ID: 900266066

View in Genome Browser
Species Human (GRCh38)
Location 1:1757810-1757832
Sequence CTGTGTGCAGGGGGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 519}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900266066_900266074 1 Left 900266066 1:1757810-1757832 CCCGCTTCCCCCCCTGCACACAG 0: 1
1: 1
2: 4
3: 31
4: 519
Right 900266074 1:1757834-1757856 TCACTACCTCCCTGCATGAACGG 0: 1
1: 0
2: 2
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900266066 Original CRISPR CTGTGTGCAGGGGGGGAAGC GGG (reversed) Intronic
900188429 1:1343461-1343483 CTGAGTGCAGGGGTGGGTGCAGG - Intronic
900211748 1:1459649-1459671 CTGTGTGTCGGGGCGGAACCTGG + Intronic
900224557 1:1526949-1526971 CTGTGTGTCGGGGCGGAACCTGG + Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900371520 1:2334227-2334249 CTGGGTGGTGGGGGGGCAGCAGG + Intronic
900973238 1:6002928-6002950 ATGTGTGGAGGGGACGAAGCAGG - Intronic
902625791 1:17675563-17675585 GTGTGTGCAGGTGTGGATGCAGG + Intronic
902625817 1:17675716-17675738 CTGTGTGCAGGTGTGGGTGCAGG + Intronic
903279716 1:22243679-22243701 CTGCCTGCAGGGAGGGACGCTGG + Intergenic
904565347 1:31425275-31425297 CTGAGTGCAGGCAGGGAAACTGG - Intronic
904625296 1:31798918-31798940 ATGTGTGGAGGGGAGGAAGCCGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906109308 1:43312562-43312584 ACGTGTGCAGGGGGCGAGGCCGG - Exonic
906190240 1:43894248-43894270 CTGGGTGGAGGGGGGTATGCCGG + Intronic
906319029 1:44805421-44805443 CAGGGTGCTGGGGAGGAAGCTGG + Intronic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
910101805 1:83585149-83585171 CTGAGTGCAGGTGGGAGAGCAGG + Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
912233411 1:107821975-107821997 TTGCATGCAGGGGAGGAAGCCGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912745142 1:112239743-112239765 CTGTGTGCAGGGTGGACCGCAGG + Intergenic
912748657 1:112267414-112267436 CTGTCTGCAGAGGGTGAACCTGG + Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
914912744 1:151800656-151800678 GTGTGTGGAGGGGGTGAAGCAGG + Exonic
915117026 1:153607686-153607708 CTGTGTCCTGGGGAGGAAGCAGG + Exonic
915302551 1:154959666-154959688 CCGTGTGCAGGGGGGCATGGCGG - Exonic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915722160 1:157993539-157993561 GTGTGTGCAGGGGCGGGCGCGGG + Intronic
917360513 1:174170338-174170360 CAGTTTGCAGGTGAGGAAGCAGG + Intronic
917967062 1:180185543-180185565 CTGGGGGCAGGAGGGGAAGCAGG - Intronic
919925520 1:202189952-202189974 CTATGTGGAGGGGAGGAAGGAGG - Intergenic
919980891 1:202642547-202642569 CTCTGTGCATTGGAGGAAGCAGG - Intronic
920304113 1:205007947-205007969 CTGGGAGCAGGAGTGGAAGCAGG + Intronic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
920571522 1:207021716-207021738 GTGTGTGGAGGGGGGGCCGCTGG - Exonic
922507214 1:226133521-226133543 CTGTGTGCAGAGGGGGTCCCTGG + Intergenic
922732119 1:227954104-227954126 GTGTGTGCCGGCGGGGATGCAGG - Intergenic
923190271 1:231613597-231613619 CCTTGTGCAGGAGGGGCAGCTGG + Intronic
923287394 1:232509616-232509638 CTGTGTCCAGTGGCTGAAGCGGG + Intronic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
923693027 1:236214977-236214999 GAGTGTGCAGTGGAGGAAGCTGG + Intronic
1063178569 10:3574128-3574150 CTATGTGCAGAGGAGGACGCAGG + Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1067148817 10:43712861-43712883 CTGTGTGCAAGGTGGGATCCTGG - Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1068182690 10:53543010-53543032 GTGTGTGTAGGGGGAAAAGCTGG - Intergenic
