenic
901486131 1:9563212-9563234 ACTAAAGAATCGGCCGGGCGCGG - Intronic
901581188 1:10244900-10244922 AGAAAAATGGCGGCCGGGCGCGG - Intronic
901625373 1:10621633-10621655 AAAGAATTCTTGGCCGGGCGCGG - Intronic
901676439 1:10888661-10888683 ACAGAAGGGGCGGAGGGGCGCGG + Intergenic
901698963 1:11033036-11033058 AAAATATTGTCGGCCGGGCGCGG + Intronic
901790607 1:11651987-11652009 AAAGAAAAGTCAGCCGGGCGTGG - Intronic
902295669 1:15465297-15465319 AGTTAAGTGTCGGTCGGGCGCGG - Intronic
902461438 1:16580336-16580358 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902462223 1:16586635-16586657 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902506300 1:16940676-16940698 AAATAAATGTTGGCCGGGCGCGG - Intronic
902588769 1:17458546-17458568 GACGAAGTCTCGGCCGGGCGCGG - Intergenic
902862950 1:19258970-19258992 ATAAAACTGTGGGCCGGGCGCGG + Exonic
902900024 1:19508449-19508471 AAAGAATGGTTGGCCGGGCGCGG + Intergenic
902944039 1:19821261-19821283 AAAGCAGTCTAGGCCGGGCGTGG - Intergenic
903326924 1:22574132-22574154 ACAAAAAAGTTGGCCGGGCGTGG - Intronic
903476583 1:23623474-23623496 AAAGATGTTTCGGCCGGGCACGG - Intronic
903632981 1:24790876-24790898 AAAGTAGTATGGGCCGGGCGTGG + Intronic
903711214 1:25326059-25326081 ACTGAAGTTTTGGCCGGGCATGG - Intronic
903715734 1:25365370-25365392 ACTGAAGTTTTGGCCGGGCATGG + Intronic
903785799 1:25860444-25860466 ACAAAATTTTTGGCCGGGCGCGG - Intergenic
903881004 1:26509183-26509205 ATACAACTTTCGGCCGGGCGCGG - Intergenic
903949771 1:26989559-26989581 ACACAAGGGTAGGCCGGGTGCGG - Intergenic
904120962 1:28197539-28197561 AATGAAGTGTAGGCTGGGCGTGG - Intergenic
904186055 1:28705739-28705761 ATAGATGTATCGGCTGGGCGCGG - Intronic
904225568 1:29015265-29015287 AGAGAAATGTAGGCTGGGCGTGG + Intronic
904473670 1:30751105-30751127 AGAGAAGTCTCGGCCAGGCCAGG + Intronic
904520691 1:31093397-31093419 ATAGATGTTTAGGCCGGGCGCGG - Intergenic
904551587 1:31323609-31323631 ACAGAGGTCTAGGCCGGGCTCGG - Intronic
904799011 1:33079894-33079916 ACTGTAGTTTTGGCCGGGCGCGG + Intronic
905091488 1:35434375-35434397 ATAGAAATGATGGCCGGGCGCGG - Exonic
905611104 1:39352420-39352442 ACAGAAGTGCCGGACTGGCTTGG - Intronic
905613612 1:39377300-39377322 ACAAAATAGTTGGCCGGGCGCGG - Intronic
905937655 1:41837614-41837636 ACAAAAGAGCAGGCCGGGCGTGG - Intronic
906487944 1:46246248-46246270 AAAGAATTCTGGGCCGGGCGCGG - Intergenic
906548278 1:46638326-46638348 AAAGAAGTTTGGGCCAGGCGTGG + Intronic
906633886 1:47395295-47395317 ATAGAATTGTTGGCCGGGCACGG - Intergenic
907918066 1:58888745-58888767 AAAGGGGTGTGGGCCGGGCGCGG - Intergenic
908296793 1:62720510-62720532 AAAGAAATGTTGGCCGGGCTAGG - Intergenic
908306740 1:62826524-62826546 AGGGAATGGTCGGCCGGGCGTGG - Intronic
908365383 1:63417843-63417865 AAAGTAGTGTTGGCCGGGCACGG + Intronic
908380062 1:63589293-63589315 AAAATAGTCTCGGCCGGGCGCGG - Intronic
908675703 1:66601071-66601093 AAAGAAGTAAAGGCCGGGCGCGG + Intronic
908887859 1:68810671-68810693 ACACAGCTGTCGGCCGGGTGCGG - Intergenic
909160011 1:72135084-72135106 AAATAACTTTCGGCCGGGCGTGG + Intronic
909588732 1:77321179-77321201 ATACAAGTCTCGGCCGGGCGTGG + Intronic
909783336 1:79577313-79577335 AAAGATTTCTCGGCCGGGCGCGG - Intergenic
910179175 1:84462716-84462738 AAAGAAATGTGGGCCAGGCGCGG - Intergenic
910255443 1:85242696-85242718 AAAGAATTCTTGGCCGGGCGTGG - Intergenic
910499226 1:87870590-87870612 AAATAATTGTCGGCCGGGCGCGG + Intergenic
910759277 1:90718799-90718821 ACTGCGGTGTCGGGCGGGCGCGG + Intergenic
910866669 1:91794491-91794513 AAAAAAGTGGAGGCCGGGCGAGG - Intronic
910963577 1:92785787-92785809 TTAGAAGTGACAGCCGGGCGCGG + Intronic
910966273 1:92811055-92811077 AGAGGAGGGTCGGCCGGGCGCGG - Intergenic
911003893 1:93198039-93198061 GCAGGAGAGTGGGCCGGGCGCGG - Intronic
911065671 1:93785901-93785923 ATAAAAGTGCCGGCCGGGCGCGG + Intronic
911133875 1:94418654-94418676 AGAGACCTGTCGGCCGGGTGGGG - Intronic
912277786 1:108278757-108278779 TAAGAAGAGTCGGCCGGGCGCGG + Intergenic
912290440 1:108415602-108415624 TAAGAAGAGTCGGCCGGGCGCGG - Intronic
912325832 1:108761194-108761216 ACAGCAGTATCAGCTGGGCGTGG - Intronic
912335750 1:108861111-108861133 ACATATTTGTAGGCCGGGCGTGG + Intronic
912360387 1:109090286-109090308 AAACAAGTCGCGGCCGGGCGCGG - Exonic
912765879 1:112410100-112410122 AAATAAGTGTAGGCCGGGCACGG + Intronic
912792666 1:112667993-112668015 TGAGAAGTGTGGGCCGGGAGTGG + Intronic
913146889 1:116000920-116000942 ACAGGAAGGTCGGCCGGGCATGG - Intronic
913270477 1:117088245-117088267 AAAGAAAAGTCGGCTGGGCGCGG + Intronic
913602505 1:120435551-120435573 AAAGAGAAGTCGGCCGGGCGCGG + Intergenic
913603240 1:120441882-120441904 TAAGAAGTCTCGGCCTGGCGCGG + Intergenic
913603987 1:120448234-120448256 TAAGAAGTCTCGGCCTGGCGCGG + Intergenic
913676946 1:121149851-121149873 AAAGAATTGGAGGCCGGGCGCGG + Intergenic
914147531 1:145009296-145009318 ACAAAACTGGCGGCCGGGCGCGG + Intronic
914190552 1:145406222-145406244 AAAGAGAAGTCGGCCGGGCGCGG - Intergenic
914588358 1:149083096-149083118 AAAGAGAAGTCGGCCGGGCGCGG - Intronic
914687385 1:149992858-149992880 CCAAAAGTGTTGGCCGGGCATGG + Intronic
914740925 1:150464297-150464319 AAACAAGTATTGGCCGGGCGAGG - Intronic
915173159 1:153992641-153992663 AGTTAACTGTCGGCCGGGCGCGG - Intergenic
915307729 1:154990305-154990327 ACAGAAGTAGGGGTCGGGCGTGG - Intronic
915428726 1:155848855-155848877 ACGGAATTGTAGGTCGGGCGCGG + Intronic
915460365 1:156066943-156066965 AAAAAAGTGTCAGCTGGGCGCGG + Intronic
915481249 1:156187400-156187422 AAAGCAGTCTTGGCCGGGCGCGG + Intergenic
915485023 1:156214202-156214224 ATAAAAGTGAAGGCCGGGCGCGG - Intronic
915546952 1:156605299-156605321 ATAGAAATGTAGGCCGGGCATGG + Intergenic
915781677 1:158558791-158558813 CAAGAAGTTTTGGCCGGGCGCGG - Intergenic
915870537 1:159555617-159555639 AAGAAAGTGTAGGCCGGGCGCGG + Intergenic
916044036 1:160985341-160985363 ATAAAAGTTTCGGCTGGGCGTGG + Intergenic
916071732 1:161174115-161174137 ATAAAAGTGAAGGCCGGGCGCGG + Intronic
916098959 1:161377169-161377191 AAAGACATGTAGGCCGGGCGTGG + Intergenic
916201245 1:162273453-162273475 ACAGAGGCTTCGGCCGGGCGCGG - Intronic
916310498 1:163393635-163393657 ACTATAGTTTCGGCCGGGCGTGG + Intergenic
916680332 1:167098297-167098319 AAAAAAGTTTGGGCCGGGCGTGG - Intronic
916718038 1:167461557-167461579 AGAAAATAGTCGGCCGGGCGTGG + Intronic
916772700 1:167928056-167928078 AAAAAAAGGTCGGCCGGGCGCGG + Intronic
916773882 1:167939470-167939492 ACAGTACTCTTGGCCGGGCGCGG + Intronic
916909008 1:169324143-169324165 ACTGAAGTGGGGGCTGGGCGCGG - Intronic
917115005 1:171594187-171594209 ACAAATCTGTCAGCCGGGCGTGG + Intergenic
917233082 1:172858920-172858942 ACACAAGTTTGGGCCAGGCGTGG + Intergenic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
917973166 1:180221371-180221393 ACATAAGTGGTGGCCGGGCGTGG - Intergenic
918732041 1:188011095-188011117 AAAGAAATGCCGGCCGGGCGCGG - Intergenic
919375603 1:196790434-196790456 ACAGGAATGTCGGCCTGGGGTGG + Intronic
919385302 1:196915345-196915367 ACAGGAATGTCGGCCTGGGGTGG + Intronic
919480699 1:198085305-198085327 AAAAAATTGTCGGCCGGGCTCGG + Intergenic
919930818 1:202220507-202220529 ATTGTAGTGTGGGCCGGGCGTGG - Intronic
920014615 1:202896479-202896501 TCAGAAGTTTGGGCTGGGCGTGG - Intronic
920023397 1:202973050-202973072 AAAGAACTCTCAGCCGGGCGTGG - Intergenic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920105666 1:203551579-203551601 ACCAAACTGTAGGCCGGGCGTGG - Intergenic
920126318 1:203696215-203696237 ACCCAAGAGTGGGCCGGGCGTGG - Intronic
920145253 1:203855338-203855360 GCAGAACTGTTGGCTGGGCGTGG - Intergenic
920339383 1:205266298-205266320 ACATAATTTTGGGCCGGGCGCGG + Intronic
920385764 1:205569348-205569370 AGGGAAGGGTCGGCCCGGCGAGG - Intronic
920461378 1:206143306-206143328 TCAGAACTGTCGGTCGGGAGGGG + Intergenic
920484853 1:206360094-206360116 AGAGCAATATCGGCCGGGCGCGG - Intronic
920532433 1:206713574-206713596 ACAGAAGAGTAGGCCAGGCATGG + Intronic
920577038 1:207069033-207069055 AAAGAAATGTCGGCCGGGCACGG - Intronic
920642052 1:207762559-207762581 AAAGAAGTGGTGGCCAGGCGCGG + Intronic
921156087 1:212439959-212439981 AAATAAGTGTCGGCTGGGCATGG + Intronic
921173644 1:212572000-212572022 AAAGTATTGGCGGCCGGGCGCGG - Intronic
921444285 1:215226613-215226635 AAAGAAAGGTTGGCCGGGCGCGG - Intronic
921489556 1:215757991-215758013 ATAGAAGAGTAAGCCGGGCGTGG + Intronic
921656439 1:217744170-217744192 AAAGAATTTTCGGCCGGGCGCGG + Intronic
921688750 1:218122331-218122353 AGAGAAGGGTAGGCCGGGCAAGG - Intergenic
921726227 1:218526736-218526758 TGATAAATGTCGGCCGGGCGAGG + Intergenic
921729916 1:218566399-218566421 AAAGGATTGTCGACCGGGCGTGG + Intergenic
922103711 1:222495079-222495101 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
922264027 1:223967596-223967618 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
922276914 1:224087785-224087807 AGACAAGTGAAGGCCGGGCGCGG + Intergenic
922292692 1:224221777-224221799 AGAGACATGTCGGCCGGGCGCGG - Intergenic
922486507 1:225977257-225977279 ATAAAACTGTCGGCCAGGCGCGG + Intergenic
922584078 1:226720749-226720771 AAAGAAATATTGGCCGGGCGCGG + Intronic
922625465 1:227036718-227036740 ACTGAATTGAAGGCCGGGCGCGG - Intronic
922646424 1:227291256-227291278 AAAGAAGTCTAGGCTGGGCGCGG + Intronic
922953632 1:229580367-229580389 AAAGAAGAATAGGCCGGGCGTGG - Intergenic
923159863 1:231306689-231306711 GTAGAAAGGTCGGCCGGGCGCGG - Intergenic
923413064 1:233729399-233729421 ACAGGGCTGGCGGCCGGGCGCGG + Intergenic
923577227 1:235170446-235170468 ACATAAGTGGAGGCCGGGCACGG + Intronic
924055021 1:240116598-240116620 ACAGAAATGTTGGCTGGGTGTGG + Intronic
924112668 1:240715263-240715285 AAAGAGGTATAGGCCGGGCGTGG + Intergenic
924345875 1:243072591-243072613 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
924383749 1:243484753-243484775 TAAGAGGTGTTGGCCGGGCGCGG + Intronic
924508110 1:244704946-244704968 AAAAAAGTGTGGGCCAGGCGCGG - Intronic
924540459 1:244975976-244975998 ACATAAGAGTTGGCCAGGCGTGG + Intronic
924551457 1:245081757-245081779 AAAGAACACTCGGCCGGGCGTGG - Intronic
1062784806 10:255265-255287 AATGAGGTGTCGGCCAGGCGTGG + Intergenic
1063192393 10:3708300-3708322 AAAAAACTCTCGGCCGGGCGCGG - Intergenic
1063387339 10:5624311-5624333 AAAGAAGTGGGGGCTGGGCGTGG - Intergenic
1063446603 10:6121859-6121881 ACAGAAGAGTGGGCTGGGCATGG - Intergenic
1063468181 10:6262162-6262184 ACAAAGCTGTTGGCCGGGCGTGG + Intergenic
1063565840 10:7171878-7171900 ACAGAGGTGATGCCCGGGCGTGG - Exonic
1063926605 10:10983853-10983875 ACAGATATATCGGCCAGGCGTGG - Intergenic
1064000957 10:11663380-11663402 AAAAAAGTCTGGGCCGGGCGTGG - Intergenic
1064102522 10:12476000-12476022 AGAGAAGTCTAGGCCGGGTGGGG + Intronic
1064134018 10:12735184-12735206 ACGAAAGTGTCGGCCGGGCGCGG + Intronic
1064253366 10:13724096-13724118 AGAGATTTGTCAGCCGGGCGCGG + Intronic
1064377461 10:14809948-14809970 CCCAAAGTGTCGGCCGGGCGCGG + Intergenic
1064885208 10:20103931-20103953 AAAGATGTGTCAGCCGGGCACGG - Intronic
1064894663 10:20221131-20221153 AAAAAAGTGTTGGCCGTGCGTGG - Intronic
1064983789 10:21189755-21189777 ACAGAAGGCTGGGCCAGGCGCGG - Intergenic
1065251979 10:23824337-23824359 AAAGATATGTAGGCCGGGCGCGG + Intronic
1065469349 10:26061217-26061239 AACAAGGTGTCGGCCGGGCGTGG - Intronic
1065724801 10:28658971-28658993 ATAGAAGGGTCAGCCGGGCACGG - Intergenic
1065930042 10:30471324-30471346 AAAGGAGTTTGGGCCGGGCGCGG - Intergenic
1065980257 10:30887676-30887698 AGAGGAGTTTAGGCCGGGCGCGG - Intronic
1066099544 10:32105625-32105647 AGAAAAGTATTGGCCGGGCGCGG + Intergenic
1066311159 10:34198015-34198037 ACAGCAGATTCGGCCGGGCGCGG - Intronic
1066564478 10:36707067-36707089 AAACCAGTGGCGGCCGGGCGTGG + Intergenic
1066825737 10:39572750-39572772 AAAGAAAGGTTGGCCGGGCGCGG - Intergenic
1067410272 10:46058389-46058411 AAAGCAGTGTTGGCCCGGCGCGG - Intergenic
1067763748 10:49069960-49069982 AAAGAAATATCGGCCGGGCGCGG + Intronic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068207633 10:53876474-53876496 ATACAAGAGTTGGCCGGGCGCGG - Intronic
1068274462 10:54775605-54775627 ACAAATATCTCGGCCGGGCGCGG + Intronic
1068539122 10:58271328-58271350 AAAAAATAGTCGGCCGGGCGCGG - Intronic
1068865393 10:61889670-61889692 ACAGCACCCTCGGCCGGGCGCGG - Intergenic
1068872322 10:61958514-61958536 AAAGAGGTCACGGCCGGGCGCGG - Intronic
1068882756 10:62067371-62067393 ACAGAAGTTCTGGCCGGGCATGG - Intronic
1068979217 10:63043937-63043959 AAAAAACTGTCGGCCGGGCGCGG + Intergenic
1069398879 10:68020474-68020496 AAAAAAGTTTGGGCCGGGCGCGG + Intronic
1069682325 10:70294095-70294117 ACTGTAGTGTCAGCCGGGCGCGG - Intergenic
1069976482 10:72217182-72217204 ATGAAAGTGTAGGCCGGGCGCGG + Intronic
1070112470 10:73498562-73498584 ACTGTACTGTGGGCCGGGCGCGG - Exonic
1070193514 10:74133941-74133963 ACTGAAGTCCTGGCCGGGCGCGG - Intronic
1070199016 10:74185540-74185562 GCAGAGTCGTCGGCCGGGCGCGG + Intronic
1070587461 10:77777338-77777360 ACTGAAGCTTGGGCCGGGCGCGG - Intergenic
1070617320 10:77978950-77978972 AAACAAGCGTGGGCCGGGCGCGG - Intronic
