ID: 900265708

View in Genome Browser
Species Human (GRCh38)
Location 1:1756032-1756054
Sequence GGGGTGGCCAGCGCCCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900265708_900265716 9 Left 900265708 1:1756032-1756054 CCCAGGCGGGCGCTGGCCACCCC 0: 1
1: 0
2: 1
3: 17
4: 180
Right 900265716 1:1756064-1756086 CACTGTGTCCACACTGCCCCTGG 0: 1
1: 0
2: 2
3: 44
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900265708 Original CRISPR GGGGTGGCCAGCGCCCGCCT GGG (reversed) Intronic
900265708 1:1756032-1756054 GGGGTGGCCAGCGCCCGCCTGGG - Intronic
900415426 1:2532451-2532473 GTGCTGGCCAGGGCCTGCCTGGG - Intergenic
902538424 1:17135359-17135381 GGGGTGGCTAGCACCCCTCTAGG + Intergenic
903069075 1:20717782-20717804 GGCGGGGCCAGCGCCGGCCACGG + Exonic
906114595 1:43348487-43348509 GGGGTGTCCATCGCCCGACCTGG + Intronic
907278328 1:53328874-53328896 GGGGCGGACAGCGCGGGCCTAGG - Intergenic
912471061 1:109907214-109907236 GGGGTGGACAGCAGCTGCCTTGG - Intergenic
913109165 1:115642221-115642243 CGGGTGGCCGGCTCCCGCCTCGG + Intronic
914750623 1:150532569-150532591 GGGGTTGCCAGCACCCGCCTTGG + Intergenic
918215739 1:182391140-182391162 TGGGCGGCCGGCTCCCGCCTCGG - Intronic
920666034 1:207963618-207963640 CGCTTGGCCAGCGACCGCCTCGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921850527 1:219928471-219928493 GGGGTGGGCTGCGCTCCCCTGGG - Exonic
922749695 1:228064671-228064693 GGTGTGGCCAGCCCCCAACTTGG + Intergenic
923623272 1:235594786-235594808 GAGGGAGCCAGCTCCCGCCTTGG + Intronic
924742237 1:246801340-246801362 GTGGAGGCCAGCGCCAGGCTGGG + Intergenic
1062829830 10:598188-598210 GTGGTGGCCGGTGCCGGCCTTGG - Intronic
1063443139 10:6089351-6089373 GGAGAGACCAGCGCCCGCCGCGG - Exonic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1069830504 10:71279687-71279709 GGGGCAGCCAGAGCCCTCCTGGG - Intronic
1073792609 10:106955350-106955372 GGGGTGGGCAGCTCCAGCATTGG - Intronic
1076785349 10:132746965-132746987 GGGGTGGCCGGCCCCTTCCTGGG + Intronic
1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG + Exonic
1083265062 11:61542789-61542811 TGGGTGGGCAGAGCCGGCCTGGG - Intronic
1083460058 11:62805264-62805286 CGGGTGGGCGGCGCCGGCCTAGG - Intronic
1083682807 11:64359112-64359134 GGCGGTGCCGGCGCCCGCCTCGG + Intergenic
1084454844 11:69262488-69262510 GGGGTGGCCAGAGCTGCCCTCGG - Intergenic
1085042440 11:73334596-73334618 GAGGGGGCCAGAGCCTGCCTCGG - Intronic
1089619486 11:119714171-119714193 GGGGCAGCCAGGGCCTGCCTGGG + Intronic
1096628965 12:52913202-52913224 GGGGTGGGCAGGGCTGGCCTTGG - Intronic
1099014247 12:77325518-77325540 GGGGTGGCCAGCGCGGTCCTGGG + Intergenic
1099989976 12:89710146-89710168 GGAGTGTCCCGCGCCCGCATGGG - Intergenic
1100505755 12:95218185-95218207 GGGGGGGACTGCGCCCGGCTGGG + Intronic
1105026152 12:132850507-132850529 GCAGTGGCCAGCGCCTGCCGTGG + Intronic