1068906886 10:62336659-62336681 CCTTATGCAGGGGAGGAAGCTGG + Intergenic
1069735420 10:70650785-70650807 CTGAGTGCATGTGGTGAAGCCGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072418358 10:95268551-95268573 CTGTGTCCTGGGCTGGAAGCAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073192695 10:101663049-101663071 CTGTGTGCTGAGGGACAAGCAGG - Intronic
1073243054 10:102070707-102070729 CTGGGTGAAGGCGAGGAAGCAGG + Intergenic
1073288604 10:102402558-102402580 ATGTGGGCAGGGTGGGTAGCTGG - Intergenic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073484177 10:103806203-103806225 CTCTGTCCAGGGGGGTAGGCTGG - Intronic
1073972427 10:109060169-109060191 CTGTGTGCAGGCTGGGTAGTAGG + Intergenic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1075776933 10:124995220-124995242 CTGTGTTCTGGGCGGGAGGCAGG + Intronic
1075968254 10:126631375-126631397 CTGTCTCCAGGAGAGGAAGCAGG - Intronic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076235518 10:128861175-128861197 TTGTGTGCAGGTGAGGAAGTGGG - Intergenic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076692433 10:132230656-132230678 CTTGCTGCTGGGGGGGAAGCTGG + Intronic
1076734900 10:132454421-132454443 TTGTGTGCCGTGGGGGAAGGGGG - Intergenic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077092916 11:787766-787788 CTGAGTGCAGGTGGGGGTGCCGG - Exonic
1077304543 11:1863227-1863249 CTGTGAGCAGACGGGCAAGCGGG - Intronic
1077328135 11:1972437-1972459 CAGTGTGCAGGAGGGGAACATGG - Intronic
1077372739 11:2191132-2191154 CAGTGTGCAGGGGGCAGAGCCGG + Intergenic
1077415820 11:2423837-2423859 CTGTGGGCAGGGGCGGAGCCAGG - Intergenic
1077540120 11:3142737-3142759 TCGTGTGCAGGGGTGGAGGCTGG + Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078086089 11:8233720-8233742 GTGTCTGCAGGGGGGCAGGCTGG - Intronic
1079084056 11:17432763-17432785 CTGTGTGCGGGTGGGGTAGCTGG + Intronic
1079242162 11:18728822-18728844 CTGACTGAAGGGGAGGAAGCGGG + Exonic
1079339630 11:19601387-19601409 CTGAGTCCAGGAGGGGAGGCCGG - Intronic
1079371232 11:19854610-19854632 ATGTGTGCAGGGGGATAGGCAGG - Intronic
1080857183 11:36122318-36122340 CTCAGTGCAGGGGGAGAAGTGGG + Intronic
1081581050 11:44352242-44352264 CTTTGTGGAGGGAGTGAAGCTGG + Intergenic
1081690582 11:45075108-45075130 CTGGGCTCAGGGGGGGCAGCGGG + Intergenic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1083211949 11:61193765-61193787 CTGGGTGCTGGGGGGCAAGGCGG + Intergenic
1083677579 11:64335147-64335169 CTGTGGGGAGGAGGGGAGGCTGG - Intergenic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084010423 11:66345305-66345327 CGGCGTGCAAGGGGAGAAGCCGG + Intergenic
1084172616 11:67407876-67407898 CTGTGCGGAGGGCAGGAAGCCGG - Intronic
1084695873 11:70755426-70755448 CTGTGTGCAGGGGTGCACTCCGG + Intronic
1084736506 11:71108819-71108841 CTGTGAGCAGCAGGAGAAGCCGG - Intronic
1084756366 11:71241395-71241417 CTGTGTGGGGCAGGGGAAGCGGG - Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085456618 11:76669085-76669107 CTGTCTGCAGGGTAGGCAGCTGG + Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089110055 11:116048441-116048463 CTGTATGCAATGGGGTAAGCTGG - Intergenic
1089345205 11:117786607-117786629 CTGTCTGCAGTGGGAGGAGCTGG + Intronic
1089470281 11:118715193-118715215 CTGTGTGCAGGGGCAGATGTGGG - Intergenic