1071034129 10:81222900-81222922 ATAGCATTGCCGGCCGGGCGTGG + Intergenic
1071839924 10:89459648-89459670 AAAGAAATGTAGGCCGGGCATGG + Intronic
1072045985 10:91655701-91655723 AAAAAATTGTTGGCCGGGCGTGG - Intergenic
1072077784 10:91995384-91995406 AAAGAAAAGTAGGCCGGGCGTGG + Intronic
1072467494 10:95679878-95679900 TTAGAAATGACGGCCGGGCGCGG - Intronic
1072538951 10:96383919-96383941 AAAGAGGTTTAGGCCGGGCGTGG - Intronic
1072903375 10:99429336-99429358 AAAAAAAAGTCGGCCGGGCGCGG - Intronic
1072946611 10:99816254-99816276 ACAGAGATGGAGGCCGGGCGCGG - Intronic
1073007383 10:100335063-100335085 AAAGCAGTGTCAGCCGGGCGTGG + Intergenic
1073059908 10:100727420-100727442 ATAGAATTGTTGGCCGGGCGTGG - Intergenic
1073091515 10:100944203-100944225 AAAAAAGTCTCGGCCGGGCGCGG + Intronic
1073151648 10:101315745-101315767 ACACCAGTGTCGGCTGGGCACGG + Intergenic
1073253617 10:102137046-102137068 AAATAAGTGTCGGCCGGGCGTGG + Intronic
1073410462 10:103337772-103337794 ACAAAATTAGCGGCCGGGCGCGG + Intronic
1073526670 10:104189492-104189514 ACAGAAGTGTGGGTAGGGAGAGG - Intronic
1073534383 10:104262418-104262440 AAAGTTGTGTTGGCCGGGCGTGG + Intronic
1074140056 10:110664454-110664476 TCAGTAGTTTCGGCCGGGCTTGG + Intronic
1074569892 10:114614761-114614783 ACACAAGTGTGGGCTGGGCGTGG + Intronic
1074739153 10:116467833-116467855 AAAGTAATGTCGGCCGGGCGCGG + Intronic
1074792505 10:116904909-116904931 ATAGCAGTGTTGGCCGGGCGCGG + Intronic
1074907188 10:117875083-117875105 ACAAAAGATTCGGCCGGGCGCGG - Intergenic
1075055405 10:119214809-119214831 AAAACAGTGTTGGCCGGGCGTGG - Intronic
1075292520 10:121242566-121242588 ACAGAAGCTGGGGCCGGGCGTGG - Intergenic
1075645212 10:124092453-124092475 ACAGCAGTGGGGGCGGGGCGGGG + Intronic
1076507683 10:130988496-130988518 TGAAAAGTGTGGGCCGGGCGCGG + Intergenic
1076972476 11:144454-144476 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
1076985783 11:235164-235186 CCTGAAGAGTTGGCCGGGCGCGG - Intronic
1077072417 11:681698-681720 AAAAAAAAGTCGGCCGGGCGTGG - Intronic
1077314163 11:1909320-1909342 ACAGAAGTTGGGGCCGGGCGCGG + Intergenic
1077642593 11:3895037-3895059 AGAACAGGGTCGGCCGGGCGCGG - Intronic
1077885253 11:6382648-6382670 AAAGGAATGTCGGCAGGGCGTGG - Intergenic
1078162402 11:8853071-8853093 AAAGAAGCTTCGGCCAGGCGCGG + Intronic
1078236656 11:9491344-9491366 AGACAGGTGTCGGCTGGGCGCGG + Intronic
1078330495 11:10415254-10415276 AAGAATGTGTCGGCCGGGCGTGG - Intronic
1078470881 11:11585644-11585666 AAAGATTTTTCGGCCGGGCGCGG - Intronic
1079202572 11:18388140-18388162 AAACAAGTGTTGGCCGGGCGCGG + Intergenic
1079914330 11:26349836-26349858 AAACAATTCTCGGCCGGGCGTGG - Intronic
1079986147 11:27202723-27202745 TCAAAAGGGTGGGCCGGGCGTGG + Intergenic
1080008428 11:27433519-27433541 ATAGAAGAGTGGGCCGGGCATGG - Intronic
1080323907 11:31048561-31048583 AAAGGACTGTCGGCTGGGCGCGG + Intronic
1080503855 11:32893418-32893440 CCAGAGGTCTGGGCCGGGCGGGG + Intronic
1080522896 11:33083075-33083097 ACAGAGATGTAGGCTGGGCGCGG - Intronic
1081117136 11:39217390-39217412 AAAACAATGTCGGCCGGGCGCGG - Intergenic
1081387639 11:42491266-42491288 ACAGAAGATGAGGCCGGGCGTGG + Intergenic
1081556301 11:44165166-44165188 TTAAAAGTGTGGGCCGGGCGCGG - Intronic
1081831170 11:46116671-46116693 ACAAAAATTTAGGCCGGGCGTGG + Intronic
1082029025 11:47591676-47591698 AAAGGGGTTTCGGCCGGGCGCGG - Intronic
1082032096 11:47612275-47612297 CCAGATGTGTGGGCCGGGCGCGG + Intergenic
1082209472 11:49480665-49480687 ACAAAAAAATCGGCCGGGCGCGG - Intergenic
1082677013 11:56117668-56117690 AAATAATTGCCGGCCGGGCGTGG - Intergenic
1082690180 11:56292638-56292660 AGAAAAGAATCGGCCGGGCGCGG + Intergenic
1082985365 11:59165076-59165098 ACATAAGGATCGGCCGGGCGCGG + Intergenic
1083176793 11:60955205-60955227 TCAGAAGTATTGGCCGGGCACGG + Intergenic
1083249485 11:61456392-61456414 AAAGAAGAGTCAGCCGAGCGCGG - Intronic
1083467764 11:62860209-62860231 AGAGCAGTATTGGCCGGGCGCGG + Intronic
1083552555 11:63600892-63600914 GTAGAAGAGTAGGCCGGGCGTGG - Intronic
1083676285 11:64327063-64327085 AAAGAAGTGAAGGCCAGGCGTGG + Intergenic
1083800868 11:65045603-65045625 ACAGCAGTGGCGGTCGGGGGAGG + Intronic
1083835602 11:65264938-65264960 TCAAAAGGGTCGGCCGGGTGCGG + Intronic
1083905763 11:65669123-65669145 ACAGACATATAGGCCGGGCGTGG + Intergenic
1084002108 11:66301675-66301697 AAAGAAGAGACAGCCGGGCGGGG - Intergenic
1084027839 11:66463804-66463826 AATAAAGTTTCGGCCGGGCGTGG + Intronic
1084107780 11:66991381-66991403 AAAAGAGAGTCGGCCGGGCGCGG - Intergenic
1084363808 11:68685040-68685062 ACATCAGAGCCGGCCGGGCGTGG + Intronic
1084382425 11:68821441-68821463 ACAAAAATGTAGGCCGGGCGCGG - Intronic
1084523507 11:69681305-69681327 ATAGAAATGTTGGCCGGGCACGG + Intergenic
1084597395 11:70125050-70125072 AGAGAAGTGGGGACCGGGCGCGG + Intronic
1084643290 11:70438741-70438763 ACAGTGGTGGGGGCCGGGCGCGG - Intergenic
1084668551 11:70591724-70591746 GCAGAGATGTGGGCCGGGCGCGG + Intronic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1084853849 11:71967159-71967181 ACACAAATATTGGCCGGGCGCGG - Intronic
1084923964 11:72496754-72496776 AAATAAGTCTTGGCCGGGCGCGG + Intergenic
1084946753 11:72642669-72642691 AGAGAAGTGGCGACGGGGCGAGG - Intronic
1085214945 11:74821366-74821388 ATACAAGTGCGGGCCGGGCGCGG + Intronic
1085289772 11:75389546-75389568 AAAGCAATGACGGCCGGGCGCGG + Intergenic
1085338404 11:75715275-75715297 ACATTAGTGTAGGCCGGGCGCGG + Intergenic
1085487221 11:76875404-76875426 AATGAAATGTTGGCCGGGCGCGG - Intronic
1085960297 11:81454204-81454226 CTAGCAGTGTTGGCCGGGCGCGG + Intergenic
1086281626 11:85195814-85195836 AAAACACTGTCGGCCGGGCGCGG - Intronic
1086354689 11:85982715-85982737 AAAAAGGTCTCGGCCGGGCGCGG - Intronic
1087409626 11:97775218-97775240 ACAAAAGAATTGGCCGGGCGCGG - Intergenic
1087420241 11:97913950-97913972 AAAGAAATATCGGCCGGGCGCGG - Intergenic
1087500992 11:98953347-98953369 ACATGACTGTTGGCCGGGCGTGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1088307108 11:108422216-108422238 GAATAAGTGTCGGCCAGGCGCGG - Intronic
1088343609 11:108797320-108797342 ACAAAAGTTTAGGCTGGGCGCGG - Intronic
1088625671 11:111728636-111728658 AGAGCAGTATCAGCCGGGCGCGG + Exonic
1088714389 11:112536046-112536068 ACAGAAATGTAGGCAGGGCACGG - Intergenic
1088868564 11:113872329-113872351 ACAGAAACATCAGCCGGGCGTGG + Intronic
1088912853 11:114205117-114205139 AAAAAAATTTCGGCCGGGCGCGG + Intronic
1089366185 11:117922516-117922538 TAAGAAGTCTCGGCTGGGCGCGG - Intronic
1089786567 11:120911525-120911547 AGAGAATTTTGGGCCGGGCGCGG - Intronic
1089851653 11:121502424-121502446 ATAGAATTGTCGGCCGGGCATGG - Intronic
1090328231 11:125907316-125907338 GTTGAAGTGTTGGCCGGGCGCGG + Intronic
1090501691 11:127267073-127267095 ACACAAATGTCGGCTGGGCATGG - Intergenic
1091350166 11:134887482-134887504 ACTGAAATGACGGCCAGGCGCGG - Intergenic
1091460248 12:638703-638725 AACTAAGTGTCGGCCGGGCGCGG - Intronic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1091947533 12:4561864-4561886 ACAGAAGTTCTGGCCGGGCGCGG - Intergenic
1092168530 12:6358566-6358588 GCAAAAATGTGGGCCGGGCGTGG + Intronic
1092524756 12:9302801-9302823 TAAGAAGGGTCGGCCGGGTGTGG + Intergenic
1092570967 12:9720629-9720651 ACAGAGGTGGCGGCTGGGCGCGG - Intronic
1092780000 12:11977650-11977672 CCAGCAGTGTAGGCCGAGCGCGG + Intergenic
1093294996 12:17379001-17379023 AAAGAGGTCCCGGCCGGGCGCGG + Intergenic
1093439651 12:19179364-19179386 AATGAAGTGTTGGCCGGGCGTGG + Intronic
1093716773 12:22391789-22391811 AATGAAGTCTGGGCCGGGCGCGG + Intronic
1094130432 12:27068930-27068952 ACCGAAGTCTCGGCCGGGCGCGG - Intergenic
1094224592 12:28030848-28030870 AGAGAAGTGTTGGCCAGGCGCGG + Intergenic
1094377211 12:29802516-29802538 ACTTATGTGTTGGCCGGGCGCGG - Intergenic
1094410036 12:30158097-30158119 AAAGCAGTGTGGGCCGGGCGCGG - Intergenic
1094510503 12:31093423-31093445 TAAGAAGGGTCGGCCGGGTGCGG + Intronic
1095304561 12:40624545-40624567 AAAAAAATGTCGGCCGGGCGCGG + Intergenic
1095353672 12:41244978-41245000 ACAGTGGTGTGGGCCGGGCGCGG - Intronic
1095867228 12:46985196-46985218 AAAGAAATTTCGGCCGGGCGCGG + Intergenic
1096014412 12:48255833-48255855 TCAAAAGTTTAGGCCGGGCGCGG - Intergenic
1096150305 12:49305711-49305733 AGAGAAGGCTGGGCCGGGCGCGG - Intergenic
1096230606 12:49894811-49894833 ACAGTAGTGTCTGCCTGGCAGGG + Intronic
1096448762 12:51719784-51719806 AAAGAATTCTTGGCCGGGCGCGG + Intronic
1096461822 12:51825904-51825926 ATAAGAGTGTCGGCCGGGCGCGG - Intergenic
1096517172 12:52163362-52163384 AATGAAGAGTAGGCCGGGCGCGG + Intergenic
1096631613 12:52930509-52930531 ACAGAATTGGGGGCCGGGCGTGG - Intronic
1096662145 12:53132542-53132564 AAAGAAGTCATGGCCGGGCGCGG - Intergenic
1096782103 12:53997485-53997507 ACAGAAGTGGCCGCCGCGCCCGG + Intronic
1096905906 12:54935163-54935185 TAAGAAATGTGGGCCGGGCGTGG - Intergenic
1097019954 12:56013484-56013506 ACATAACTGTCGGCTGGGGGCGG - Intronic
1097099325 12:56575602-56575624 ACAGTAGTCTCGGCCAGGCATGG + Intronic
1097214068 12:57396147-57396169 AGAGTAGTCTAGGCCGGGCGCGG + Intronic
1097229863 12:57503828-57503850 AAACAAGTGTGGGCCGGGCGCGG - Intronic
1097543099 12:60964727-60964749 TAAGACGTTTCGGCCGGGCGCGG + Intergenic
1097634480 12:62106040-62106062 AGAAAAGTATAGGCCGGGCGCGG + Intronic
1098340415 12:69445064-69445086 AAGGAACTGTGGGCCGGGCGCGG - Intergenic
1098468924 12:70821952-70821974 ACATAGGTTTCGGCCGGGCGTGG - Intronic
1098728122 12:73995865-73995887 ATAAAAGAATCGGCCGGGCGCGG + Intergenic
1098751464 12:74297807-74297829 AAAGAGGAGTAGGCCGGGCGCGG - Intergenic
1099027529 12:77484259-77484281 TCAGAAGTGTTAGCAGGGCGTGG + Intergenic
1099832034 12:87856433-87856455 ATATCATTGTCGGCCGGGCGCGG - Intergenic
1100225203 12:92549494-92549516 AGAAAACTGTGGGCCGGGCGCGG - Intergenic
1100399034 12:94211982-94212004 ATAGAAAAGACGGCCGGGCGCGG + Intronic
1100928732 12:99581598-99581620 AATGAAAAGTCGGCCGGGCGCGG + Intronic
1100940432 12:99718188-99718210 AGAGTATTGTCGGCTGGGCGCGG - Intronic
1101357335 12:103992780-103992802 AGAGAACTTTCGGCCGGGCGTGG - Intronic
1101477001 12:105060532-105060554 AAAGATGTGTTGGCCGAGCGTGG + Intronic
1101868448 12:108541826-108541848 AAAAAAGTCTGGGCCGGGCGGGG - Intronic
1102125456 12:110476815-110476837 ATATCAATGTCGGCCGGGCGCGG - Intronic
1102242951 12:111336736-111336758 ACTGAAGTGTGGGCTGGGCACGG - Intronic
1102321776 12:111942226-111942248 AATGAAGTGTTAGCCGGGCGTGG - Intronic
1102343221 12:112140128-112140150 ACTGAATTGGAGGCCGGGCGTGG + Intronic
1102654008 12:114464730-114464752 AAAAGAGAGTCGGCCGGGCGCGG - Intergenic
1102701099 12:114840119-114840141 AGAGAACTGTAGGCCGGGCATGG - Intergenic
1103124467 12:118409433-118409455 ACAGAATTTTAGGCCGGGCGTGG - Intronic
1103138730 12:118530276-118530298 AACGATGTGTCAGCCGGGCGCGG + Intergenic
1103300488 12:119922621-119922643 ACACAACTTTCGGCCGGGTGAGG + Intergenic
1103307710 12:119979052-119979074 ATATAAGTGTAGGCCAGGCGCGG + Intergenic
1103319640 12:120084290-120084312 ATAAAAGTGTTGGCCGGGTGTGG - Intronic
1103320426 12:120089670-120089692 ACAGAAGTTGAGGCCGGGTGTGG - Intronic
1103533371 12:121617997-121618019 AAAAAAGTCTCGGCCGGGCATGG - Intergenic
1103549796 12:121728608-121728630 AAGTGAGTGTCGGCCGGGCGCGG - Intronic
1103582293 12:121924403-121924425 ACACAAGTCTAGGCCGGGCGTGG - Intronic
1103582346 12:121924718-121924740 ACACAAGTCTAGGCCGGGCGTGG - Intronic
1103659454 12:122501948-122501970 AAAGAAATGTGGGCCGGGGGCGG + Intergenic
1103671472 12:122619700-122619722 AAACAAGTGTTGGCCGGGCGCGG - Intronic
1103688485 12:122751869-122751891 AAAAAATTGTAGGCCGGGCGCGG + Intergenic
1103756694 12:123213147-123213169 ACAGAATGGTCAGCCAGGCGCGG - Intronic
1103789784 12:123461414-123461436 AAAGAAGAGGCAGCCGGGCGCGG - Intronic
1103946115 12:124527571-124527593 ACAGAAGAATTAGCCGGGCGTGG - Intronic
1104408573 12:128539324-128539346 ACACATGTGTGGGCTGGGCGTGG + Intronic
1104430384 12:128711242-128711264 ACACAACTGCGGGCCGGGCGCGG + Intergenic
1104560790 12:129842236-129842258 ACAGGAGTGCTGGCCGGGCGCGG - Intronic
1104686929 12:130792347-130792369 AAGAAAGTGTCGGCCGGGCCTGG - Intronic
1105026880 12:132854949-132854971 ACAAAATTAGCGGCCGGGCGCGG + Intronic
1105238101 13:18580141-18580163 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1105253822 13:18726326-18726348 AAAGAACTTCCGGCCGGGCGCGG - Intergenic
1105494234 13:20916485-20916507 AAAAAAGTCTTGGCCGGGCGCGG + Intergenic
1105571024 13:21603260-21603282 AGACAAGAGTCCGCCGGGCGCGG - Intronic
1105728870 13:23191893-23191915 AGGGAAGTGTCGGCCGGGCGCGG + Intronic
1105747036 13:23387167-23387189 AAACGAATGTCGGCCGGGCGCGG + Intronic
1106195733 13:27492413-27492435 ACAGAAATTTAGGCCAGGCGTGG - Intergenic
1106266157 13:28112113-28112135 AAAACAGTGTAGGCCGGGCGTGG + Intergenic
1106749571 13:32747460-32747482 ACAGCTATTTCGGCCGGGCGTGG + Intronic
1106844703 13:33725961-33725983 ACAAAAGTTTAGGCCGGGCAAGG + Intergenic
1107053134 13:36074210-36074232 ACAGAGAAGACGGCCGGGCGTGG + Intronic
1107278860 13:38709851-38709873 ACATCAGTGATGGCCGGGCGCGG + Intronic