1105723870 13:23142104-23142126 GGGGGAGCCAGCTCCGGCCTTGG - Intergenic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1107714145 13:43181832-43181854 GGGCTGGCCAGCTCCAGCCCTGG + Intergenic
1108373234 13:49791925-49791947 CGGGCCGCCACCGCCCGCCTGGG + Intronic
1108621595 13:52190282-52190304 GGGGTGGCCAGGGGAGGCCTGGG + Intergenic
1108665091 13:52621596-52621618 GGGGTGGCCAGGGGAGGCCTGGG - Intergenic
1110621733 13:77603704-77603726 GGGGTGGCCTGTGTCCCCCTGGG + Intronic
1112229009 13:97569059-97569081 GGGGTGGCCAGCCCCAGGCTGGG - Intergenic
1113378991 13:109786278-109786300 GGGGCGGCCACCGCCCGCGCCGG - Exonic
1115651171 14:35403991-35404013 GGTCTGGCCGGCGCCCGCCGGGG - Intronic
1118610012 14:67532916-67532938 GGGGTGGCCAGAGCGCCCCGGGG - Intronic
1121496033 14:94391726-94391748 GGGGTGGCCAGCACTCTCCGGGG - Intergenic
1122264696 14:100541137-100541159 GGCTGAGCCAGCGCCCGCCTGGG - Intronic
1122945648 14:105007535-105007557 GGAGTGGCGATCGCCCGTCTGGG - Intronic
1123089572 14:105736494-105736516 AGTGCGGCCAGCGCCTGCCTCGG - Intergenic
1125535521 15:40439765-40439787 GGTGGTGCCAGAGCCCGCCTAGG - Intronic
1127103354 15:55588602-55588624 CGGGTGGGCAGCGCGCGCCTAGG + Intronic
1130108227 15:80944925-80944947 TGGGTGCCCAGCGCCAGCCCAGG - Intronic
1131059733 15:89397386-89397408 GGGGTGGCAAGTGCACTCCTGGG - Intergenic
1132830050 16:1923581-1923603 GGGGTGGGCAGCCCCAGCCTGGG + Intergenic
1133156876 16:3881465-3881487 GGGGTGGCGAGGGCCGGCCTGGG + Intergenic
1133882783 16:9798494-9798516 GGGGTGGCCAGGTACCACCTCGG + Intronic
1134234590 16:12455401-12455423 GGCTTGGCCAGCACCCGCCGTGG + Intronic
1135323748 16:21513112-21513134 GGTGTGTCCAGCACCCCCCTGGG - Intergenic
1136040744 16:27576891-27576913 GGTGTGGCCAGCGCACTCCCTGG + Intronic
1136335230 16:29606377-29606399 GGGGTGTCCAGCACCCCCCTGGG - Intergenic
1138348109 16:56332250-56332272 AGGGTGGCCAGAGTCCGGCTGGG - Intronic
1141424371 16:83935714-83935736 GGCGTGGGCAGCGCCAGCTTTGG + Intronic
1141935337 16:87234745-87234767 GGGGGGGCCAGCGCCATCCTGGG + Intronic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142376446 16:89709300-89709322 GGGGTAGCCAGTGGCCCCCTTGG + Exonic
1142597497 17:1036631-1036653 GGGGTGCCCAGCGCCCACACAGG + Intronic
1142884906 17:2906423-2906445 GGGGTAGCCAGAGCCTGCCCTGG + Intronic
1143764812 17:9130516-9130538 GGGGTGGCCAGCTGCCTCCTGGG + Intronic
1145018014 17:19411497-19411519 GGGGTGGGAAGGGCCCTCCTTGG + Intronic
1145810349 17:27760566-27760588 CAGGGGGCCAGCGCCTGCCTAGG - Intronic
1146789099 17:35741614-35741636 GGGGTGGCGAGGTGCCGCCTTGG + Exonic
1149996730 17:61409676-61409698 GGGGAGTCCAGCCCCGGCCTGGG - Intergenic
1150292709 17:63990781-63990803 GGGGTGGGCAGCGCCTCCCCAGG - Intergenic
1151368244 17:73630845-73630867 GGGGTTGCCAGCCTCAGCCTGGG - Intronic
1152260133 17:79262326-79262348 GGGGTGGCCAGGACTGGCCTGGG + Intronic