1089759966 11:120716008-120716030 ATGTGGGCAGTGGGGGAAGGCGG + Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1090074984 11:123574767-123574789 CTGTGACCAGGGCCGGAAGCAGG + Intronic
1090800826 11:130170577-130170599 CTGTGTGCTGGAGGGCAGGCAGG + Intronic
1202811114 11_KI270721v1_random:27617-27639 CAGTGTGCAGGAGGGGAACATGG - Intergenic
1091764727 12:3111887-3111909 CTGAGTGCAGTGGCTGAAGCCGG - Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092263187 12:6963170-6963192 CTGTGCGCAGGGTGGCAGGCGGG + Intergenic
1096616141 12:52834524-52834546 CTGGGGGCAGGGGGAGAAGGTGG - Intergenic
1100412919 12:94340310-94340332 CTGTGTGGAGTGGGTGAAGGAGG - Intronic
1100854627 12:98748253-98748275 CAGTTTGCAGGGTGGGGAGCGGG + Intronic
1100865479 12:98852647-98852669 CTGTTTACAGGTGGGGAAACTGG + Intronic
1101252667 12:102951051-102951073 TTGTGCGTGGGGGGGGAAGCAGG + Intronic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1101686681 12:107030767-107030789 CTGTGTGGGGGTGGGGAAGGGGG + Intronic
1102036147 12:109771533-109771555 CTGTGTCCAGGGCGGGACCCAGG + Intergenic
1102073536 12:110041820-110041842 CTGAGTGCAGGGCAGGATGCAGG + Exonic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104574801 12:129957312-129957334 CTGTGTGTAGGGGATGTAGCTGG + Intergenic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1105518927 13:21114246-21114268 CTGTGTGCAGGCGATGGAGCTGG + Intergenic
1105849877 13:24323792-24323814 CTGAGTGCAGGTGGGGGTGCCGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107400434 13:40063860-40063882 CTGTGTGGAGTGGGAGGAGCAGG + Intergenic
1108495932 13:51025476-51025498 CTCTGTGCAAGGGTGGAGGCGGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110351260 13:74510290-74510312 CTGCCTGGTGGGGGGGAAGCAGG + Intergenic
1111981949 13:95025499-95025521 GTGTGTGGTGGGGGGGATGCAGG - Intronic
1112146435 13:96705546-96705568 CTGAGTGCAAGGGAGGAAGAGGG - Intronic
1113200886 13:107866956-107866978 CTGGGTGCAGGGGGCGATGGTGG + Intergenic
1113201942 13:107875621-107875643 ATGTGTGCCGGTGGGGCAGCAGG - Intergenic
1113383220 13:109823216-109823238 CTGTGTGGGGTGGGGGAAGTGGG - Intergenic
1113654322 13:112058436-112058458 CTAGGTGCAGGGGAGGAGGCCGG - Intergenic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1113813926 13:113158962-113158984 CTGTGTGCAGGGGATTCAGCCGG + Intronic
1113874131 13:113584238-113584260 GTGTGTGCACGTGGGGGAGCAGG - Intergenic
1113874139 13:113584280-113584302 GTGTGTGCACGTGGGGGAGCGGG - Intergenic
1113874146 13:113584308-113584330 GTGTGTGCATGTGGGGGAGCGGG - Intergenic
1113887683 13:113669588-113669610 CTGTGTGCAGTGGGCGTGGCCGG + Intronic
1113902336 13:113804067-113804089 CTGTGTGAAGGTGGGGAGGGAGG + Intronic
1114083489 14:19220435-19220457 CTGTGGGCTGGGGGAGCAGCTGG + Intergenic
1114658726 14:24331473-24331495 CTGTGTGCAGCGGGAGGACCTGG - Intronic
1117736966 14:58777528-58777550 CCCTGGGCAGGGGTGGAAGCGGG - Intergenic
1118276239 14:64388270-64388292 GCGTCTGCAGGGGGAGAAGCGGG + Intronic
1118807472 14:69250574-69250596 CTGTGTGCAGCTGGGGAGGCAGG + Intergenic
1121035618 14:90700977-90700999 GTATGTACAGAGGGGGAAGCTGG - Intronic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1122122056 14:99560036-99560058 CTGTGTGCAGGGGGTGAGTGGGG - Intronic
1122126299 14:99580356-99580378 GTGAGTGCAGTGGGGGAGGCAGG + Intronic
1122262508 14:100531360-100531382 CTGTCTGTGGGTGGGGAAGCTGG + Intergenic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122549123 14:102540351-102540373 GTGTGTGAAGGGGAGGAATCGGG + Intergenic