1107530761 13:41280223-41280245 AAAGGATTGTGGGCCGGGCGCGG - Intergenic
1107682220 13:42864114-42864136 ACTGCAGTATCAGCCGGGCGCGG + Intergenic
1107721056 13:43248173-43248195 ATATAAGTTGCGGCCGGGCGCGG - Intronic
1108380081 13:49846882-49846904 AAAGAATTGCCGGCCGGGCGCGG + Intergenic
1108621033 13:52183916-52183938 ATATAAATGTCGGCCGGGTGCGG - Intergenic
1108698173 13:52921034-52921056 ACAGTAGTGTGGGCCGGGCACGG - Intergenic
1108760656 13:53559819-53559841 AGAGTACTGTAGGCCGGGCGCGG + Intergenic
1108920314 13:55664887-55664909 ACAGTAGTGAGGGCCGGGCACGG - Intergenic
1109123275 13:58485347-58485369 AAAGAACTCTGGGCCGGGCGCGG - Intergenic
1109314629 13:60735586-60735608 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1109397918 13:61785019-61785041 AAACAGGTGTTGGCCGGGCGCGG + Intergenic
1109398204 13:61789009-61789031 ATAAAAATATCGGCCGGGCGCGG + Intergenic
1109578767 13:64298234-64298256 ATAAAAATGTAGGCCGGGCGCGG + Intergenic
1110429759 13:75410644-75410666 ACCGAAGGGGAGGCCGGGCGCGG + Intronic
1111008746 13:82284211-82284233 ACAGAAATGTCGGCTGGGCACGG - Intergenic
1111125108 13:83905196-83905218 AGATTAGTGACGGCCGGGCGCGG - Intergenic
1112201255 13:97277963-97277985 AAAGCAGTGTAGGCCGGGCATGG + Intronic
1112280938 13:98062404-98062426 AAATAAGTATAGGCCGGGCGCGG + Intergenic
1112403036 13:99092683-99092705 AAAGAAAACTCGGCCGGGCGCGG + Intergenic
1112415730 13:99201779-99201801 AAAGATCTGTTGGCCGGGCGCGG + Intronic
1112682503 13:101783179-101783201 TTAAAAGTGTTGGCCGGGCGCGG + Intronic
1113329186 13:109311815-109311837 CCAGACGGGGCGGCCGGGCGGGG - Intergenic
1113343532 13:109450322-109450344 ATAGAAGTTTTGGTCGGGCGTGG - Intergenic
1113946590 13:114048023-114048045 ACGGAGGTCTCGGCCGGGCGCGG + Intronic
1113979700 13:114264255-114264277 ACAGAAGGCTCAGCTGGGCGCGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114294933 14:21320579-21320601 AAAAAAGAGTGGGCCGGGCGCGG - Intronic
1114777220 14:25497825-25497847 ACAGAAAGATTGGCCGGGCGTGG + Intergenic
1114899137 14:27034092-27034114 GTAGAAGAGTCGGCCGGGCGCGG - Intergenic
1115144036 14:30206127-30206149 AAAGCAGTCTAGGCCGGGCGTGG + Intergenic
1115216841 14:31022087-31022109 AAATCACTGTCGGCCGGGCGCGG + Intronic
1115230277 14:31153100-31153122 AGAGATGGGTCGGCCAGGCGTGG + Intronic
1115491352 14:33961138-33961160 AAAGTAATGGCGGCCGGGCGCGG + Intronic
1115556683 14:34549810-34549832 ACGGAACTGTCGGCCGGGCGCGG + Intergenic
1115632005 14:35254680-35254702 ACAGGAGAGTGGGCTGGGCGCGG - Intronic
1115679470 14:35720040-35720062 TAAGAATTGTTGGCCGGGCGCGG - Intronic
1115696125 14:35900526-35900548 ATAGTTTTGTCGGCCGGGCGTGG - Intronic
1115988994 14:39132238-39132260 AAAGAAGTCTGAGCCGGGCGTGG + Intronic
1115995792 14:39194441-39194463 ATAGAAAACTCGGCCGGGCGCGG + Intergenic
1116076257 14:40114676-40114698 AGAGAAGTCTTGGCTGGGCGCGG - Intergenic
1116248236 14:42445792-42445814 ACACCACTGTGGGCCGGGCGTGG - Intergenic
1116563187 14:46410211-46410233 ATAGAAATTTCGGCCAGGCGTGG + Intergenic
1116852183 14:49919461-49919483 ACACAAATATGGGCCGGGCGCGG + Intergenic
1116874079 14:50094091-50094113 ATGGAAGTGCCGGCTGGGCGTGG - Intergenic
1117143560 14:52813575-52813597 AAACATGTGTCGGCTGGGCGCGG - Intergenic
1117212069 14:53511093-53511115 AGAAAAGTGATGGCCGGGCGTGG + Intergenic
1117321141 14:54624261-54624283 AAATAAGAGTGGGCCGGGCGCGG - Intronic
1117771795 14:59141006-59141028 AAAGAAATGTAGGCCGAGCGCGG + Intergenic
1117774040 14:59164261-59164283 ACAGAGATGTAGGCTGGGCGCGG - Intergenic
1118351905 14:64978147-64978169 AGAACAATGTCGGCCGGGCGCGG - Intronic
1118636296 14:67751534-67751556 AAAGAAGAGTCAGCCGGGTGTGG - Intronic
1118673383 14:68155480-68155502 AAAGAAATATAGGCCGGGCGCGG - Intronic
1118747971 14:68787343-68787365 ACACAAGTGTCGGCAAGGCTGGG + Intergenic
1118758407 14:68862358-68862380 AAAGATATGTGGGCCGGGCGTGG - Intergenic
1118867575 14:69715550-69715572 AAAGAAGTCTTGGCCAGGCGCGG + Intergenic
1119240058 14:73051864-73051886 AAAAAAATGTTGGCCGGGCGCGG - Intergenic
1119314359 14:73679282-73679304 ACAAAAGTCTTGGCCGGGCACGG - Intronic
1119367048 14:74101748-74101770 AAAGAAAAATCGGCCGGGCGCGG - Intronic
1119396624 14:74330907-74330929 ACACAAGTCTGGGCCGGGCACGG + Intronic
1119491738 14:75040157-75040179 TCAAAAGAATCGGCCGGGCGTGG + Intronic
1119620529 14:76128492-76128514 ACAGAAAAGTTGGCCGGGCACGG + Intergenic
1119656735 14:76422499-76422521 AAGGAAATGTCGGCCGGGTGTGG - Intronic
1120065377 14:80034377-80034399 AAAAAACTGTGGGCCGGGCGCGG + Intergenic
1120284069 14:82475213-82475235 ACAGTGGTCTCGGCCAGGCGTGG + Intergenic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1120653255 14:87159944-87159966 AAAGAAATGTGGGCCGGGCGCGG - Intergenic
1120872184 14:89347661-89347683 ACAGAGGCATGGGCCGGGCGCGG + Intronic
1120998755 14:90436442-90436464 AAAAAAGTCTGGGCCGGGCGCGG + Intergenic
1121053336 14:90833713-90833735 ACAGCTGCATCGGCCGGGCGCGG + Intergenic
1121056684 14:90861230-90861252 AAAATAATGTCGGCCGGGCGCGG + Exonic
1121073732 14:91049322-91049344 AGAGACAAGTCGGCCGGGCGCGG + Intronic
1121258009 14:92545398-92545420 ACAGAAAGTTAGGCCGGGCGCGG - Intronic
1121276805 14:92673794-92673816 GAAGATGTGGCGGCCGGGCGCGG - Intronic
1121639874 14:95478138-95478160 ACCGAACTGTGGGCTGGGCGAGG + Intergenic
1121651215 14:95560322-95560344 ACAGAAATTTTGGCCGGGTGTGG + Intergenic
1122177578 14:99932345-99932367 ACAGATATGGGGGCCGGGCGCGG + Intronic
1122530907 14:102426174-102426196 AACCAAGTGGCGGCCGGGCGCGG - Intronic
1122618420 14:103037738-103037760 AAAGAATTTTAGGCCGGGCGTGG + Intronic
1122669549 14:103359757-103359779 AGAAAAGTGTTGGCCGGGCGCGG - Intergenic
1123107968 14:105851840-105851862 ACACAACTGGAGGCCGGGCGGGG + Intergenic
1123191506 14:106576350-106576372 ACAGAAGTTTGGGCAGGGGGTGG + Intergenic
1124131857 15:26996940-26996962 ACACCAGTATAGGCCGGGCGTGG - Intronic
1124418416 15:29493421-29493443 AAAGAGTTGTCGGCCGGGCGCGG - Intronic
1124448358 15:29760665-29760687 ACACTAGTGTTGGCCGGGCGCGG - Intronic
1124464900 15:29928651-29928673 ACACACTTGTCGGCCGGGCACGG + Intronic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1124611171 15:31209972-31209994 GCTGATGGGTCGGCCGGGCGCGG + Intergenic
1124839956 15:33232521-33232543 AAAGCAGTGGCGGCCAGGCGTGG + Intergenic
1125020069 15:34975748-34975770 TCAGAAATGTGGGCCGGGCATGG + Intergenic
1125027212 15:35042709-35042731 ACTGAAGGATAGGCCGGGCGTGG + Intergenic
1125149927 15:36519937-36519959 AACCAAATGTCGGCCGGGCGCGG - Intergenic
1125532475 15:40422571-40422593 AAAAAAAAGTCGGCCGGGCGCGG - Intronic
1125540828 15:40469074-40469096 GCAGAAGTGGAGGCGGGGCGGGG - Intergenic
1125543674 15:40487432-40487454 AAAAAATTGTTGGCCGGGCGCGG + Intergenic
1125646284 15:41275443-41275465 TCAGAAGTTTTGGCCGGGGGTGG - Intronic
1125792992 15:42383861-42383883 AGGGCAGTGTCGGCTGGGCGTGG - Intronic
1125822249 15:42641892-42641914 TAAGAAATGTCAGCCGGGCGCGG - Intronic
1125854750 15:42938151-42938173 TTAGAAGTTTGGGCCGGGCGCGG - Intergenic
1125905508 15:43388139-43388161 ATAGAAGTACCTGCCGGGCGTGG - Intronic
1126150024 15:45515362-45515384 AAAGAAATTTCGGCCGGGCGTGG + Intronic
1126598769 15:50407816-50407838 TCAGAGGGATCGGCCGGGCGCGG + Intergenic
1127107308 15:55630274-55630296 ACAAAAGAATTGGCCGGGCGTGG - Intronic
1127199274 15:56625843-56625865 AAGGAAGTGGAGGCCGGGCGTGG + Intergenic
1127588791 15:60402086-60402108 AAAGAAGTTTTTGCCGGGCGTGG + Intronic
1127857589 15:62965395-62965417 AGAAAAATGTAGGCCGGGCGCGG - Intergenic
1128022274 15:64402508-64402530 AAAAAAATGTTGGCCGGGCGCGG - Intronic
1128048540 15:64641502-64641524 GCACAAGTGTAGGCCAGGCGCGG - Intronic
1128222066 15:65976329-65976351 ATAGGAATGTTGGCCGGGCGTGG - Intronic
1128367601 15:67015450-67015472 TAAGAAGTGGAGGCCGGGCGCGG - Intergenic
1128424442 15:67525722-67525744 ACAGTAATGTTGGCCGGGCGCGG + Intronic
1128871394 15:71158441-71158463 AAACAAGTGTTGGCCAGGCGCGG - Intronic
1128906930 15:71475630-71475652 AAAGAAATGGCGGCCAGGCGTGG + Intronic
1128980623 15:72183225-72183247 AAAGAACTCTTGGCCGGGCGCGG + Intronic
1128993483 15:72279743-72279765 GCAGAAAAGGCGGCCGGGCGAGG - Intronic
1129041147 15:72687272-72687294 AAAAATGTTTCGGCCGGGCGTGG - Intronic
1129131868 15:73505820-73505842 GGAGAAGTGCAGGCCGGGCGCGG - Intronic
1129321248 15:74776291-74776313 GAAGCAGTGTCGGCCGGACGCGG + Intergenic
1129346639 15:74925030-74925052 AAGAAAGTGCCGGCCGGGCGTGG + Intronic
1129993640 15:79986159-79986181 ACAGAATTTCTGGCCGGGCGTGG - Intergenic
1130323540 15:82859955-82859977 AACAAAATGTCGGCCGGGCGCGG + Intronic
1130539585 15:84812546-84812568 AGAGAAATTTCTGCCGGGCGCGG + Intergenic
1130644406 15:85711169-85711191 AAAGAAGTTTAGGCCGGGCATGG - Intronic
1130667026 15:85878610-85878632 TCACAAGTCCCGGCCGGGCGCGG + Intergenic
1130881090 15:88056878-88056900 AGAAATGTGTCGGCCGGGCGCGG + Intronic
1131289118 15:91089695-91089717 ATAGAAGTCTCAGCCGGGCACGG - Intergenic
1131518715 15:93097458-93097480 AAAAAAGTGGGGGCCGGGCGAGG - Intergenic
1131624328 15:94101601-94101623 ACTTACTTGTCGGCCGGGCGCGG + Intergenic
1131870627 15:96760225-96760247 AAAGAAGAGTCGTCCGGGCGTGG + Intergenic
1132152626 15:99473464-99473486 GGAGAAGAGTTGGCCGGGCGCGG - Intergenic
1132319164 15:100912866-100912888 ATACAGATGTCGGCCGGGCGCGG + Intronic
1132475657 16:136397-136419 ACACAAGTGCAGGCTGGGCGCGG + Intronic
1132507882 16:321388-321410 ACAGAAGTCTTGGCGGGGTGGGG - Intronic
1132542358 16:516584-516606 ACAGAAAAGAGGGCCGGGCGCGG + Intronic
1132867573 16:2101272-2101294 TAAAAACTGTCGGCCGGGCGCGG - Intronic
1133173520 16:3997153-3997175 ACAGGAGGGTTGGCCGGGCACGG - Intronic
1133664226 16:7950079-7950101 ATAGAATTGTTGGCCGGGAGTGG + Intergenic
1133793181 16:9025328-9025350 AAAGAATTATTGGCCGGGCGCGG - Intergenic
1133914084 16:10093126-10093148 TCAGAAAGGTTGGCCGGGCGTGG - Intronic
1134063889 16:11214554-11214576 ACAGCACTTTGGGCCGGGCGCGG + Intergenic
1134222455 16:12365750-12365772 GCAGAACAGTGGGCCGGGCGCGG + Intronic
1134482929 16:14633941-14633963 AGACAATTCTCGGCCGGGCGCGG - Intronic
1134524207 16:14931841-14931863 TAAAAACTGTCGGCCGGGCGCGG + Intronic
1134543934 16:15093292-15093314 ACAAAAATCTAGGCCGGGCGCGG - Intronic
1134548698 16:15129093-15129115 TAAAAACTGTCGGCCGGGCGCGG - Intronic
1134560953 16:15209011-15209033 CAAAAAGGGTCGGCCGGGCGTGG - Intergenic
1134719648 16:16373621-16373643 TAAAAACTGTCGGCCGGGCGCGG + Intergenic
1134947778 16:18338264-18338286 TAAAAACTGTCGGCCGGGCGTGG - Intergenic
1135041942 16:19124179-19124201 AAAGACTTGTCGGCAGGGCGTGG + Intronic
1135126732 16:19816572-19816594 AAAGAAGTGTTGGCCAGGCGCGG - Intronic
1135361510 16:21819442-21819464 ACAAAAATCTAGGCCGGGCGCGG - Intergenic
1135411834 16:22241056-22241078 AGAGCAGTTTAGGCCGGGCGCGG - Intronic
1135717916 16:24788936-24788958 AAAGAATTTTGGGCCGGGCGTGG - Intronic
1135746318 16:25019834-25019856 ATGGAAGTGTGGGCCGGGCGTGG + Intergenic
1135747909 16:25032840-25032862 ACAGGGGTGTAGGCCGGGCGCGG + Intergenic
1135780274 16:25293919-25293941 AAAAAAGTGTTGGCCGGGCGCGG + Intergenic
1135953559 16:26937268-26937290 AAAGAGGTTTAGGCCGGGCGTGG - Intergenic
1136126814 16:28189234-28189256 AAGGAAGTGTCAGCTGGGCGCGG - Intronic
1136218428 16:28811429-28811451 ACAGCAGTGTTGGCCGGGCGAGG - Intergenic
1136337744 16:29621416-29621438 TGAGAAATGTCTGCCGGGCGGGG + Intergenic
1137438756 16:48480910-48480932 AGATAAATGTTGGCCGGGCGAGG - Intergenic
1137532461 16:49288020-49288042 ACAGAGGTGTCGGCAGGGTTGGG - Intergenic
1137809865 16:51342692-51342714 AGAGAAGAGGAGGCCGGGCGCGG - Intergenic
1137989023 16:53132962-53132984 ATAGAAGAAACGGCCGGGCGTGG - Intronic
1138138359 16:54544368-54544390 ACAGATTTTTAGGCCGGGCGCGG - Intergenic
1138311939 16:56032787-56032809 AAAGAACTCTTGGCCGGGCGTGG - Intergenic
1138423927 16:56917765-56917787 AAATAAGACTCGGCCGGGCGCGG + Intergenic
1138741522 16:59316234-59316256 ACAGAAACTTCAGCCGGGCGCGG - Intergenic
1138893020 16:61167996-61168018 AAAGTTATGTCGGCCGGGCGCGG + Intergenic
1139385284 16:66564758-66564780 AGAAAAAAGTCGGCCGGGCGCGG - Intronic
1139445211 16:66993809-66993831 ACAGAGGCGTAGGCCGGGCGCGG + Intronic
1139454152 16:67058429-67058451 AAAGAACTGTTGGTCGGGCGTGG - Intronic
1139467232 16:67160418-67160440 ACAAGATTGGCGGCCGGGCGCGG + Intronic
1139542341 16:67627656-67627678 ACACGAAGGTCGGCCGGGCGCGG + Intronic
1139722293 16:68866331-68866353 AAAATAATGTCGGCCGGGCGCGG + Intronic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140281006 16:73555442-73555464 ACAAACATGGCGGCCGGGCGCGG - Intergenic
1140295930 16:73709889-73709911 ACATAGGTTTTGGCCGGGCGTGG + Intergenic
1140309383 16:73834600-73834622 AAAGAAGTGTCAGCTGGGCGTGG + Intergenic
1140358733 16:74327402-74327424 ATAGAATTATCGGCCGGGCCTGG + Intergenic
1140399914 16:74663192-74663214 ACATGAGTATTGGCCGGGCGCGG - Intronic
1140402296 16:74681501-74681523 ACACAAGACACGGCCGGGCGCGG + Intronic
1140435148 16:74940992-74941014 ACAGCATTTTCGGCTGGGCGCGG - Intronic
1140561366 16:75986153-75986175 AGAGAAGATTAGGCCGGGCGTGG + Intergenic