1152362825 17:79840289-79840311 CGGGAGGCCAGGGTCCGCCTGGG + Intergenic
1152515548 17:80821692-80821714 GGGATTGCCAGCGCGCGCCCAGG - Intronic
1152870923 17:82752533-82752555 GGGGTGGCCCTCTCCCGCCTAGG - Intronic
1157306987 18:46524752-46524774 GGGAGAGCCAGCGCCCGCATAGG + Exonic
1157569522 18:48703349-48703371 GGTGTGGCCACCTCCTGCCTGGG + Intronic
1160412803 18:78686348-78686370 GAGGAGGCCAGCGGCCGCCCTGG - Intergenic
1160438217 18:78867388-78867410 GTGGTGGCCTGCTCCTGCCTGGG - Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1160613130 18:80104561-80104583 GGGGAGGCCAGGGCCAGGCTAGG - Intergenic
1160777582 19:863044-863066 GGGGCGGCCCGCGCCCACCCCGG - Intronic
1161209928 19:3061286-3061308 GGGGGGTCCAGCCCACGCCTGGG - Intronic
1163085862 19:14979530-14979552 GGGGCGGCCTGCCCGCGCCTCGG + Intronic
1163551150 19:17967100-17967122 CGGGGGGCGAGCGCCCGCCCGGG - Intronic
1166751931 19:45168379-45168401 TGGGTGGCCAGAGCCCGTCCTGG + Intronic
1166841229 19:45698508-45698530 GGGGTGGCCAGAGCCAGCTCAGG - Intronic
1166843325 19:45712009-45712031 AGGGCGGCCAGCGCGCGCGTGGG + Exonic
1166864925 19:45830036-45830058 GGGGTGGCAGGCGCACACCTGGG + Exonic
1167049958 19:47072157-47072179 GGTGTGGCCACTGCCCTCCTCGG - Intronic
1167456083 19:49597256-49597278 GGGTGGCCCAGCGCCAGCCTTGG - Exonic
1168169418 19:54575921-54575943 GGGATGGCCTGCCCCCTCCTTGG - Exonic
1168572634 19:57483368-57483390 GGGGGGGTCAGCCCCCGCCCCGG + Intergenic
1168679641 19:58305324-58305346 CTGGTGGCCAGCGGCCGCCCAGG - Intronic
925259382 2:2516729-2516751 GGGGTTGCCAGCAGCCTCCTCGG + Intergenic
925897087 2:8480889-8480911 GGGGTGACCAGGGCCCTCCCTGG + Intergenic
931762719 2:65431753-65431775 GGGCTGGCGGGCGCACGCCTAGG - Intronic
933695152 2:85212200-85212222 GGGGTGGCCACAGCCCATCTGGG - Intronic
934522443 2:95027671-95027693 GGGGTGGCCAGCGCCTTCTCAGG - Intronic
937110944 2:119366865-119366887 GGCGTGCCCAGCCCCCGCCGCGG - Intergenic
937859407 2:126696345-126696367 GGGGTGGCCATCGCCTCCCTGGG - Exonic
948871402 2:240800464-240800486 GCGGAGGCCAGCTCCCGTCTTGG - Intronic
1172699332 20:36843278-36843300 GGGGTTGCCAGCGCCCCCTGAGG + Intronic
1173725994 20:45298176-45298198 GGTGTGGGCAGCGCGCGCCAAGG - Exonic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1174467969 20:50731808-50731830 GGGGCGGGCAGCGGCTGCCTGGG + Exonic
1175776738 20:61658606-61658628 GGGGTGGCGAGCCCCTGCCCAGG - Intronic
1175935994 20:62514268-62514290 AGGGTGCCCAGGGCCCGCCGGGG + Intergenic
1176118713 20:63444623-63444645 GGGGCGCCCACCGCCAGCCTTGG + Intronic
1176287100 21:5023948-5023970 CTGGTGGCCAGGGGCCGCCTTGG + Intronic
1176388363 21:6150995-6151017 GGGCTGGCCAGGGCTCGCCCAGG - Intergenic
1176428880 21:6564293-6564315 GGTGTGGGCAGGGCCCGCCGCGG - Intergenic
1178075828 21:29012167-29012189 GGGGTGGTCAGCCCCCCCCCGGG + Intronic
1178583902 21:33857392-33857414 GAGGTGGCCAGGGCCCTTCTGGG - Intronic