1122649378 14:103217361-103217383 TTGTGTGCAGGGGGAATAGCTGG - Intergenic
1122795881 14:104205980-104206002 GTGTGTGCAGGGCTGGGAGCTGG + Intergenic
1123404114 15:20010254-20010276 CTGTGTGCAGGTGGGGAGTGGGG + Intergenic
1123513452 15:21016900-21016922 CTGTGTGCAGGTGGGGAGTGGGG + Intergenic
1124001546 15:25764559-25764581 CTGTCTGCAGGCCGGGAAGAGGG + Intronic
1124400731 15:29345502-29345524 CTGTGTGCAGGGGGCCAGGTGGG - Intronic
1124496592 15:30191292-30191314 CTCTGTGCATTGGAGGAAGCAGG - Intergenic
1124746985 15:32347356-32347378 CTCTGTGCATTGGAGGAAGCAGG + Intergenic
1125600041 15:40910516-40910538 CAGGGTGCAGTGGGGGATGCTGG - Intergenic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1125933603 15:43616691-43616713 CTGGGTGCAGAGGGAGGAGCAGG + Intronic
1125946701 15:43716153-43716175 CTGGGTGCAGAGGGAGGAGCAGG + Intergenic
1127629713 15:60815588-60815610 CTGGCTGCAGTGGGGGAAGCTGG - Intronic
1127800456 15:62472891-62472913 CTGTGTGCAGCTGAGGAAGGGGG + Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1130270305 15:82442705-82442727 CTGTGTGGAGCTGGGGCAGCGGG + Intergenic
1130275663 15:82475124-82475146 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130460782 15:84157145-84157167 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic
1130462648 15:84170026-84170048 CTGTGTGGAGCTGGGGCAGCGGG + Intergenic
1130468022 15:84202516-84202538 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130490030 15:84424767-84424789 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130496244 15:84471026-84471048 CTGTGTGGAGCTGGGGCAGCGGG + Intergenic
1130501616 15:84503517-84503539 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1130539390 15:84811278-84811300 CTGTGTGGAGGAGAGGAAACGGG - Intergenic
1130590314 15:85207114-85207136 CTGTGTGGAGCTGGGGCAGCGGG - Intergenic
1131109559 15:89756481-89756503 CTGTGTGCCGGGGTGGGAGTGGG + Intergenic
1131397308 15:92096989-92097011 TTGGGTGCAGTGGTGGAAGCTGG - Intronic
1132537718 16:491398-491420 CAGCGTGCAGGGTGGGAGGCGGG - Intronic
1133718478 16:8471781-8471803 CTGTGTGGAGGGGGTGATGGAGG - Intergenic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134335227 16:13293025-13293047 CAGTTTGCAGGGGGGAAACCTGG - Intergenic
1134441375 16:14301624-14301646 GTTTGTGCGGCGGGGGAAGCGGG + Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140415572 16:74771778-74771800 CTGTGACCATGGGGGGAAGGGGG - Intronic
1140802378 16:78500212-78500234 CTTTGTGCAGTGGGGAAAGGTGG + Intronic
1141610966 16:85181104-85181126 CTGTGGGCAGCTGCGGAAGCTGG - Intronic
1141779101 16:86146155-86146177 GTGTGTGTAGGGGGGGGTGCGGG + Intergenic
1142307711 16:89294859-89294881 CTGTGTGGAGGGCAGGGAGCAGG - Intronic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1142879216 17:2871383-2871405 CTATGTGCAGGGGTGGGAGCGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143718859 17:8796454-8796476 ATGTGTGTTGGGGGGGAAGTGGG - Intergenic
1144235205 17:13254038-13254060 CTGTGAGAAGGGGCGGATGCAGG + Intergenic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1145799296 17:27672919-27672941 CTGGGTGCAGTGGTGGAAGGGGG - Intergenic
1146602372 17:34229017-34229039 CTTGGTGGACGGGGGGAAGCCGG - Intergenic
1146838042 17:36127869-36127891 GTATGTGCAGGGTGGGAAGATGG + Intergenic
1147256418 17:39184859-39184881 CTCTGTCTGGGGGGGGAAGCAGG + Exonic