1141093231 16:81144796-81144818 ATAGAGGTGTTGGCTGGGCGTGG - Intergenic
1141111230 16:81272406-81272428 AAAGCAGTCTGGGCCGGGCGCGG - Intronic
1141227778 16:82135490-82135512 AAAGAGGTGTTGGCTGGGCGTGG - Intergenic
1141455759 16:84140811-84140833 ACAGTATTGCTGGCCGGGCGCGG + Intronic
1141970234 16:87476834-87476856 ACTGAAGTGGTGGCCGGGCGCGG + Intronic
1142016091 16:87748476-87748498 ACAGAAGCCTGGGCCGGGTGTGG - Intronic
1142105970 16:88302937-88302959 ACAGATGTGTGGGAAGGGCGTGG + Intergenic
1142140175 16:88469237-88469259 TCTGAAGTGCCGGCCGGGCCAGG + Intronic
1142301493 16:89261156-89261178 AAAGAAAAGTCGGCCGGGTGCGG + Intergenic
1142447776 16:90153068-90153090 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1142459714 17:82256-82278 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
1142677389 17:1522359-1522381 AAAGATGTTTCGGCCAGGCGCGG - Intronic
1142772868 17:2112212-2112234 AAAAAAAAGTCGGCCGGGCGCGG + Intronic
1143216157 17:5226797-5226819 AAAAATGTGTCGGCCGGGCGTGG - Intronic
1143357781 17:6343410-6343432 ACAGAAGTCCAGGCCAGGCGTGG + Intergenic
1143568176 17:7737797-7737819 CCAGAGGTGTCGGCCTGGCCAGG + Intronic
1143626558 17:8113734-8113756 AAAGATGTGTGGGCTGGGCGTGG + Intronic
1144030465 17:11316708-11316730 AGAGAAGGATGGGCCGGGCGTGG - Intronic
1144251930 17:13426224-13426246 AAAGAATTCTGGGCCGGGCGTGG + Intergenic
1144566771 17:16365896-16365918 ACAGATGAGACGGCAGGGCGTGG - Intergenic
1144607616 17:16681565-16681587 ACAGGAGCGTTGGCCGGGCATGG + Intergenic
1144608585 17:16689482-16689504 AGAAAAGTGACGGCCAGGCGCGG - Intergenic
1144963267 17:19058955-19058977 ACAGAAATGTAGGCCGGGCATGG + Intergenic
1144964423 17:19067085-19067107 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144971892 17:19115570-19115592 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144983545 17:19185088-19185110 CCAGAAATGTAGGCCGGGCATGG + Intergenic
1144984680 17:19193151-19193173 CCAGAAATGTAGGCCGGGCATGG - Intergenic
1145026254 17:19469991-19470013 AAAAAAGGTTCGGCCGGGCGCGG - Intergenic
1145028976 17:19490182-19490204 AAAAAAATGTCGGCCGGGCGTGG + Intergenic
1145070460 17:19801281-19801303 AAAGAAGTTGGGGCCGGGCGCGG + Intronic
1145079456 17:19882678-19882700 AATCAAGTCTCGGCCGGGCGCGG + Intergenic
1145082573 17:19907307-19907329 CCAGAAATGGGGGCCGGGCGTGG - Intronic
1145098910 17:20057149-20057171 ACAGAAAGGTTGGCCGGGTGCGG + Intronic
1145128358 17:20320397-20320419 AGAAAAGTGACGGCCGGGCGCGG - Intergenic
1145196255 17:20896817-20896839 AGAAAAGTGACGGCTGGGCGCGG + Intergenic
1145197218 17:20904547-20904569 ACAGGAGCGTTGGCCGGGCACGG - Intergenic
1145222541 17:21101287-21101309 AAAAAAGTGTAGGCTGGGCGCGG - Intergenic
1145857453 17:28175153-28175175 AGTGTAGTGTCAGCCGGGCGCGG + Intronic
1145951778 17:28824165-28824187 AAAAAATTCTCGGCCGGGCGTGG - Intronic
1146509817 17:33437153-33437175 AAAGAAGTTGGGGCCGGGCGCGG - Intronic
1146777354 17:35633070-35633092 ACTGCAGAATCGGCCGGGCGCGG + Intronic
1146797666 17:35794534-35794556 ATAAAAGTGTAGGCCGGACGCGG - Intronic
1146899800 17:36576045-36576067 TAAGAAGTCTAGGCCGGGCGTGG + Intronic
1147276742 17:39324067-39324089 ACAGAAGTATAGGCCAGGCACGG - Intronic
1147433022 17:40385701-40385723 AGAGAACTATTGGCCGGGCGCGG + Intergenic
1147502069 17:40975060-40975082 AAAAAACTGTCGGCCAGGCGTGG - Intergenic
1147798925 17:43067985-43068007 CCTGAAGTCTCGGCTGGGCGCGG + Intronic
1148006921 17:44440070-44440092 AAAGAAGTTGAGGCCGGGCGAGG - Intronic
1148487280 17:47998662-47998684 AAAGAAGTGTGGGCCAGGCATGG - Intergenic
1148602735 17:48906804-48906826 AAAGAAGTCTGGGCCGGGCACGG - Intergenic
1148732601 17:49846565-49846587 ACATAAGTGACGGCCGGCTGTGG - Intronic
1148930424 17:51122678-51122700 AAAAAAGTATCAGCCGGGCGTGG + Intergenic
1149305859 17:55346015-55346037 AAACAAGTGTAGGCCGGGAGTGG + Intergenic
1149314763 17:55428586-55428608 ACAAGAGTATCGGCTGGGCGCGG + Intergenic
1149440795 17:56672010-56672032 TCAGAAGGGATGGCCGGGCGCGG - Intergenic
1149652221 17:58282568-58282590 AGACAAGAGTGGGCCGGGCGCGG - Intergenic
1149768261 17:59298438-59298460 AAGGGAGTATCGGCCGGGCGCGG - Intergenic
1149792735 17:59493512-59493534 ACAGATGCATGGGCCGGGCGCGG + Intergenic
1149879579 17:60275164-60275186 TGAGAAGTATTGGCCGGGCGCGG + Intronic
1149935788 17:60805535-60805557 AAGGAAGTGGCGGCTGGGCGCGG + Intronic
1150042650 17:61880334-61880356 AGTGCAGTGTAGGCCGGGCGTGG - Intronic
1150152792 17:62824216-62824238 AAAAAAGTGTTGGCCGGGCGTGG - Intergenic
1150800411 17:68277418-68277440 AAAAAAGTTGCGGCCGGGCGCGG - Intronic
1150959773 17:69900701-69900723 AAAGAACTTGCGGCCGGGCGTGG - Intergenic
1151267344 17:72966857-72966879 ACAGATGAAGCGGCCGGGCGTGG - Intronic
1151595089 17:75073565-75073587 AAAAAAGTGTCAGCCGGGTGAGG - Intergenic
1151699443 17:75735375-75735397 ATAAAACTGTCAGCCGGGCGTGG - Intronic
1151798646 17:76364043-76364065 ACAAAAGTACAGGCCGGGCGCGG - Intronic
1151962681 17:77415314-77415336 CAAGAAGTCTCGGCCAGGCGTGG + Intronic
1152107771 17:78341142-78341164 AAGGAAGTGGGGGCCGGGCGCGG + Intergenic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1152367407 17:79864498-79864520 CCACAGGTGTCGGCCGGGCATGG + Intergenic
1152672191 17:81615388-81615410 ACAGACGTCTCGGCTGGACGTGG - Intronic
1153199984 18:2638096-2638118 ACAGAAATTTAGCCCGGGCGTGG + Intergenic
1153643748 18:7176464-7176486 CGAGAAATGTGGGCCGGGCGCGG - Intergenic
1153958406 18:10118950-10118972 AAATAAGTAGCGGCCGGGCGTGG + Intergenic
1154005909 18:10526897-10526919 TCAGCATTGTGGGCCGGGCGCGG + Intronic
1154208286 18:12356440-12356462 AAAGAATTGACGGCTGGGCGCGG - Intronic
1155068249 18:22287538-22287560 AAACAAGTATTGGCCGGGCGCGG + Intergenic
1155211389 18:23605209-23605231 ACAGAATTCTGGGCCGGGCATGG - Intronic
1155275016 18:24178579-24178601 AAAGAATTGTTGGCCGGGCATGG - Intronic
1155463198 18:26106806-26106828 ACATAAGGATCGGCTGGGCGTGG - Intergenic
1155751518 18:29428824-29428846 AGAAAAGTGGCGGCTGGGCGCGG + Intergenic
1155754824 18:29478662-29478684 TAAGAAGTGTGAGCCGGGCGCGG - Intergenic
1155894483 18:31306935-31306957 ATGGAAGTACCGGCCGGGCGCGG - Intergenic
1155944889 18:31837050-31837072 ACTGAAGGATGGGCCGGGCGCGG - Intronic
1155953858 18:31940785-31940807 AAAAAATTTTCGGCCGGGCGCGG - Intronic
1156330271 18:36115149-36115171 ACTGAAGAGGGGGCCGGGCGTGG + Intronic
1156379104 18:36541286-36541308 AAAAAAGTGTTGGCAGGGCGTGG + Intronic
1156442047 18:37200519-37200541 AAGGAGCTGTCGGCCGGGCGCGG + Intronic
1156556968 18:38078650-38078672 AAAGAAGGCTGGGCCGGGCGCGG + Intergenic
1156980589 18:43283433-43283455 AAAGAACTCTTGGCCGGGCGCGG + Intergenic
1157107401 18:44787562-44787584 AGAAAATTGTTGGCCGGGCGCGG + Intronic
1157778887 18:50420203-50420225 AAAGCAGTTTGGGCCGGGCGAGG + Intergenic
1157825541 18:50808845-50808867 AAAGAACTGTCGGCCGGGCGCGG + Intronic
1157998203 18:52585791-52585813 CCAACACTGTCGGCCGGGCGCGG + Intronic
1158088637 18:53683768-53683790 AAAGAATTATCGGCTGGGCGCGG - Intergenic
1158182748 18:54735810-54735832 ACAAAAGTGTCAGCTGGGAGTGG - Intronic
1158263222 18:55632326-55632348 AAAGAACTGTTGGCCGGGCGCGG - Intronic
1158364614 18:56719271-56719293 ACAGAATTGCTGGCCGGGCGCGG + Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1158466975 18:57699444-57699466 ACAGGAGTCTCGGCCGGGCCCGG + Intronic
1158719134 18:59908340-59908362 ACACAAGTTCAGGCCGGGCGAGG - Intergenic
1158721110 18:59925540-59925562 ACAAAAAATTCGGCCGGGCGCGG + Intergenic
1158913275 18:62091057-62091079 ACAACAGTGTTGGCCAGGCGTGG + Intronic
1159308538 18:66677651-66677673 ACAGGAGAGTCGGCCGGGCGCGG - Intergenic
1159362090 18:67418509-67418531 AAAGTAGCGTGGGCCGGGCGCGG + Intergenic
1159447051 18:68554081-68554103 TAAAAAGTGTTGGCCGGGCGCGG + Intergenic
1159814445 18:73055190-73055212 ACAGAGTTTTCGGCCGGGCGCGG - Intergenic
1159862994 18:73671354-73671376 ATAAAAGTGAGGGCCGGGCGCGG + Intergenic
1160178478 18:76614587-76614609 ATGGAGGCGTCGGCCGGGCGCGG - Intergenic
1160275016 18:77423926-77423948 AAATAAATGTCGGCCGGGTGCGG + Intergenic
1160649430 19:214764-214786 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
1160734242 19:654674-654696 AAAAAAGTGCTGGCCGGGCGCGG + Intronic
1160919921 19:1514463-1514485 AGAGAAGGGCAGGCCGGGCGCGG + Intergenic
1160977291 19:1799473-1799495 AAAAAAAAGTCGGCCGGGCGTGG + Intronic
1161037713 19:2094878-2094900 AAAGCAGTGTGGGCCGGGCGCGG + Intronic
1161044121 19:2125710-2125732 ACAGAAATGTAGGCCGGGCGCGG + Intronic
1161051486 19:2166058-2166080 ATATAAATGTGGGCCGGGCGCGG - Intronic
1161159115 19:2751948-2751970 AAAAAAATGTAGGCCGGGCGCGG + Intergenic
1161352185 19:3799850-3799872 TAAGATGTGTCAGCCGGGCGCGG + Intronic
1161373880 19:3928953-3928975 ACAGAAAAGAAGGCCGGGCGCGG + Intergenic
1161414409 19:4137423-4137445 AGAAAAGTGAAGGCCGGGCGCGG - Intergenic
1161435317 19:4259367-4259389 AGAAAAGCGTCGTCCGGGCGCGG - Intronic
1161506422 19:4646276-4646298 AAAAAAAAGTCGGCCGGGCGTGG - Intronic
1161548889 19:4899637-4899659 AAAGAACTAGCGGCCGGGCGCGG + Intronic
1161549611 19:4904605-4904627 AGAGAAATGTCAGCCAGGCGTGG - Intronic
1161550015 19:4907558-4907580 ATAAATGTGTGGGCCGGGCGTGG - Intronic
1161601173 19:5184077-5184099 CAAGAAGTTTCGGCCGGGCGCGG + Intronic
1161676617 19:5654029-5654051 ACAGACATGTTGGCTGGGCGTGG - Intronic
1161731111 19:5961151-5961173 ACTGCAGTGTTGGCCGGGCGCGG + Intronic
1161734522 19:5982945-5982967 AGAAAAGTATCGGCCGGGCGCGG - Intergenic
1161752290 19:6107003-6107025 CCACAGGTGCCGGCCGGGCGCGG + Intronic
1161785502 19:6322818-6322840 ACAGGAGTTTCAGCCGGGCGTGG + Intronic
1161809958 19:6465908-6465930 GCAGGAGTCCCGGCCGGGCGCGG + Intronic
1161877399 19:6922323-6922345 TCAGAGGTGTTGGCCGGGTGTGG + Intronic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1162221803 19:9183665-9183687 AGACAAGAGTTGGCCGGGCGCGG + Intergenic
1162532980 19:11246552-11246574 ACTTCAGTGTCGGCGGGGCGCGG - Intronic
1162583271 19:11543488-11543510 ATAAAAGAGTGGGCCGGGCGCGG + Intronic
1162649254 19:12073444-12073466 ACAGTACTGTGGGCCGGGCGCGG - Intronic
1162665364 19:12205850-12205872 AAAGAAGTTTAGGCCGGGTGCGG - Intergenic
1163022697 19:14491817-14491839 AAATCAGTGTCGGCCGGGTGTGG + Intronic
1163060313 19:14755868-14755890 ACAGAAGGGCCTGCAGGGCGAGG + Exonic
1163065486 19:14789736-14789758 ACAGAAGTGCTGGCCGGGCACGG - Intergenic
1163216484 19:15881952-15881974 ACAGGAGTGGAGGTCGGGCGCGG + Intronic
1163497281 19:17654115-17654137 GGAGAAGTGATGGCCGGGCGTGG - Intronic
1163535713 19:17875077-17875099 ATAGTAATGGCGGCCGGGCGCGG + Intronic
1163606315 19:18277676-18277698 ACAGGGGTGTTGGCCGGGCACGG + Intergenic
1163626834 19:18395079-18395101 AAAAAAATGTCGGCTGGGCGCGG + Intronic
1163629572 19:18410982-18411004 ATACAAATTTCGGCCGGGCGCGG + Intergenic
1163729864 19:18942578-18942600 ACTCAAGTGTCGGCCAGGTGTGG - Intergenic
1164077724 19:21835643-21835665 ACAGGAGAGTCGGCCGGGCGCGG - Intronic
1164201019 19:23018654-23018676 AGAGAAGCATTGGCCGGGCGCGG + Intergenic
1164703639 19:30303781-30303803 AAAAAAGTGTCGGCTGGGCATGG - Intronic
1165048137 19:33122611-33122633 ACTAAAGAGCCGGCCGGGCGTGG - Intronic
1165325035 19:35109547-35109569 ACAACAGGGGCGGCCGGGCGTGG - Intergenic
1165341230 19:35213709-35213731 ACAAAATTCTTGGCCGGGCGCGG - Intergenic
1165682284 19:37788379-37788401 ACAAAATTTTTGGCCGGGCGCGG + Intronic
1165722223 19:38087726-38087748 ACAGCAGTGTTGGCCGGGCACGG + Intronic
1165960671 19:39531962-39531984 AAACAAGATTCGGCCGGGCGCGG + Exonic
1166712599 19:44946859-44946881 AAAGAACTGTAGGCTGGGCGTGG + Intronic
1167283006 19:48581745-48581767 AAAGAACTCTCGGCCGGGCACGG - Intronic
1167474722 19:49693166-49693188 GCAGGAGTTTGGGCCGGGCGCGG - Intronic
1167616568 19:50537663-50537685 AAAGAACAGTCGGCCGGGCGCGG - Intronic
1167686189 19:50958168-50958190 ACAAAAGTTTAGGCTGGGCGCGG + Intergenic
1167827286 19:51985714-51985736 TAAGAAGTGAAGGCCGGGCGCGG + Intronic
1167946877 19:52995271-52995293 AAAGATTTTTCGGCCGGGCGCGG + Intergenic
1168031789 19:53685909-53685931 ACAGAAAAGTTAGCCGGGCGTGG - Intergenic
1168071216 19:53953040-53953062 ATAAAATTCTCGGCCGGGCGCGG - Intergenic
1168143125 19:54402924-54402946 AAAGACTTGTTGGCCGGGCGCGG - Intergenic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1168209491 19:54879973-54879995 AAAGAAATGTCGGCCGGGCGCGG - Intronic
1168286108 19:55334617-55334639 ACAGAAAAGTAGGTCGGGCGCGG - Intergenic
1168533895 19:57152931-57152953 AAAGAAGTTATGGCCGGGCGCGG - Intergenic
1168554076 19:57323480-57323502 ACAGCAGTGTCGGTCAGGCGCGG - Intronic
1168598041 19:57694960-57694982 ACAGTAGTCTTGGCCAGGCGCGG + Intronic
1202677876 1_KI270711v1_random:24083-24105 TAAGAAGTCTCGGCCGGGCGCGG - Intergenic
925076037 2:1016529-1016551 ATAAAGTTGTCGGCCGGGCGTGG - Intronic
925227864 2:2201407-2201429 TCATAAGTGTTGGCCGGGTGCGG + Intronic
925327411 2:3034505-3034527 ACAGAAGGCTGGGCCAGGCGGGG - Intergenic
925469809 2:4147821-4147843 AATGAGGTCTCGGCCGGGCGCGG - Intergenic
925984173 2:9202170-9202192 AAATGAGTGTAGGCCGGGCGCGG + Intergenic
926186666 2:10696196-10696218 ATACAAGTGTAGGCCGGGTGCGG - Intergenic