1178855395 21:36246187-36246209 GGGCTGGCCACCGCCCACCACGG + Exonic
1179704370 21:43172609-43172631 GGTGTGGGCAGGGCCCGCCGCGG - Exonic
1179735109 21:43387253-43387275 GGGCTGGCCAGGGCTCGCCCAGG + Intergenic
1179870081 21:44239527-44239549 CTGGTGGCCAGGGGCCGCCTTGG - Intronic
1180020808 21:45125389-45125411 GAGGTGGCTGGCTCCCGCCTGGG + Intronic
1180147307 21:45928596-45928618 GGGGTGGCCAGGGCAAGCATGGG + Intronic
1181270271 22:21654436-21654458 GGGGTGGCCACCTCCAGCCATGG - Intronic
1182296480 22:29313473-29313495 AGGGCGGCCAGCGCGCGCCGCGG + Exonic
1182904054 22:33921074-33921096 GGCGGGGCCGGCGCCCGCGTCGG + Intronic
1183829522 22:40410410-40410432 GGGGTGGCCATCTCCTGCCCTGG - Exonic
1184066615 22:42125171-42125193 AGGGTGGCCAGGGCCCCCTTGGG - Intergenic
1184069083 22:42137323-42137345 AGGGTGGCCAGGGCCCCCTTGGG - Intergenic
1184686553 22:46098954-46098976 GGGGAGGCCAGGGGCAGCCTAGG + Intronic
1184759577 22:46537077-46537099 GGGGCTGCGAGCGGCCGCCTGGG - Exonic
1185241199 22:49748692-49748714 CGGGTGCCCAGTGCACGCCTGGG + Intergenic
1185241249 22:49748863-49748885 TGGGTGCCCAGTGCACGCCTGGG + Intergenic
950316342 3:12004728-12004750 GCGGAGGCCGCCGCCCGCCTCGG + Exonic
950444088 3:13026068-13026090 GGGGTGGCCAGCAGCGGCCCTGG + Intronic
950773123 3:15328123-15328145 GGGGTGGCCAGGGCTGGGCTGGG - Intronic
952969821 3:38643777-38643799 GGGGCAGCCAGCACCAGCCTTGG + Intronic
954110193 3:48429283-48429305 GGAGCGGCCGACGCCCGCCTCGG - Exonic
954419814 3:50412891-50412913 GGGGTGCCCAGCACCCCCCCAGG - Intronic
954442946 3:50531612-50531634 GGGATGGGCAGCACCAGCCTTGG - Intergenic
954745708 3:52786454-52786476 GGGGTGGGCAGTGCCCACCTGGG - Intronic
958577521 3:95971866-95971888 GATGTGGCCAGAGCCAGCCTTGG - Intergenic
959537532 3:107503508-107503530 GAGGTGGCCAGCAACTGCCTTGG + Intergenic
968353185 3:198080215-198080237 AGGGTGCCCAGCGCCCTCCAAGG + Intergenic
968478972 4:825706-825728 GCAGTGGACAGCGCCCGCCCCGG + Intronic
968479355 4:826562-826584 GGGGTCGCAGGCGCCCGCCGGGG - Intergenic
968487592 4:871333-871355 GTGAGGGCCAGCGCCTGCCTTGG - Intronic
968487682 4:871714-871736 GGGGTCAGCAGGGCCCGCCTTGG + Intronic
968600836 4:1508597-1508619 AGGGTGGGCAGAGCCCGGCTGGG - Intergenic
969621414 4:8280745-8280767 GGGGTGGCTAGAGCCTGGCTGGG - Intronic
982224510 4:153153490-153153512 AGGGTTGCCAGCGCCGGGCTTGG + Intronic
985388249 4:189467353-189467375 GGGGTTGCCATCGCCTCCCTGGG + Intergenic
985676129 5:1232186-1232208 GGGGTGGTCAGCACCTGCCCAGG - Intronic
985763717 5:1765413-1765435 GGGGTGTGCAGCTCCCACCTGGG - Intergenic
988493679 5:31726672-31726694 AGGGTGGGCAGGGCCGGCCTGGG + Intronic
994097022 5:95856629-95856651 GGGGTGGGCAGTGCTGGCCTGGG + Intronic
999375106 5:151081119-151081141 GGGCGGGCCCGCGGCCGCCTGGG + Intronic
1001409207 5:171498326-171498348 AGGGTGCCCAACGCCAGCCTGGG + Intergenic