926429605 2:12772597-12772619 ACAGAAGGATAGGCTGGGCGCGG + Intergenic
926477340 2:13340468-13340490 AAAGAAGTAGAGGCCGGGCGCGG - Intergenic
926635578 2:15175253-15175275 AAAGAAGTGTTGGCCGGGCACGG - Intronic
927204518 2:20598846-20598868 AAAGAAGTACCGGCCGGGCGCGG - Intronic
927478397 2:23431600-23431622 AAAGCAGTGAAGGCCGGGCGCGG + Intronic
927633697 2:24796063-24796085 TCCGGAGTGTTGGCCGGGCGCGG + Intronic
927665622 2:25030433-25030455 AAAGAATTGTAGGCTGGGCGTGG + Intergenic
927794501 2:26036368-26036390 AATGAAGTCTGGGCCGGGCGCGG + Intronic
927900298 2:26814033-26814055 ACAGAATTCCAGGCCGGGCGCGG + Intergenic
928646314 2:33356387-33356409 TCAGAAATGTCTGCCGGGCGAGG + Intronic
928807466 2:35177043-35177065 AAAGAAATGTTGGCTGGGCGTGG - Intergenic
928843005 2:35633619-35633641 ATATTAGTGTCGGCCGGGCGTGG + Intergenic
929118301 2:38463421-38463443 ACAGAATTGGGGGCCGGGCGTGG - Intergenic
929127345 2:38533928-38533950 TGAAAAGTGTCAGCCGGGCGTGG + Intergenic
929161790 2:38839419-38839441 AAAGCAGTTTCGGCTGGGCGCGG + Intronic
929213406 2:39384234-39384256 ACAGCACTGTCGGCCGGGCATGG + Intronic
929702658 2:44177706-44177728 ACATACATGTAGGCCGGGCGCGG - Intronic
930550906 2:52833767-52833789 AAAGAAGAGTCGGCCAGGCTTGG + Intergenic
930647070 2:53921880-53921902 ACTGAAGTTTGGGCCAGGCGCGG + Intronic
930825814 2:55695853-55695875 TTAAAAGTGTCGGCCGGGCGCGG + Intergenic
931348304 2:61467013-61467035 ACAGCAGTCTTGGCCAGGCGCGG + Intronic
931367470 2:61631346-61631368 ACAGAAGAGTTAGCCAGGCGTGG - Intergenic
931568027 2:63637061-63637083 ACAAGAGTGGCGGCTGGGCGCGG + Intronic
931654953 2:64502475-64502497 ACAAAATTGTGGGCCGGGCACGG + Intergenic
932034616 2:68230281-68230303 ACAGAAATGAAGGCCGGGCATGG - Intronic
932261301 2:70330038-70330060 TCAAAAGTGCCGGCTGGGCGCGG + Intergenic
932726673 2:74185529-74185551 TCGGAAGTCTGGGCCGGGCGCGG - Intergenic
932979508 2:76647336-76647358 TAAGAATTGTAGGCCGGGCGCGG - Intergenic
933050098 2:77591916-77591938 ACAGAATTGTCAGCTGGGCGCGG + Intronic
933122005 2:78550425-78550447 ATGTAAGTGTAGGCCGGGCGCGG + Intergenic
933309272 2:80639810-80639832 AAATATTTGTCGGCCGGGCGCGG + Intronic
933415153 2:81978141-81978163 ACAAAAATATCAGCCGGGCGTGG - Intergenic
933455812 2:82517693-82517715 AAAGAGTTTTCGGCCGGGCGAGG - Intergenic
933520662 2:83368150-83368172 AAAGAAGGGTAGGCCGGGCGCGG + Intergenic
933563363 2:83917394-83917416 ATAAAAGTGTCGGCTGGGCACGG - Intergenic
933706908 2:85298201-85298223 AAAAAAGTGCAGGCCGGGCGCGG + Intronic
934859115 2:97749297-97749319 TAGGAAGTGTCAGCCGGGCGCGG - Intergenic
934901478 2:98163247-98163269 ACAGATGCTTGGGCCGGGCGCGG + Intronic
935982645 2:108642647-108642669 ACACTAGTAGCGGCCGGGCGCGG - Intronic
936102920 2:109599165-109599187 ACTCAAGTGGAGGCCGGGCGCGG + Intronic
936637642 2:114277267-114277289 TAACAAGGGTCGGCCGGGCGCGG - Intergenic
936683393 2:114800971-114800993 ACAGAAGAATGGGCCGGGCACGG + Intronic
937162593 2:119779325-119779347 AAAGAATTGTCGGCTGGGCGCGG + Intronic
937405135 2:121620636-121620658 AAAGAAGTCAAGGCCGGGCGTGG - Intronic
937423054 2:121774534-121774556 AAAGAAAAGTGGGCCGGGCGCGG + Intergenic
937619442 2:123968646-123968668 ATAGAAATATCGGCCGGGCGCGG - Intergenic
937918974 2:127117056-127117078 TTTGAAGTCTCGGCCGGGCGCGG - Intergenic
937933221 2:127221422-127221444 AAATAAATGTTGGCCGGGCGCGG - Intergenic
937962677 2:127473093-127473115 ACAGAATTCTTGGCTGGGCGTGG - Intronic
939404788 2:141742542-141742564 ACAGAACTGGAGGCCAGGCGTGG - Intronic
939635359 2:144575690-144575712 TCAGAGGTGTTGGCCGGGCACGG - Intergenic
940052262 2:149477330-149477352 ACTGAAAGGTCAGCCGGGCGTGG + Intergenic
940834820 2:158509655-158509677 ATACTAGTGTGGGCCGGGCGCGG + Intronic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
941144548 2:161827853-161827875 ACATAAATATTGGCCGGGCGCGG - Intronic
941218574 2:162744861-162744883 AAAGTTCTGTCGGCCGGGCGCGG - Intronic
941445438 2:165593089-165593111 AAAGAGGTTTAGGCCGGGCGCGG - Intronic
941475807 2:165950896-165950918 ACAGAGCTGTCGGACGGGCGTGG - Intronic
941496482 2:166210766-166210788 AAAGAAGTCTCGGCTGGGCATGG + Intronic
941694794 2:168539253-168539275 ACAATATTTTCGGCCGGGCGCGG - Intronic
941779040 2:169425262-169425284 ATATAATTGTTGGCCGGGCGCGG + Intergenic
941819499 2:169829712-169829734 ACTCAAATGTTGGCCGGGCGCGG - Intronic
941935238 2:170976589-170976611 ACAGAGCTGTCGGCCGGACGCGG + Intergenic
942925517 2:181427387-181427409 ACATGAGTTTTGGCCGGGCGCGG + Intergenic
943186013 2:184608233-184608255 AGAGATGCATCGGCCGGGCGCGG - Intronic
943360574 2:186914212-186914234 ACTGAAGTTGCGGCCGGGCATGG + Intergenic
943676029 2:190717260-190717282 AGAAAAATGCCGGCCGGGCGCGG - Intergenic
944302548 2:198140141-198140163 AAAGAAGTATGGGCCAGGCGCGG - Intronic
944361581 2:198863170-198863192 AAACAATTTTCGGCCGGGCGCGG - Intergenic
944427711 2:199600443-199600465 ATAAAAGAGTTGGCCGGGCGCGG - Intergenic
944452656 2:199858601-199858623 AAAGTTGTGTGGGCCGGGCGCGG - Intergenic
944622520 2:201531247-201531269 ACTGCAGGGTCGGCCAGGCGCGG - Intronic
944657326 2:201889104-201889126 GCAGAAGTTTAGGCCAGGCGAGG + Intronic
944664307 2:201946961-201946983 AGAGAAAGGTCGGCCAGGCGCGG + Intergenic
944761510 2:202820081-202820103 AAAGATGTGTTGGCCGGGCGCGG + Intronic
944774068 2:202943934-202943956 ACAGGAGTTTAGGCCGGGCGTGG - Intronic
945131848 2:206582166-206582188 TAAGAAATGTTGGCCGGGCGTGG - Intronic
945433099 2:209788124-209788146 ACAAAAAAGTTGGCCGGGCGCGG + Intronic
945760714 2:213910776-213910798 AAAGAATTCTTGGCCGGGCGTGG - Intronic
945790574 2:214299535-214299557 ACAGAAGTATAGGCTGGGCACGG - Intronic
945792830 2:214326653-214326675 ACAGTACTTCCGGCCGGGCGCGG + Intronic
945914327 2:215686844-215686866 ACAAAACTGTTGGCCGGGTGCGG - Intergenic
946217977 2:218200693-218200715 AAAGAAGTTCCGGCCGGGCGCGG + Intergenic
946900169 2:224364609-224364631 ACAGAGCTATCGGCCGGGCGCGG + Intergenic
946920866 2:224581104-224581126 ACAGAACTATTGGCCGGGCGTGG + Intronic
947168932 2:227291271-227291293 AAACACTTGTCGGCCGGGCGCGG + Intronic
947403536 2:229751895-229751917 AGAAAAATGTCGGCCGGGCGCGG + Intergenic
947468126 2:230372433-230372455 AAGAAAGAGTCGGCCGGGCGCGG + Intronic
947486204 2:230551490-230551512 AAAAAAATGTAGGCCGGGCGAGG + Intergenic
947518562 2:230827826-230827848 AAAGAAATGTCAGCTGGGCGCGG - Intergenic
948265962 2:236635560-236635582 AAAGCAGGGACGGCCGGGCGCGG - Intergenic
948339415 2:237237572-237237594 ACTGCAGTGTGGGCCGGGCATGG + Intergenic
948488830 2:238298322-238298344 ACAAAAGCTTTGGCCGGGCGCGG - Intergenic
948725639 2:239932122-239932144 GCAGAGGTGCAGGCCGGGCGCGG - Intronic
949005502 2:241644578-241644600 TCAGAAGTGTTGGCCGGGCGCGG + Intronic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
1168808316 20:686148-686170 AGAGAGGTGGAGGCCGGGCGCGG + Intergenic
1169057817 20:2638049-2638071 ATAAAAGTCTAGGCCGGGCGTGG + Intronic
1169231091 20:3889354-3889376 ACGGAAGAGGCGGCCGGCCGAGG + Exonic
1169398633 20:5260036-5260058 AAAGCCGTGTTGGCCGGGCGCGG + Intergenic
1169603945 20:7293991-7294013 AATGTATTGTCGGCCGGGCGCGG - Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1170265005 20:14456870-14456892 ACAAAAAAGTTGGCCGGGCGTGG - Intronic
1170461112 20:16577072-16577094 ATAAAAATGTCGGCCGGGCTTGG - Intergenic
1171078612 20:22155100-22155122 ACAGAAGTGGAGGTCGGGGGTGG + Intergenic
1171287077 20:23949182-23949204 TCAGAGATGACGGCCGGGCGCGG - Intergenic
1171323630 20:24269840-24269862 AAAGAAGTCTCGGCTGGGAGCGG - Intergenic
1172070012 20:32249823-32249845 ACAAAACTATCAGCCGGGCGTGG - Intergenic
1172414229 20:34751078-34751100 TGTGAAGTGTCGGCCGGGCGCGG + Intronic
1172597545 20:36160291-36160313 TCAGAAGTGTAGGCCAGGCACGG + Intronic
1172622798 20:36330861-36330883 ACTCAAAAGTCGGCCGGGCGTGG - Intronic
1172855870 20:38002005-38002027 ATACAACTGTCGGCCAGGCGCGG - Intronic
1173513455 20:43648444-43648466 ACAAATTTGTAGGCCGGGCGCGG - Intergenic
1174251832 20:49225743-49225765 AGAGAGTTCTCGGCCGGGCGCGG - Intronic
1174261519 20:49299102-49299124 ACAGCACTATAGGCCGGGCGTGG - Intergenic
1174381225 20:50156543-50156565 AAAAAAAAGTCGGCCGGGCGCGG - Intergenic
1174384807 20:50180938-50180960 ACAGAATTACTGGCCGGGCGTGG + Intergenic
1174422441 20:50408219-50408241 ACAGAAACGTAGACCGGGCGCGG - Intergenic
1174445588 20:50588788-50588810 AAAGAATTCTAGGCCGGGCGCGG + Intronic
1174525546 20:51167741-51167763 AAAATAGTCTCGGCCGGGCGCGG - Intergenic
1174830563 20:53808493-53808515 AGAAAAGTCTGGGCCGGGCGCGG + Intergenic
1175106425 20:56618236-56618258 ACAGTAGTGCCAGCCGGGTGCGG - Intergenic
1176188111 20:63792669-63792691 ACAAAAATGTCAGCCAGGCGTGG - Intronic
1176302074 21:5103165-5103187 AAGGAAATGTGGGCCGGGCGTGG + Intergenic
1176782083 21:13208418-13208440 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1176839332 21:13826317-13826339 AAAGAACTTCCGGCCGGGCGCGG - Intergenic
1177239612 21:18440082-18440104 ACTGTAGTGATGGCCGGGCGCGG + Intronic
1177312677 21:19417780-19417802 AGAATAGTGTGGGCCGGGCGCGG - Intergenic
1177637237 21:23803382-23803404 ACAAAAATGTGGGTCGGGCGTGG + Intergenic
1177717272 21:24854983-24855005 AATGAAGTTTAGGCCGGGCGCGG - Intergenic
1178149871 21:29781958-29781980 ACAGTAGGTTAGGCCGGGCGCGG - Intronic
1178558748 21:33617997-33618019 ATAGAAATGATGGCCGGGCGCGG + Intronic
1178671331 21:34594261-34594283 AAAGAAGGGTGGGCCGGGCGCGG + Intronic
1178872278 21:36386330-36386352 AAACCAGTGTCGGCTGGGCGCGG + Intronic
1179056764 21:37943628-37943650 AAAAAAATGCCGGCCGGGCGCGG - Intergenic
1179341190 21:40511699-40511721 AAAGTATTCTCGGCCGGGCGCGG + Intronic
1179854955 21:44158735-44158757 AAGGAAATGTGGGCCGGGCGTGG - Intergenic
1179975138 21:44861090-44861112 ATAGTAGTATGGGCCGGGCGCGG - Intronic
1180049504 21:45324840-45324862 ACAGAAGTGGCCGCTGGGTGGGG + Intergenic
1180177803 21:46098637-46098659 ACGGAAGGGGCGGCGGGGCGGGG + Intronic
1180232523 21:46435830-46435852 ACAAAACTGCCGGCCGGGCGCGG - Intronic
1180593402 22:16958905-16958927 AATGAAATGTCGGCCGGGCACGG + Intergenic
1180663014 22:17485475-17485497 AGTGAAGTATTGGCCGGGCGTGG + Intronic
1180666202 22:17514741-17514763 ACAGACTTGTGGGCCAGGCGCGG + Intronic
1180681360 22:17629073-17629095 ACATGATTGTTGGCCGGGCGTGG + Intronic
1180684872 22:17658108-17658130 AAAGAAATGTCGGCCGGGCGTGG - Intronic
1180689971 22:17705585-17705607 AAAGCAATATCGGCCGGGCGCGG - Intronic
1180697264 22:17759850-17759872 AAAAATGTTTCGGCCGGGCGAGG + Intronic
1180890040 22:19280998-19281020 AAAGAGTTGTGGGCCGGGCGCGG + Intronic
1180994257 22:19957238-19957260 ACAGGAATGCTGGCCGGGCGCGG - Intronic
1181101611 22:20544373-20544395 ACAGAAATTTAGGCCGGGTGCGG + Intronic
1181159594 22:20950702-20950724 ACACAAGTCTAGGCCAGGCGCGG - Exonic
1181300604 22:21878226-21878248 AAAAAAAAGTCGGCCGGGCGCGG + Intergenic
1181628080 22:24134785-24134807 AAACAAGTGTGGGCCGGGCGCGG + Intronic
1182450745 22:30419259-30419281 ACAGAAGTGATGGCCGGGCGTGG + Intronic
1182736934 22:32537447-32537469 AAGGAAGTGCCGGCCGGGTGCGG - Intronic
1183118864 22:35714019-35714041 ACATCTGTGTTGGCCGGGCGCGG + Intergenic
1183293355 22:37016233-37016255 GTAGCAGTGGCGGCCGGGCGTGG - Intronic
1183586679 22:38756746-38756768 ACAGAAGAGCTGGCCGGGCGCGG - Intronic
1183697833 22:39433159-39433181 ACATCAGTCTCGGCCGGGCGCGG + Intronic
1183826147 22:40389307-40389329 ACTGCAGTGCAGGCCGGGCGCGG + Intronic
1183858236 22:40650880-40650902 ACTGCACTGTTGGCCGGGCGCGG - Intergenic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1185345923 22:50310652-50310674 AGAAAAGTCCCGGCCGGGCGCGG + Exonic
949178368 3:1095180-1095202 ACAGAAATATTGGCCGCGCGCGG + Intronic
949339140 3:3009721-3009743 AAAGAAATGCTGGCCGGGCGCGG - Intronic
949397434 3:3629710-3629732 TTAAAAGCGTCGGCCGGGCGTGG - Intergenic
949490868 3:4587559-4587581 TGAGAAGTGTGGGCCGGGCAGGG - Intronic
950094581 3:10321392-10321414 ATATAACTATCGGCCGGGCGCGG + Intergenic
950504255 3:13384249-13384271 ACAACAGGGCCGGCCGGGCGTGG - Intronic
950676222 3:14555918-14555940 ACTCAAGTGGCGGCTGGGCGTGG - Intergenic
950749686 3:15118869-15118891 AAAGAATTCTGGGCCGGGCGCGG + Intergenic
951142172 3:19175497-19175519 ACAAAACAGTTGGCCGGGCGCGG - Intronic
951351292 3:21610478-21610500 AGACATGTGTTGGCCGGGCGCGG + Intronic
951615214 3:24534860-24534882 AAAAAAGTCTGGGCCGGGCGCGG + Intergenic
951788662 3:26453759-26453781 ACATATGTGTGGGCCAGGCGCGG - Intergenic
951879088 3:27463135-27463157 ACAAAAGTTAGGGCCGGGCGCGG + Intronic
952316693 3:32238442-32238464 ACAGAAGTAAAGGCCGGGAGGGG + Intergenic
952678816 3:36066936-36066958 ACAAAAGAAACGGCCGGGCGCGG - Intergenic
952996638 3:38889507-38889529 AAAGAAATGCTGGCCGGGCGCGG + Intronic
953030129 3:39174476-39174498 AAAAAACTGTGGGCCGGGCGCGG + Intergenic
953305270 3:41823010-41823032 AAAAAAATCTCGGCCGGGCGTGG - Intronic
953398035 3:42588638-42588660 ACAAAAGTATAGGCCGGGCATGG + Intronic
953881680 3:46694202-46694224 ACAGGAGGGGCGGCCGGCCGTGG - Intergenic
953976157 3:47382975-47382997 ACAGGAGTTTTGGCCAGGCGCGG - Intronic
954169660 3:48790996-48791018 TTAAAAGTGTTGGCCGGGCGAGG + Intronic
954435612 3:50494239-50494261 ACTGAAGTGGGGGCAGGGCGGGG + Intronic
954515337 3:51170652-51170674 AAAGATTTGTCAGCCGGGCGCGG + Intronic
954814754 3:53271742-53271764 AAAAAAGAGTCGGCCAGGCGCGG - Intergenic
955262226 3:57404423-57404445 ACAAAAGTTTCGGCCAGGTGTGG + Intronic
955323642 3:57992969-57992991 ACAGACTTGTAGGCTGGGCGCGG + Intergenic
955911896 3:63865599-63865621 AAGTAATTGTCGGCCGGGCGCGG + Intronic
956625327 3:71260830-71260852 CTAGAACTGTAGGCCGGGCGTGG - Intronic
956887854 3:73578458-73578480 AAAGAATGGTCGGCTGGGCGCGG - Intronic
957200389 3:77127077-77127099 AAAGAAGTTTCGGCCTGGCGTGG - Intronic
957203661 3:77166847-77166869 ACCTCTGTGTCGGCCGGGCGCGG - Intronic
957509573 3:81169869-81169891 ACATAGGTTTCGGCCGGGCGTGG - Intergenic
957858383 3:85909012-85909034 TCACAACTGTAGGCCGGGCGTGG - Intronic
957968083 3:87346684-87346706 ACAGAAGTATAGGTCGGGTGTGG + Intergenic
958191091 3:90185646-90185668 AGATAACTCTCGGCCGGGCGTGG - Intergenic
958472813 3:94542599-94542621 AAGTAAATGTCGGCCGGGCGCGG - Intergenic
958784492 3:98582779-98582801 AAAGTATTGTGGGCCGGGCGTGG - Intronic
958894679 3:99816529-99816551 TAAGAAGTATGGGCCGGGCGCGG - Intergenic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
959049553 3:101512108-101512130 ACAGATTTATTGGCCGGGCGCGG - Intronic
959210729 3:103376793-103376815 AGCGAAGTTTTGGCCGGGCGCGG + Intergenic
960107675 3:113815678-113815700 ACAGGAGGGTAGGCCGGGTGCGG + Intergenic
960139144 3:114135489-114135511 AGACAAATATCGGCCGGGCGCGG - Intronic
960280873 3:115780318-115780340 ACAGCAGTGGGGGCCGGGAGCGG + Intergenic
960641723 3:119831365-119831387 AGAGAAGAGTGGGCCGGGCGCGG + Intronic
960666205 3:120111522-120111544 ACACACTTCTCGGCCGGGCGCGG + Intergenic
960689339 3:120327542-120327564 AAAGAAATCTTGGCCGGGCGTGG - Exonic
961400730 3:126640395-126640417 ACACAAGCAGCGGCCGGGCGCGG - Intronic
961762714 3:129183573-129183595 ACAGAAGTGTCGTCCGACAGCGG + Intronic
961850901 3:129817291-129817313 CCATAAGAGTCGGCCGGGTGTGG + Intronic
962063925 3:131959288-131959310 AAAGGTGTATCGGCCGGGCGCGG - Intronic
962075900 3:132081343-132081365 TAAGATTTGTCGGCCGGGCGCGG - Intronic
962349131 3:134644113-134644135 GCAGGAGGCTCGGCCGGGCGCGG - Intronic
962790918 3:138810935-138810957 AAATAAATGTCGGCCGGGCGCGG + Intronic
963249493 3:143089976-143089998 AAAGAAGTTGCAGCCGGGCGCGG - Intergenic
963619415 3:147586733-147586755 ACTGAAGTGTTGGCCAGGCACGG - Intergenic
964110309 3:153080414-153080436 ACATAATTTTGGGCCGGGCGCGG - Intergenic
964150159 3:153514965-153514987 AGAAAAGTGTTGGCCGGGCACGG + Intergenic
964356513 3:155855976-155855998 AGAACAGTGTTGGCCGGGCGCGG + Intergenic
964665359 3:159165916-159165938 ACAGATGCTTTGGCCGGGCGCGG - Intronic
965077362 3:163995944-163995966 AAAGAGGAGTAGGCCGGGCGTGG + Intergenic
965080991 3:164031697-164031719 ACAGAAGTGAGGGCTGGGTGTGG + Intergenic
965179602 3:165384714-165384736 AAAGAAGGATAGGCCGGGCGCGG - Intergenic
965509170 3:169549260-169549282 AGACAAGTGTCGGCCGGGCACGG - Intronic
965537941 3:169843482-169843504 ACAGAACTGTGAGCCGGGTGAGG + Intronic
966058954 3:175732640-175732662 ACAGAAGTGTTGGGAGGGTGCGG + Intronic
966170928 3:177079139-177079161 AAAAAAATGTCGGCCGGGTGCGG + Intronic
966177530 3:177154683-177154705 AAAGTTCTGTCGGCCGGGCGCGG - Intronic
966189006 3:177254370-177254392 TTAAAAGTGTCGGCCGGGCCTGG - Intergenic
966271665 3:178114933-178114955 ACAAAATTAGCGGCCGGGCGCGG + Intergenic
966482807 3:180430209-180430231 CAAGAAATGTTGGCCGGGCGCGG + Intergenic
966670895 3:182524503-182524525 GGAGAAGTTTTGGCCGGGCGCGG - Intergenic
966719756 3:183050410-183050432 AAAGGAAAGTCGGCCGGGCGCGG + Intronic
966827828 3:183979863-183979885 AAAAAAGTATTGGCCGGGCGAGG - Intronic
966845291 3:184124340-184124362 ACAGAAAGTTCGGCCGGGCGCGG + Intergenic
966984783 3:185169177-185169199 ATAAAAGTATTGGCCGGGCGCGG - Intergenic
967190151 3:186977921-186977943 AAAACAGTCTCGGCCGGGCGTGG + Intronic
967579600 3:191136775-191136797 CAAAAAGTGTTGGCCGGGCGCGG + Intergenic
967965900 3:194960135-194960157 ACAGAAGTGTCAGCATGGGGAGG + Intergenic
967996957 3:195174034-195174056 AGAGAAGTGTCTGCCTGGCCTGG - Intronic
968021626 3:195396495-195396517 AAAGAAGTATGGGCCGGGCACGG + Intronic
968182965 3:196610729-196610751 ACAAAACTGAGGGCCGGGCGTGG - Intergenic
968368416 3:198205367-198205389 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
968758831 4:2431076-2431098 AAAAAAATGTTGGCCGGGCGCGG + Intronic
968785146 4:2616088-2616110 TTAGAAGTTTCGGCCGGGCGCGG - Intronic
968822335 4:2864120-2864142 ACAGAATTTATGGCCGGGCGTGG + Intronic
969366955 4:6701416-6701438 AAAGAATTATAGGCCGGGCGCGG - Intergenic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
969418028 4:7073825-7073847 ACAGAATTGTCAGCAGGGAGTGG - Intergenic
970393905 4:15645715-15645737 AAAGAAAAGTAGGCCGGGCGTGG - Intronic
970396775 4:15675871-15675893 ACAGGAGTTTTGGCTGGGCGCGG - Intronic
970600414 4:17637315-17637337 AAAGCAGTGGGGGCCGGGCGCGG - Intronic
972391175 4:38615214-38615236 AGAGAAGTTTTGACCGGGCGCGG + Intergenic
972664620 4:41152616-41152638 AAACAAGTGAAGGCCGGGCGCGG - Intronic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
973248045 4:48031349-48031371 ACTGAAGGGGTGGCCGGGCGTGG - Intronic
973282748 4:48376899-48376921 AAAAAAAAGTCGGCCGGGCGCGG - Intronic
973623942 4:52752455-52752477 AGACAAGGGGCGGCCGGGCGCGG + Intergenic
973629660 4:52808178-52808200 AAAGAAAGTTCGGCCGGGCGCGG + Intergenic
973875773 4:55217054-55217076 ACTGAAGTGTAGGCAGGGCTGGG - Intergenic
974043709 4:56879586-56879608 AAAGAAATGTGGACCGGGCGTGG + Intergenic
974256653 4:59465255-59465277 AAATAATTTTCGGCCGGGCGCGG + Intergenic
974565773 4:63577144-63577166 CAAGAAGTTTGGGCCGGGCGCGG - Intergenic
974804031 4:66857170-66857192 ATAAAAGAGTTGGCCGGGCGTGG + Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
974911090 4:68120676-68120698 AAAGATTTCTCGGCCGGGCGCGG - Intronic
975372259 4:73602796-73602818 ACACAAGTTTCGGCCAGGCGCGG + Intronic
975714525 4:77192809-77192831 ACAGAAACCTCAGCCGGGCGCGG - Intronic
975930262 4:79512937-79512959 ACAGAAAAGTTGGCCGGGCGTGG - Intergenic
975932759 4:79545515-79545537 AAAGAGGTGTCAGCCAGGCGTGG - Intergenic
976172112 4:82314918-82314940 ACTAAAGTTTAGGCCGGGCGTGG - Intergenic
976567353 4:86566421-86566443 AAAGTAGTCTAGGCCGGGCGCGG + Intronic
976639299 4:87320675-87320697 ACAGAAGAATAGGCCGGACGCGG - Intronic
976798849 4:88964916-88964938 AGAGCAGAGTGGGCCGGGCGCGG - Intronic
977038715 4:91986380-91986402 AGAATAGTGTCGGCCGGGCACGG - Intergenic
977091924 4:92688338-92688360 AAAGAAGAGTTGGCCGGGCGTGG - Intronic
977241698 4:94578118-94578140 TAAGAAGAGTTGGCCGGGCGCGG - Intronic
977245212 4:94622957-94622979 AAAGAAATGGAGGCCGGGCGTGG - Intronic
977259152 4:94777733-94777755 ATAGAAGTTTTGGCCGGGCGTGG + Intronic
977691494 4:99916842-99916864 ACATAATTGCCAGCCGGGCGTGG + Intronic
977901805 4:102431052-102431074 AGAGCAGTACCGGCCGGGCGCGG + Intronic
978135348 4:105250970-105250992 ACAGAAGTACAGGCCAGGCGTGG - Intronic
978145304 4:105365345-105365367 AAAGAACTGCCGACCGGGCGTGG - Intergenic
978152266 4:105450895-105450917 AGAAAAGTGTTGGCAGGGCGCGG - Intronic
978174076 4:105708645-105708667 ACAGACGGATCGGCAGGGCGGGG - Exonic
979256841 4:118615090-118615112 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
979331508 4:119425455-119425477 AAAGAAATGGAGGCCGGGCGTGG + Intergenic
979806050 4:124972402-124972424 AAAGCAGTCACGGCCGGGCGCGG - Intergenic
980286054 4:130779757-130779779 ACAGAGGGGATGGCCGGGCGTGG - Intergenic
980431224 4:132699016-132699038 ATGCAAGTATCGGCCGGGCGCGG - Intergenic
980673539 4:136043807-136043829 ACGGAAGTGTCGGCTTGGCACGG + Intergenic
980830949 4:138128730-138128752 CAACAAGTGTCGGCCGGGTGCGG - Intergenic
980937326 4:139238432-139238454 AAAGAATTGGCGGCCGGGCATGG + Intergenic
981179157 4:141717949-141717971 AAAGAAGTATTGGCCGGGCATGG - Intronic
981714911 4:147743319-147743341 ACAAAACTATCGGCTGGGCGCGG - Intronic
981906051 4:149922955-149922977 AAAAAAGTCTCGGCTGGGCGTGG - Intergenic
982004657 4:151052039-151052061 AAAGAAGAGTGGGCCGGGCGTGG + Intergenic
982642000 4:157973345-157973367 TAAGAAGTCTCGGCCAGGCGGGG - Intergenic
982740569 4:159053244-159053266 AAATAATAGTCGGCCGGGCGCGG - Intergenic
982988651 4:162242923-162242945 AAAAAAGTTCCGGCCGGGCGCGG + Intergenic
982993521 4:162311252-162311274 ATAGAAATCTTGGCCGGGCGCGG + Intergenic
983026779 4:162747384-162747406 ACTCAATAGTCGGCCGGGCGTGG - Intergenic
983218778 4:165025020-165025042 AATGAACTGTGGGCCGGGCGCGG - Intergenic
983226725 4:165092410-165092432 ACAGCACTGTGGGCCGGGTGCGG - Intronic
983728819 4:170967709-170967731 ACTGACGTGCAGGCCGGGCGCGG + Intergenic
983747467 4:171219468-171219490 AAAGAAATGCAGGCCGGGCGTGG + Intergenic
983773433 4:171577779-171577801 AGAAAAGTATGGGCCGGGCGCGG - Intergenic
984304748 4:177974082-177974104 ATAGATGTTTCAGCCGGGCGTGG + Intronic
984500359 4:180550801-180550823 ACATAAATCTCGGCCGGGCGCGG + Intergenic
984725321 4:183014293-183014315 ACACAAAAGTCAGCCGGGCGTGG + Intergenic
984889918 4:184482698-184482720 AAGGAAATGTGGGCCGGGCGCGG - Intergenic
984919293 4:184749815-184749837 ACAGAAGTACCGGCCAGGCGCGG + Intergenic
984974291 4:185216809-185216831 ACACTTTTGTCGGCCGGGCGAGG - Intronic
984983818 4:185308047-185308069 AGAGAGGTGTGGGCCCGGCGTGG - Intronic
985032719 4:185806746-185806768 ACAGGATTCTAGGCCGGGCGCGG - Intronic
985247477 4:187992405-187992427 ACCCAAGTGTTGGCTGGGCGTGG - Intergenic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
986918040 5:12648357-12648379 AAAGAGGTTTCGGCCGGGCACGG - Intergenic
986945774 5:13017683-13017705 ATATAAATGTCGGCCGGGCGTGG + Intergenic
987098116 5:14567784-14567806 ACAGAAGTTATGGCCGGGCATGG - Intergenic
987176376 5:15314994-15315016 AGAGAAGGTCCGGCCGGGCGCGG + Intergenic
987206387 5:15631403-15631425 GAAGAAGTGTGGGCTGGGCGTGG + Intronic
987627264 5:20418369-20418391 ACACTAGTCTTGGCCGGGCGTGG - Intronic
987771514 5:22311412-22311434 AAACAATTGTGGGCCGGGCGCGG + Intronic
988130317 5:27095950-27095972 AAAGAAGTTTTGGCTGGGCGTGG - Intronic
988161381 5:27522174-27522196 AGAGAAATTTTGGCCGGGCGCGG + Intergenic
988240852 5:28606904-28606926 ACAAACATGGCGGCCGGGCGCGG + Intergenic
988331364 5:29844782-29844804 ATAGAAATATGGGCCGGGCGCGG + Intergenic
988556428 5:32240108-32240130 AATGAATTGTAGGCCGGGCGCGG + Intronic
989478484 5:41901551-41901573 AAAGATGGGTAGGCCGGGCGCGG - Intergenic
989593076 5:43129944-43129966 CCAGAAGTTTCGGCTGGGTGTGG - Intronic
989741059 5:44772614-44772636 ATAAATGTGTCGGCCAGGCGCGG - Intergenic
990181320 5:53163579-53163601 ACAGTATCCTCGGCCGGGCGCGG - Intergenic
990526821 5:56636310-56636332 AAAGTACTCTCGGCCGGGCGCGG - Intergenic
990804921 5:59649356-59649378 GCAGAAGTGTGAGCCGGGGGAGG + Intronic
990805032 5:59650963-59650985 AAATAATTGTTGGCCGGGCGCGG + Intronic
991022763 5:61997803-61997825 AAACAATTTTCGGCCGGGCGCGG + Intergenic
991069195 5:62457856-62457878 AGATAAATGCCGGCCGGGCGCGG + Intronic
991380848 5:66023965-66023987 ACAGAAAGTTCGGCTGGGCGCGG - Intronic
991584352 5:68187122-68187144 AGAGAAAACTCGGCCGGGCGCGG - Intergenic
991696395 5:69277477-69277499 ATAAAAATGTTGGCCGGGCGCGG + Intergenic
991732076 5:69599240-69599262 AAACAAATCTCGGCCGGGCGCGG + Intergenic
991808509 5:70454383-70454405 AAACAAATCTCGGCCGGGCGCGG + Intergenic
991862875 5:71028618-71028640 AAACAAATCTCGGCCGGGCGCGG - Intergenic
991900872 5:71459219-71459241 AGACAAGTATAGGCCGGGCGTGG + Intronic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992548861 5:77843030-77843052 AAAGAAATGTCGGCTGGGCATGG - Intronic
992696222 5:79290695-79290717 TTAGAAATGTCGGCCGGGCACGG + Intronic
993348757 5:86820408-86820430 AGAGAAGCGTAGGCCAGGCGCGG - Intergenic
993531787 5:89034320-89034342 ACAGAAGCTTGGGCTGGGCGTGG - Intergenic
994060422 5:95470266-95470288 ATTGAATTGTTGGCCGGGCGCGG - Intronic
994099181 5:95876027-95876049 ATAAAAGTGTTGGCTGGGCGCGG + Intergenic
994199360 5:96955070-96955092 ACATAATTGCAGGCCGGGCGCGG - Intronic
994427275 5:99606830-99606852 ATAAGAATGTCGGCCGGGCGTGG + Intergenic
994588203 5:101738688-101738710 ACAGCAATCACGGCCGGGCGCGG + Intergenic
994850844 5:105053295-105053317 TCAAAAGAGACGGCCGGGCGCGG - Intergenic
995003792 5:107166508-107166530 TAAGAAATGTCGGCCGGGCGCGG + Intergenic
995195648 5:109364331-109364353 ATTTCAGTGTCGGCCGGGCGCGG + Intronic
995466411 5:112453560-112453582 AAAAATGTGTTGGCCGGGCGCGG - Intergenic
995680973 5:114718839-114718861 AAGAAATTGTCGGCCGGGCGTGG - Intergenic
995762553 5:115578486-115578508 AGAAAAATGTTGGCCGGGCGCGG - Intergenic
995813342 5:116134909-116134931 AAAAAATTGTAGGCCGGGCGCGG - Intronic
995884107 5:116873978-116874000 AAACAGTTGTCGGCCGGGCGCGG - Intergenic
995994564 5:118282972-118282994 CCAGAAGGGGCGGCCGGGCGGGG - Intergenic
996121588 5:119679758-119679780 AGAGACTTCTCGGCCGGGCGCGG - Intergenic
996298939 5:121959012-121959034 ACAAGAGTATCGGCCGGGTGTGG + Intergenic
996447329 5:123570644-123570666 AAAGGACTGTCGGCTGGGCGCGG - Intronic