1002098761 5:176847085-176847107 TGGGTGCCCCGCTCCCGCCTGGG + Intronic
1003545258 6:7052694-7052716 GAGGCGGCCAGCTCCAGCCTTGG + Intergenic
1007088315 6:39166359-39166381 GGTGTGTCCAGCTCCGGCCTGGG - Intergenic
1007327606 6:41073683-41073705 GGGCTGGCCCGCCCACGCCTCGG + Intronic
1007702107 6:43771518-43771540 TGGGTGGGCAGGGCCCGCGTGGG - Intronic
1007788925 6:44297834-44297856 AGGGTGGCCAGGCCCGGCCTCGG + Intronic
1015864869 6:137717777-137717799 GGGGTGGGCAGTGGCAGCCTTGG + Intergenic
1016864089 6:148748229-148748251 GGGGTGGGCAGCGGCAGCCAAGG - Intronic
1017170441 6:151450451-151450473 GGGGGGGCCAGCCCCCGTCCGGG + Intronic
1017702697 6:157090950-157090972 GGGGTAGCCGCCTCCCGCCTGGG + Intronic
1019056469 6:169227174-169227196 GGGGTGGCTGGCGCCGGGCTGGG + Intronic
1019322101 7:420441-420463 GGGGTGGGCAGCGGCCCCTTGGG - Intergenic
1019709705 7:2512586-2512608 AGGGTGGCCAGGAGCCGCCTTGG - Intronic
1019712380 7:2523616-2523638 GGAGTCGCCGGCGCCCGCCTGGG - Intronic
1019744956 7:2694502-2694524 GGGGCGGCCAAGGCCAGCCTGGG - Intronic
1020130935 7:5558214-5558236 TGGGCGGCCAGAGCCGGCCTGGG + Intronic
1020609981 7:10383737-10383759 GGGCTGGGCAGAGCCCACCTTGG + Intergenic
1024639307 7:51316673-51316695 GCGGTAGCCAGCGCCTGACTCGG - Exonic
1025106236 7:56174364-56174386 GGGGTGGTGAGCCCGCGCCTTGG + Intergenic
1026001056 7:66558923-66558945 GGGTTGGCCAGCGGCAGCCCGGG + Intergenic
1034475155 7:151277282-151277304 GGTCTGGCCAGGGCCCGCCGAGG - Intronic
1034964313 7:155382290-155382312 GCGGTGCCCAGCGCGCGCCAGGG - Exonic
1035169113 7:157008223-157008245 GGGCTGGCCAGCCCCCTCCGTGG + Intronic
1035202681 7:157277275-157277297 GGGGTGGGCAGCGCCTGCGAAGG - Intergenic
1037913591 8:22758803-22758825 GGGGTGGACAGCGCTTTCCTAGG + Intronic
1042701126 8:71616089-71616111 GGGGAGGCCAGTGCCCCTCTTGG - Intergenic
1046031457 8:108787597-108787619 CGGGTGGGCAGCGCCCGCCACGG + Exonic
1049407683 8:142459002-142459024 GGAGTGGCCAGCGCCCACACTGG + Intronic
1053066437 9:35072408-35072430 GCGGTGGCAAGCGACCGACTGGG + Exonic
1053280967 9:36819629-36819651 GGGGTGGCCAGGGCCTGCCCCGG + Intergenic
1053489348 9:38487680-38487702 GTGGTGGTCAGCCCCCGTCTGGG + Intergenic
1057314412 9:93959298-93959320 GGGGCGGCCCGGGGCCGCCTGGG - Intergenic
1058144750 9:101399019-101399041 GGTCTGGCCAGTGCCTGCCTCGG - Exonic
1059380145 9:113917027-113917049 GGGGTGGCCAGCTCCCACCAAGG + Intronic
1060742875 9:126111117-126111139 GGGGTGGCCAGAGCTCTCCTGGG + Intergenic
1062378384 9:136275214-136275236 GGGGTGGCCAGTGCCCCGCCAGG + Intergenic
1062401351 9:136374063-136374085 GGCATGGCCAGCACACGCCTTGG + Intergenic
1062565788 9:137163432-137163454 GGAGTGGGCAGCGCCCGGCCTGG - Intronic
1188938032 X:36201462-36201484 CGTGTGGCCATCGCCCTCCTGGG + Intergenic
1191129676 X:56994885-56994907 GCCGTGGCCAGCGCCCGTCCTGG + Exonic
1200094208 X:153649725-153649747 GGGGAGGCCAGAGCAGGCCTTGG - Intronic