996535092 5:124569613-124569635 AGAGAAGTGAAGGCCGGGCATGG + Intergenic
996616838 5:125452379-125452401 AAAGAAATTCCGGCCGGGCGCGG + Intergenic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
996946813 5:129080314-129080336 ACACAAGTTTGGGCCAGGCGTGG + Intergenic
997418116 5:133744757-133744779 ACTGAAGTGTCGGTGGGACGTGG + Intergenic
997519472 5:134513420-134513442 AGAAAAGTGTTGGCTGGGCGCGG - Intergenic
998118677 5:139559134-139559156 AAAAATCTGTCGGCCGGGCGCGG + Intronic
998249517 5:140542401-140542423 ACAGAAGTGGAGGCCGGGCATGG + Intronic
998824425 5:146086317-146086339 AAAGACCTTTCGGCCGGGCGCGG - Intronic
998931491 5:147186257-147186279 AAAAAATTGTCGGCTGGGCGGGG - Intergenic
999315072 5:150578416-150578438 ACAGCAGTTTCGGCCGGGTGCGG + Intergenic
999329937 5:150666321-150666343 ATAGAAATGGGGGCCGGGCGCGG + Intronic
999454627 5:151704893-151704915 AATAAAGTGTAGGCCGGGCGCGG + Intergenic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
999779252 5:154835869-154835891 AAAAAAAAGTCGGCCGGGCGCGG - Intronic
1000665929 5:163996651-163996673 AAATAAATGTTGGCCGGGCGCGG + Intergenic
1000700506 5:164443536-164443558 ACAGATATGTCGGCCGGGCGCGG - Intergenic
1001033679 5:168281355-168281377 ACAGACCTCTGGGCCGGGCGTGG + Intergenic
1001628970 5:173160522-173160544 ACAGAAATACGGGCCGGGCGTGG - Intronic
1001846046 5:174922477-174922499 ACACAAGTTGAGGCCGGGCGTGG + Intergenic
1002040787 5:176512627-176512649 ACCCAAATGTTGGCCGGGCGCGG - Intergenic
1002042204 5:176522660-176522682 ACAAAAATGAAGGCCGGGCGTGG - Intergenic
1002174680 5:177394981-177395003 ACAAAAGTCTCGGCCGGGCACGG - Intronic
1002272414 5:178081377-178081399 ACAAAAGTCTTGGCAGGGCGCGG + Intergenic
1002314261 5:178333244-178333266 AAACATGAGTCGGCCGGGCGCGG - Intronic
1002475866 5:179465706-179465728 AGAGAAGGGGCAGCCGGGCGTGG - Intergenic
1002568239 5:180126115-180126137 ACAAGAATCTCGGCCGGGCGCGG + Intronic
1002629605 5:180562448-180562470 AAAGAAGTCCTGGCCGGGCGCGG + Intronic
1002727637 5:181310594-181310616 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1002727836 5:181312400-181312422 AAAAAAATGTTGGCCGGGCGCGG - Intergenic
1003064913 6:2895808-2895830 AAAGAAGTTTAGGCTGGGCGTGG + Intronic
1003353544 6:5343500-5343522 ACTGAAATGTAGGCCAGGCGCGG - Intronic
1003590139 6:7430473-7430495 ACGAAACTGTAGGCCGGGCGCGG - Intergenic
1003666472 6:8116225-8116247 AAAGAAATTGCGGCCGGGCGTGG + Intergenic
1003972017 6:11308657-11308679 AAAGATGTCCCGGCCGGGCGCGG - Intronic
1004201049 6:13548388-13548410 ACAGAAGTCACAGCCGGGCACGG - Intergenic
1004203335 6:13570216-13570238 ACAGAAATTTCAGCCGGGCGTGG + Intergenic
1004227937 6:13804482-13804504 GTAGAAGTCTTGGCCGGGCGCGG + Intronic
1004325229 6:14668614-14668636 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1004383940 6:15155921-15155943 ACAGAAATATGGGCCAGGCGCGG - Intergenic
1004469857 6:15919787-15919809 ACCCTAGTGTTGGCCGGGCGCGG - Intergenic
1004602726 6:17166069-17166091 GCAAATGTGTGGGCCGGGCGCGG + Intergenic
1004603255 6:17171046-17171068 AAAGAGGTTTAGGCCGGGCGCGG + Intergenic
1004666903 6:17756816-17756838 AACGTAGTGTCGGCCAGGCGTGG + Intergenic
1005166719 6:22931137-22931159 ACAGAAGTTGAGGCTGGGCGTGG - Intergenic
1005293959 6:24405813-24405835 AAAGGTGTGCCGGCCGGGCGTGG + Intronic
1005522136 6:26610842-26610864 AGAGAAATGCCGGCCGGGCGCGG + Intergenic
1005634315 6:27738900-27738922 AAAGAAGAGCGGGCCGGGCGCGG - Intergenic
1005918055 6:30371460-30371482 ATAGAAAGGTAGGCCGGGCGCGG - Intergenic
1006024157 6:31136858-31136880 ACATAAGTGTTGGCCGGGCACGG + Intronic
1006725085 6:36193764-36193786 GTAAAAGTATCGGCCGGGCGCGG + Intergenic
1006727843 6:36212661-36212683 TTAAAAGTTTCGGCCGGGCGCGG + Intronic
1006755888 6:36415150-36415172 AAAGAATTGCCGGCCAGGCGCGG + Intronic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1006994937 6:38250780-38250802 ACAGAAGTTTAGGCCGAGCGAGG + Intronic
1007091408 6:39187084-39187106 ACAGCAATGACGGCCGGGCACGG + Intergenic
1007546928 6:42701411-42701433 ACAAAAATGACGGCCAGGCGCGG - Intronic
1007926226 6:45651774-45651796 ACAGATGTGTCAGCCGGGACAGG - Intronic
1008331269 6:50247426-50247448 TAAGAAGTATAGGCCGGGCGTGG + Intergenic
1008428853 6:51391492-51391514 ATTAAGGTGTCGGCCGGGCGCGG + Intergenic
1008803335 6:55397226-55397248 AAAAAAATGCCGGCCGGGCGCGG + Intronic
1008813401 6:55533594-55533616 ACAACAGACTCGGCCGGGCGCGG + Intronic
1008842555 6:55921377-55921399 AGAGTTATGTCGGCCGGGCGCGG + Intergenic
1009328226 6:62381160-62381182 AAAGAATTCTTGGCCGGGCGCGG + Intergenic
1009414525 6:63400701-63400723 ACATAAATTTCGGCCGGGCGTGG + Intergenic
1009953286 6:70421172-70421194 AAAGTAGTGTGGGCCAGGCGTGG - Intronic
1010003456 6:70971107-70971129 ACTGAAGTGTAGGCCAGGCGTGG - Intergenic
1010218348 6:73425681-73425703 ACATAAATATAGGCCGGGCGTGG + Intronic
1010383319 6:75248960-75248982 ACAGAATTTTGGGCCGGGCACGG + Intronic
1010418719 6:75646544-75646566 ACACTACTGTCAGCCGGGCGCGG + Intronic
1010619099 6:78052688-78052710 AGATTTGTGTCGGCCGGGCGCGG + Intergenic
1010826777 6:80485147-80485169 AGAGTGTTGTCGGCCGGGCGCGG + Intergenic
1010971607 6:82268979-82269001 TCAGAGGTGTTGGCCGGGCGTGG + Intergenic
1011448857 6:87472342-87472364 TCAGATGTATCGGCCGGGCGTGG - Intronic
1011639171 6:89403149-89403171 TAAAAACTGTCGGCCGGGCGCGG + Intronic
1012164351 6:95929746-95929768 ATAGAGGTGGCGGCTGGGCGCGG - Intergenic
1013061841 6:106642344-106642366 AAACAAGAGTCGGCGGGGCGGGG - Intronic
1013062421 6:106648005-106648027 AAAGTATTGTAGGCCGGGCGTGG + Intronic
1013205801 6:107944907-107944929 ACAAAAATCTAGGCCGGGCGCGG + Intronic
1013251968 6:108343336-108343358 ACAAAAAGGTTGGCCGGGCGTGG - Intronic
1013517654 6:110903049-110903071 ACAGAAGTCTAGGCCAGGCGTGG - Intergenic
1014040364 6:116818242-116818264 AAAGAATTTTCGGCCGGGCGCGG + Intronic
1014127202 6:117790054-117790076 ACCTAATTGTTGGCCGGGCGCGG - Intergenic
1014166395 6:118230049-118230071 ACATAAGTGTCAGCCAGGCATGG + Intronic
1014428075 6:121333774-121333796 ATAGAGGCGGCGGCCGGGCGCGG + Intronic
1014537194 6:122628325-122628347 AAAGAACTGGAGGCCGGGCGCGG - Intronic
1014664451 6:124219566-124219588 CAATAAGTGTTGGCCGGGCGTGG - Intronic
1014715930 6:124864170-124864192 ACATAAGTGCAGGCTGGGCGCGG + Intergenic
1015112724 6:129611190-129611212 ACGGAAGTCAGGGCCGGGCGTGG - Intronic
1015144777 6:129973200-129973222 ACAAAAATTTCGGCCGGGTGCGG - Intergenic
1015371332 6:132456924-132456946 ACAGAAGTGTAGGCGGGCAGAGG + Exonic
1015606699 6:134963710-134963732 ATAGAACTCTCGGCCGGGCGCGG - Exonic
1015958850 6:138626601-138626623 AAAAAATTGTAGGCCGGGCGCGG + Intronic
1015978633 6:138816773-138816795 AAAGATGTTTAGGCCGGGCGCGG - Intronic
1015980112 6:138830012-138830034 ACAGAAATTTAGGCTGGGCGCGG - Intronic
1016744369 6:147562530-147562552 ACCAAAGTGTTGGCCGGGTGTGG + Intronic
1017256380 6:152338329-152338351 ACTCAAGTGTGGGCCAGGCGTGG + Intronic
1017328977 6:153173576-153173598 AGAGCAGTTTAGGCCGGGCGCGG + Intergenic
1017494850 6:154974635-154974657 AGAGAAGTGTTGGCTGGGCACGG + Intronic
1017506271 6:155071612-155071634 AAAGAATTATTGGCCGGGCGCGG + Intronic
1017747108 6:157456855-157456877 ACTGAGTTGTGGGCCGGGCGTGG + Intronic
1017753711 6:157511682-157511704 ATAAAAATGTGGGCCGGGCGCGG - Intronic
1017754199 6:157515753-157515775 AATGAAGGGTGGGCCGGGCGCGG - Intronic
1017879533 6:158550333-158550355 AAACAAGTCTCGGCCGGGCGTGG - Intronic
1017926911 6:158918445-158918467 AAAGAACTGTTGGCCGGGTGCGG - Intergenic
1018450097 6:163899846-163899868 AAAGAAGTCTGGGCCGGGCGTGG + Intergenic
1018730447 6:166646270-166646292 ACAGAAGCGGCGGCTGGGAGAGG + Intronic
1018753596 6:166829299-166829321 AATGAATTATCGGCCGGGCGCGG + Intronic
1019006955 6:168806311-168806333 ACAGAAGTCTCAGCCGGGGGCGG - Intergenic
1019094986 6:169572248-169572270 AAAGAATTCTGGGCCGGGCGTGG + Intronic
1019416417 7:929001-929023 AGAGGAATGCCGGCCGGGCGCGG + Intronic
1019495098 7:1334323-1334345 ACAAAAGGATCGGCTGGGCGTGG - Intergenic
1019496703 7:1343971-1343993 AAAGAGGTGTAGGCCGGGTGCGG + Intergenic
1019699847 7:2469254-2469276 GCAGAGGTTTCGGCCGGGCGCGG + Intergenic
1019787240 7:2984843-2984865 ACAGAAGCCACGGCCGGGCGTGG - Intronic
1019885747 7:3903434-3903456 AAAAAACTGTCGGCCGGGCGCGG - Intronic
1020027927 7:4912266-4912288 AGATAACTGTTGGCCGGGCGCGG + Intronic
1020050751 7:5080083-5080105 AAAAAAATGTGGGCCGGGCGCGG + Intergenic
1020595417 7:10202196-10202218 AGAAAAGTCTCAGCCGGGCGCGG - Intergenic
1020799050 7:12711191-12711213 AGAAAAGTGTCGGCCGGGCCGGG - Intergenic
1020951891 7:14689459-14689481 AGAGAAGTTTCGGCCGGGCGCGG - Intronic
1021012910 7:15493663-15493685 AAAGAAATGTGGGCCGGGCGCGG - Intronic
1021457088 7:20841393-20841415 ACACAACTCTCGGCCAGGCGCGG - Intergenic
1021553424 7:21896017-21896039 TCAAAAGTGTGGGCCAGGCGCGG - Intronic
1021559583 7:21956536-21956558 ACAGAACTCTTGGCCGGGCGCGG - Intergenic
1021877094 7:25059407-25059429 ACAGAAGTGGTGGCCTGGAGAGG - Intergenic
1022342626 7:29483109-29483131 AAAAAAGTGCAGGCCGGGCGCGG - Intronic
1022808608 7:33847436-33847458 AAAAAAGTGTTGGCCGGGCATGG + Intergenic
1022860392 7:34361145-34361167 ACATAAGTTTTGGCTGGGCGCGG + Intergenic
1023822805 7:43989292-43989314 AGAGAAGTGGAGGCCGGGCGCGG + Intergenic
1023975115 7:45023215-45023237 AAAGAAGTCTGGGCCGGGCATGG - Intronic
1024813666 7:53242997-53243019 ACAAAAGTGGAGGCCGGGCGCGG - Intergenic
1025145706 7:56500821-56500843 ATTGAAGTATCGGCCGGGCGCGG - Intergenic
1025193790 7:56916952-56916974 ACAGGAGTGTAGGCCGGGCGTGG + Intergenic
1025678155 7:63659990-63660012 ACAGGAGTGTAGGCCAGGCGTGG - Intergenic
1025702363 7:63831939-63831961 ACAAAATTAGCGGCCGGGCGCGG + Intergenic
1025778766 7:64581073-64581095 ATATAACTGTCGGCCGGGTGCGG + Intergenic
1025977825 7:66383239-66383261 ACAGAATAATAGGCCGGGCGCGG - Intronic
1026007030 7:66608060-66608082 AGCGAACTGTGGGCCGGGCGCGG + Intergenic
1026017162 7:66680654-66680676 ACAGAAATTAGGGCCGGGCGCGG + Intronic
1026695716 7:72589584-72589606 AAACAAGTATCGGCCGGGCATGG + Intronic
1026819035 7:73534411-73534433 ACAAAAATGTAGGCCGGGCGTGG - Intergenic
1026850708 7:73721575-73721597 ACAGAAGTGACAGCTGGGGGTGG - Intergenic
1026905630 7:74061224-74061246 AAGGCAGTTTCGGCCGGGCGTGG + Intronic
1027024924 7:74844299-74844321 AAAGAATTTTCGGCCAGGCGTGG - Intronic
1027062840 7:75099820-75099842 AAAGAATTTTCGGCCAGGCGTGG + Intronic
1027148995 7:75719212-75719234 AGAGAAGACTAGGCCGGGCGTGG + Intronic
1027374279 7:77535645-77535667 AAATAGGTGTAGGCCGGGCGCGG - Intergenic
1027490758 7:78823291-78823313 ACGACACTGTCGGCCGGGCGCGG + Intronic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1027656739 7:80940083-80940105 CTAGAAATGTTGGCCGGGCGCGG - Intergenic
1027919623 7:84376310-84376332 TAAGAAGTGTTGGCCGGGCGCGG + Intronic
1027925359 7:84453524-84453546 AACAAAGTCTCGGCCGGGCGCGG - Intronic
1028169500 7:87578981-87579003 AAAGTAATCTCGGCCGGGCGCGG - Intronic
1028522686 7:91749087-91749109 TAAGAATTCTCGGCCGGGCGCGG - Intronic
1028852110 7:95549585-95549607 AATGGAGTCTCGGCCGGGCGCGG - Intergenic
1029060438 7:97792175-97792197 ACAGAAGTGCGGGCTGGGTGCGG - Intergenic
1029751069 7:102542707-102542729 AGAGAAGTGGAGGCCGGGCGCGG + Intronic
1029769022 7:102641818-102641840 AGAGAAGTGGAGGCCGGGCGCGG + Intronic
1029995695 7:105005934-105005956 ACAGAACTTTTGGCCGGGCGCGG + Intergenic
1030042040 7:105460226-105460248 AAAGAATTGTCGGCTGGGCACGG - Intronic
1030079493 7:105765042-105765064 AAATAAGTCTAGGCCGGGCGTGG + Intronic
1030086660 7:105821327-105821349 ACAGAGGTTTCAGCCAGGCGTGG - Intronic
1030234465 7:107243221-107243243 AAAGAAGTCTCGGCCTGGGGCGG + Intronic
1030301724 7:107981019-107981041 ATAAGAATGTCGGCCGGGCGTGG + Intronic
1030338097 7:108347324-108347346 ACAGAAATATAAGCCGGGCGCGG - Intronic
1030507382 7:110442049-110442071 AAAGAACTGCTGGCCGGGCGCGG - Intergenic
1030838114 7:114313453-114313475 AAAATATTGTCGGCCGGGCGCGG + Intronic
1031042941 7:116857693-116857715 AAAGAAGTGTTGGCTGGGCGTGG + Intronic
1031294116 7:119981351-119981373 AAAGAAATGGAGGCCGGGCGCGG + Intergenic
1031525852 7:122820847-122820869 ACAGTAAGGTCGGCCGGGCGCGG - Intronic
1031571558 7:123365732-123365754 GCATGAGTTTCGGCCGGGCGCGG - Intergenic
1031602742 7:123732035-123732057 ACAGAAAAGGCGGCCAGGCGCGG + Intronic
1032066712 7:128776696-128776718 ATAGATGAGTTGGCCGGGCGTGG + Intergenic
1032135271 7:129271070-129271092 AAAAAAGTTTGGGCCGGGCGTGG + Intronic
1033052617 7:138020149-138020171 TCAAAAATGTCGGCCGGGCGTGG - Intronic
1033148885 7:138895972-138895994 AGAGAAGTGGGGGCCGGGTGGGG - Intronic
1033181141 7:139180045-139180067 ATAGAACTTTAGGCCGGGCGCGG + Intronic
1033274517 7:139961242-139961264 ACAGAAGTGAGGGCAAGGCGAGG - Intronic
1033286021 7:140041056-140041078 ATACAAGTTTAGGCCGGGCGTGG - Intronic
1033310311 7:140256460-140256482 ACAGAAATTGGGGCCGGGCGTGG - Intergenic
1033413165 7:141138690-141138712 ATAAAAGTGGTGGCCGGGCGGGG + Intronic
1033718476 7:144029410-144029432 AAAGAAGGTTCGGCCGGGCGCGG + Intergenic
1033720776 7:144057102-144057124 TAAGAAGAGTTGGCCGGGCGCGG - Intergenic
1033821390 7:145138800-145138822 AAAGATGTGTGGGCCGGGCACGG + Intergenic
1034187399 7:149189260-149189282 AACCAAGTGTTGGCCGGGCGCGG - Intergenic
1034486662 7:151369296-151369318 AGACAAGTTTCGGCCAGGCGCGG - Intronic
1034612582 7:152385320-152385342 TGAGACGTGTTGGCCGGGCGCGG + Intronic
1034624108 7:152479269-152479291 AAAGAAGTCTTGGCCGGGAGTGG - Intergenic
1034838587 7:154374900-154374922 ACTATAATGTCGGCCGGGCGCGG - Intronic
1034896453 7:154879288-154879310 ACACAAAAATCGGCCGGGCGCGG + Intronic
1035161766 7:156955898-156955920 ACATATTTGCCGGCCGGGCGCGG + Intronic
1035202180 7:157274751-157274773 AAAGAAGTGTGGGCCAGGCGCGG + Intergenic
1035204044 7:157283047-157283069 ACAGATCTGGAGGCCGGGCGCGG + Intergenic
1035385937 7:158472859-158472881 GCAGCAGTGGCGGCGGGGCGGGG + Intronic
1035738661 8:1908520-1908542 ATCAAAGTGTGGGCCGGGCGCGG - Intronic
1036118293 8:5985830-5985852 ACACAACTGAGGGCCGGGCGCGG + Intergenic
1036167287 8:6447837-6447859 ACAAAATTGTTGGCCGGGCGCGG - Intronic
1036465406 8:8992755-8992777 AAAGAATAGTCAGCCGGGCGTGG + Intergenic
1036954387 8:13171676-13171698 AAGGAAGTGTGGGCCGGCCGTGG - Intronic
1037008467 8:13810146-13810168 AAGAAAGTGTAGGCCGGGCGCGG - Intergenic
1037109385 8:15147566-15147588 ACGGAAGTGTCAGCCGGGTACGG - Intronic
1037170412 8:15885495-15885517 AATTAAGAGTCGGCCGGGCGCGG + Intergenic
1037382416 8:18300431-18300453 AAAGAAATCTCGGCCGGGTGTGG - Intergenic
1037964732 8:23125268-23125290 AAACAAGAGCCGGCCGGGCGCGG - Intergenic
1038010166 8:23469292-23469314 GCAGATGTGTTGGCCGGGCATGG - Intergenic
1038138067 8:24812426-24812448 ATAAAAGTGCTGGCCGGGCGTGG + Intergenic
1038485278 8:27930690-27930712 AAAGAAGTTTAGGCTGGGCGCGG - Intronic
1038533540 8:28337879-28337901 ATGGAAGTGTAGGCCGGGTGCGG - Intronic
1038544215 8:28412840-28412862 ACAGTGGGGTTGGCCGGGCGCGG - Intronic
1039052638 8:33508849-33508871 ACTCAACTGTAGGCCGGGCGGGG + Intronic
1039054222 8:33521922-33521944 TTAGAAGTATTGGCCGGGCGTGG + Intergenic
1040009397 8:42648712-42648734 ACAGGAGACTGGGCCGGGCGCGG + Intergenic
1040393423 8:46970680-46970702 ATAGAAATATTGGCCGGGCGCGG + Intergenic
1040779260 8:51088469-51088491 ACATCAGTGTCGGCCGGGTGCGG + Intergenic
1041545672 8:59040037-59040059 TAAGAAGCATCGGCCGGGCGCGG + Intronic
1041649988 8:60292733-60292755 AGGACAGTGTCGGCCGGGCGCGG - Intergenic
1041912069 8:63099517-63099539 ACAAAAATGAGGGCCGGGCGTGG + Intergenic
1042153352 8:65814219-65814241 AAAGGACTTTCGGCCGGGCGCGG + Intronic
1042245245 8:66703557-66703579 ATAAGAGTGTCGGCCGGGCGCGG + Intronic
1043215794 8:77585898-77585920 ACACTAATGTTGGCCGGGCGCGG + Intergenic
1043418110 8:80072018-80072040 TAAGAAATGTAGGCCGGGCGCGG + Intronic
1043786982 8:84415526-84415548 ACAAGAGTGTCGGCCGGGCGCGG - Intronic
1044376803 8:91484197-91484219 ACAGCTATGTTGGCCGGGCGTGG - Intergenic
1044778395 8:95718271-95718293 AGAGAACATTCGGCCGGGCGCGG + Intergenic
1045113464 8:98955485-98955507 AAAGTATTGGCGGCCGGGCGCGG + Intergenic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1046013498 8:108577917-108577939 AGAATATTGTCGGCCGGGCGTGG - Intergenic
1046374671 8:113360861-113360883 ACTGAAGTCACGGCCGGGCGCGG - Intronic
1046813562 8:118558845-118558867 AGCTCAGTGTCGGCCGGGCGCGG - Intronic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1047593247 8:126349646-126349668 AAAGAATAGTCGGCCAGGCGCGG + Intergenic
1048083784 8:131156339-131156361 AAAGAAGGGAAGGCCGGGCGCGG - Intergenic
1048559531 8:135518462-135518484 AAAGTAGTTTAGGCCGGGCGTGG - Intronic
1048595072 8:135857972-135857994 TAAGAAGTCTCAGCCGGGCGCGG - Intergenic
1048627543 8:136202257-136202279 AAAAAATTGTCAGCCGGGCGTGG + Intergenic
1050374482 9:4956797-4956819 AGAGAATTTGCGGCCGGGCGCGG + Intergenic
1050514004 9:6423653-6423675 AGAAAAGTCTCGGCCGGGCGTGG + Intronic
1050527805 9:6561356-6561378 ATTGTAGTGTTGGCCGGGCGAGG + Intronic
1050562399 9:6847678-6847700 AGAGAAGATCCGGCCGGGCGCGG - Intronic
1050604909 9:7290776-7290798 AAAAAAATGACGGCCGGGCGCGG + Intergenic
1050737696 9:8782884-8782906 AAAGAAGTGTAGGCCAGGCGTGG - Intronic
1050864574 9:10482079-10482101 AAACAAATGTTGGCCGGGCGCGG + Intronic
1051047935 9:12897996-12898018 ATAAAAGTTTGGGCCGGGCGCGG + Intergenic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051271173 9:15356295-15356317 AAAGAATTGTGGGCTGGGCGCGG - Intergenic
1051385772 9:16507042-16507064 AGAGAAGTGTAGGCTGGGCTTGG - Intronic
1051823889 9:21197678-21197700 AATGAAATGTCGGCCGGGCGCGG + Intergenic
1051875660 9:21790630-21790652 TTAAAAGTGTCGGCCGGGCACGG - Intergenic
1052959165 9:34279992-34280014 AGAACAGTGCCGGCCGGGCGCGG + Intronic
1052967780 9:34353962-34353984 AGTGAAGTGTAGGCCCGGCGCGG + Intergenic
1053027025 9:34738634-34738656 AAAGAAGTCTAGGCAGGGCGTGG - Intergenic
1053088581 9:35251252-35251274 ATGGAAGAGTAGGCCGGGCGCGG - Intronic
1053162749 9:35824969-35824991 ACAGAAGGGTCGGCTGGGCGCGG - Intronic
1053206530 9:36190973-36190995 ACAGCGGTGGCTGCCGGGCGTGG + Exonic
1053837238 9:42152721-42152743 ACTAAAGTGCAGGCCGGGCGCGG + Intergenic
1053844130 9:42219144-42219166 ACACAAATTTAGGCCGGGCGTGG + Intergenic
1053874915 9:42534562-42534584 AATGCAGTGTCTGCCGGGCGCGG + Intergenic
1054585149 9:66957007-66957029 ACACAAATTTAGGCCGGGCGTGG - Intergenic
1054788547 9:69233480-69233502 ACAGAACTATGGGCCAGGCGTGG + Intronic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1055422609 9:76160109-76160131 ACTGAAGAGTCAGCTGGGCGCGG - Intronic
1056113657 9:83421228-83421250 AAAGATGGCTCGGCCGGGCGCGG - Intronic
1056157294 9:83851124-83851146 ATGAAAGTGTCGGCTGGGCGTGG - Intronic
1056305500 9:85286786-85286808 AAAGACATGTAGGCCGGGCGCGG - Intergenic
1056357763 9:85820011-85820033 ACATAAAAGTGGGCCGGGCGTGG + Intergenic
1056991262 9:91413539-91413561 ATAGTATTGTTGGCCGGGCGTGG - Intronic
1057062214 9:92015947-92015969 AAAGCAGTGTGGGCCGGGCACGG + Intergenic
1057586493 9:96333304-96333326 ATGGAATTGTAGGCCGGGCGTGG + Intronic
1057630438 9:96715596-96715618 CCAGACGGGGCGGCCGGGCGGGG + Intergenic
1057715403 9:97491220-97491242 ACAGAAATGTGGGCTGGGTGTGG - Intronic
1057727472 9:97578341-97578363 AAAGAAGCTTCGGCCGGGCACGG - Intronic
1057901014 9:98948306-98948328 ACACACTTGTCGGCCGGGCGCGG + Intronic
1058163015 9:101590668-101590690 AAAAGAGTGTTGGCCGGGCGCGG - Intronic
1058339598 9:103878219-103878241 TCAGAATTATTGGCCGGGCGCGG - Intergenic
1058783678 9:108364989-108365011 AAAGAAGTTTAGGCCGGGCGCGG + Intergenic
1058862730 9:109132263-109132285 AAAGTTGTATCGGCCGGGCGCGG - Exonic
1059011463 9:110466466-110466488 AAAGAACTGGCGGCCGGGCACGG + Intronic
1059355027 9:113692120-113692142 ACAGAAATGCAGGCCGGGCGTGG - Intergenic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060447642 9:123706479-123706501 AGAGAAGGGTCGGCTGGGCGCGG + Intronic
1060514247 9:124256067-124256089 TAAGAAGTTTGGGCCGGGCGCGG - Intergenic
1060577151 9:124706804-124706826 ACAAAATTGTTGGCCGGGCGAGG - Intronic
1060624013 9:125093852-125093874 ACGTAGGTGTCGGCCGGGCACGG - Intronic
1060633040 9:125177082-125177104 AGAGAATTCCCGGCCGGGCGCGG + Intronic
1060917613 9:127400446-127400468 ACACACCTATCGGCCGGGCGCGG - Intronic
1061100341 9:128487235-128487257 AGAGAAGTGTGGGCTGGGTGTGG - Intronic
1061478130 9:130882884-130882906 AAAAAACTGTTGGCCGGGCGTGG + Intronic
1061891261 9:133621703-133621725 ACAGAAATCTTGGCCGGGCGCGG - Intergenic
1062075010 9:134583009-134583031 ACAGAAGGATTAGCCGGGCGTGG + Intergenic
1062078128 9:134603223-134603245 AAAGGCATGTCGGCCGGGCGCGG + Intergenic
1062239593 9:135528811-135528833 ACAGAATTCTCGGCTGGACGTGG + Intergenic
1062504170 9:136864911-136864933 GTAGAAATGTTGGCCGGGCGCGG - Intronic
1062545417 9:137061101-137061123 CCAAAAGTCTGGGCCGGGCGTGG + Intergenic
1062752757 9:138268072-138268094 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1203575275 Un_KI270745v1:2847-2869 AAAGAAATGGAGGCCGGGCGTGG - Intergenic
1185552232 X:992382-992404 ATAGAACTGTAGGTCGGGCGCGG - Intergenic
1185644105 X:1604878-1604900 AGAGAAATTTCAGCCGGGCGCGG - Intergenic
1185653484 X:1666155-1666177 ACAGAAGAGGAGGCCGGGAGTGG - Intergenic
1185661306 X:1731034-1731056 AAAAAAGGGTCGGCCGGGTGCGG + Intergenic
1185682209 X:1897961-1897983 ATACAAATGTCAGCCGGGCGTGG + Intergenic
1185906696 X:3940044-3940066 AAATAAGTGTGGGCCGGGCGTGG - Intergenic
1186053883 X:5628408-5628430 AGATAAGTTTTGGCCGGGCGCGG + Intergenic
1186407261 X:9315018-9315040 ATCGCAGTGTTGGCCGGGCGCGG - Intergenic
1186438414 X:9564127-9564149 AAAGATGTTTGGGCCGGGCGTGG + Intronic
1186496021 X:10013931-10013953 AAAGAAGAATGGGCCGGGCGCGG - Intergenic
1186924380 X:14316686-14316708 ACAGAAATTTAGGCTGGGCGTGG + Intergenic
1187115636 X:16347343-16347365 AAGGTAGTGTCGGCCGGGCGTGG - Intergenic
1187150086 X:16673174-16673196 AGAGTAGCCTCGGCCGGGCGCGG - Intronic
1187353163 X:18540975-18540997 AAAGAACTGTCGGCCGGGCGTGG - Intronic
1187537938 X:20160717-20160739 AATGAAATGTTGGCCGGGCGTGG - Intronic
1187612021 X:20953617-20953639 ACAACAGTGAGGGCCGGGCGCGG + Intergenic
1187679491 X:21752805-21752827 ACAGCATAGTAGGCCGGGCGCGG - Intronic
1188089395 X:25944725-25944747 AAAGAAGGCTCGGCCGGGCGCGG + Intergenic
1188395560 X:29678656-29678678 AAAATAGTGTTGGCCGGGCGCGG - Intronic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1188454323 X:30345546-30345568 TAAGAAGTTTAGGCCGGGCGCGG + Intergenic
1188481132 X:30638021-30638043 ATAGAAGTGGAGGCCAGGCGTGG + Intergenic
1189056478 X:37704543-37704565 AAAAAAGTATCAGCCGGGCGTGG + Intronic
1189057184 X:37710503-37710525 ACAGATGTTATGGCCGGGCGTGG + Intronic
1189342900 X:40218101-40218123 ACATAGCTGTCGACCGGGCGTGG - Intergenic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1189440328 X:41030245-41030267 AGAGAAATATAGGCCGGGCGCGG + Intergenic
1189683700 X:43542346-43542368 AAGTAAGAGTCGGCCGGGCGCGG + Intergenic
1189729184 X:44000893-44000915 ACTCAAGTTTCGGCTGGGCGTGG - Intergenic
1189990725 X:46591663-46591685 AAAGAAATCTCGGCCAGGCGCGG - Intronic
1190546153 X:51529860-51529882 AAGGAACTGTAGGCCGGGCGCGG + Intergenic
1190829574 X:54047897-54047919 TCAAAAGTGTTGGCCGGGTGTGG + Intronic
1190989175 X:55527944-55527966 TTAGAAGTATGGGCCGGGCGCGG + Intergenic
1191783631 X:64894494-64894516 ATAGAAATGTCGGCAGAGCGCGG - Intergenic
1192311814 X:70022624-70022646 AAAGAAATGTCGGCCGGGGGTGG - Intronic
1192431431 X:71114799-71114821 AAAGGAGTGGAGGCCGGGCGCGG + Intergenic
1192442606 X:71185779-71185801 AGAGAAATTTTGGCCGGGCGCGG + Intergenic
1192783215 X:74314768-74314790 ACACAATTGTCGGCCGGGCGCGG - Intergenic
1193147731 X:78094622-78094644 AAAGTAATGTTGGCCGGGCGTGG + Intronic
1193426905 X:81350292-81350314 ACTGTAATGTCGGCCGGGCGCGG - Intergenic
1193454714 X:81716388-81716410 ACATAACTGTTGGCCGGGCGCGG - Intergenic
1193591724 X:83396555-83396577 AAAGAAGCTTGGGCCGGGCGCGG + Intergenic
1193857536 X:86623757-86623779 TAAAAAGTGGCGGCCGGGCGCGG + Intronic
1194222728 X:91215299-91215321 TAAGAAGTGTCGGCCGGGCGCGG - Intergenic
1194459303 X:94146916-94146938 TAAGAAGTCTCGGCCAGGCGCGG - Intergenic
1194591335 X:95803634-95803656 AAAGAAATATTGGCCGGGCGTGG - Intergenic
1194978954 X:100420793-100420815 ATTGAAGTGTTGGCCGGGCACGG - Intergenic
1195071938 X:101289882-101289904 TCAGAAGTGTGGGCCTGGCTGGG - Intronic
1195253532 X:103071227-103071249 AGAAAAATGTAGGCCGGGCGTGG - Intergenic
1195375142 X:104219435-104219457 CCAGAAGACTGGGCCGGGCGCGG - Intergenic
1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG + Intronic
1196848617 X:119916789-119916811 ACAGAAGAATGGGCCAGGCGCGG - Intronic
1197226009 X:123957090-123957112 ACAGATGGCTAGGCCGGGCGCGG - Intergenic
1197248416 X:124189958-124189980 ATAAAAATTTCGGCCGGGCGCGG - Intronic
1197326257 X:125097971-125097993 AAGAAAGTGTCGGCCGGGCGCGG + Intergenic
1197747795 X:129944315-129944337 AAAGAAGTCTTGGCTGGGCGCGG - Intergenic
1198185263 X:134248451-134248473 ACAGAATTATAGGCCGGGCATGG - Intergenic
1198213356 X:134535184-134535206 AGATAAGTGGAGGCCGGGCGTGG + Intergenic
1198213882 X:134538931-134538953 AAAGTAATGTCGGCCGGGCACGG + Intergenic
1198304411 X:135366475-135366497 ACAGACCTATAGGCCGGGCGCGG + Intergenic
1198690859 X:139282757-139282779 AAAGAACTGGAGGCCGGGCGCGG - Intergenic
1198777759 X:140198896-140198918 AAAGGAGTGCAGGCCGGGCGTGG - Intergenic
1199288936 X:146084867-146084889 ACATAAATGTCGGCCGGGCGCGG + Intergenic
1199856410 X:151762349-151762371 ACACAGATGCCGGCCGGGCGCGG + Intergenic
1200109109 X:153730210-153730232 ACAGGAATGCAGGCCGGGCGCGG - Intronic
1200299183 X:154955544-154955566 ACCTAAGTGTCGGCCGGTCTGGG + Intronic
1202037912 Y:20654182-20654204 AAAGAAGTGGCGGCCGGGCGCGG + Intergenic
1202232800 Y:22672511-22672533 TCAGAAGTGTCTGCCTGGCCTGG - Intergenic
1202310356 Y:23523647-23523669 TCAGAAGTGTCTGCCTGGCCTGG + Intergenic
1202360981 Y:24110175-24110197 TGAGAAATGTCGGCCGGGCGCGG + Intergenic
1202509797 Y:25559943-25559965 TGAGAAATGTCGGCCGGGCGCGG - Intergenic
1202560446 Y:26146947-26146969 TCAGAAGTGTCTGCCTGGCCTGG - Intergenic