1147327038 17:39674582-39674604 CCCTGTGCAGGAGGGGGAGCTGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147422671 17:40330474-40330496 ACGTGTGCTGGGGGGGAAGAGGG - Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147556767 17:41484618-41484640 CTTTGGGCAGGGGGGGCAGTTGG - Intergenic
1148213930 17:45824369-45824391 TTGAGTGCAGGGCGTGAAGCTGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1149579242 17:57736904-57736926 CTGTGTGCAAGAGGTGAAGGAGG - Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150386003 17:64760877-64760899 CTATGTGCACTGGGGGAACCGGG + Intergenic
1151337788 17:73450261-73450283 CTCTGTGCAGGGGTGGAAGCAGG + Intronic
1151813641 17:76460063-76460085 CTGGATGCAGAGGGGGAAGGGGG - Intronic
1152039268 17:77892484-77892506 GTGGGTGCAGGGTGGGGAGCAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152342551 17:79733383-79733405 CTGTGTGCTGGGTGGGGAGTGGG - Intronic
1152390477 17:80001220-80001242 CTGGGTGCAGGCGGAGCAGCTGG + Intronic
1152657389 17:81526293-81526315 CCGTGAGCGGTGGGGGAAGCCGG - Intergenic
1152945209 17:83194334-83194356 TTGTGTGGAGGTGGGGAGGCAGG - Intergenic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153550757 18:6259062-6259084 CAGAGTGCCCGGGGGGAAGCAGG + Intronic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1159941996 18:74415309-74415331 CTATGGGCAGAGGGGGCAGCTGG + Intergenic
1160013624 18:75125082-75125104 CTGAGTGCAGAGGGGAAAGCTGG - Intergenic
1160443999 18:78913367-78913389 CTGTGAGCAGGGGTGGGAGTGGG - Intergenic
1160517424 18:79486392-79486414 CTGCGGACAGGGCGGGAAGCCGG - Exonic
1161117113 19:2503866-2503888 CTGTGTGCAGGGGGGAGCTCAGG - Intergenic
1161376744 19:3943144-3943166 CTCCGTGCTGGAGGGGAAGCAGG + Intergenic
1161480553 19:4508210-4508232 CTGTGTGCAGAGGGGGATGTGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162032667 19:7924178-7924200 GTGTGTGGAGGGGAGGCAGCTGG + Intergenic
1162141166 19:8586334-8586356 CAGTGTGCAGGCGGTGAGGCCGG - Exonic
1162392199 19:10396330-10396352 GTGGGCGCAGGGGCGGAAGCTGG - Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1163234464 19:16022769-16022791 GTGTGGGCAGGAGGGGATGCAGG - Intergenic
1165328339 19:35126776-35126798 CTGTGGGGAGGTGGGGAGGCAGG + Intronic
1165349076 19:35266954-35266976 CCGTGTGGAGCGGGGTAAGCAGG + Exonic
1165547872 19:36556794-36556816 TTTTGTCCAGGGGGAGAAGCAGG + Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166376074 19:42327737-42327759 CTGTGCAAAGGCGGGGAAGCGGG + Intronic
1166867773 19:45851169-45851191 CTGAGTGCAAGAGTGGAAGCGGG + Intronic
1167563002 19:50237718-50237740 CTGGGTGCAGGTGGGGACACAGG - Intronic
1167724073 19:51199280-51199302 CTCTGTGCACGTGGGGAATCAGG + Intergenic
1168060398 19:53888925-53888947 CTGTGTGCAGGGGGAGTGGCAGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925298848 2:2795694-2795716 CTGTGGGGAGCGGGGGGAGCCGG + Intergenic
925346387 2:3174967-3174989 CTGGAGGCAGGTGGGGAAGCAGG + Intergenic
926016939 2:9461718-9461740 AGGTGTGCAGGGTGGGAAGGAGG + Intronic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
928269661 2:29844844-29844866 GTGTGTGCAGGGGGGTTATCAGG - Intronic
928449221 2:31364125-31364147 CTGGGTGCAGGGGCGGCTGCAGG + Intronic
929070837 2:38029178-38029200 GTGTGTGCAGTTGGGGATGCTGG - Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
930018439 2:46986502-46986524 CTCTGTGCTGGGGGGGAAAGAGG + Intronic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932625825 2:73295121-73295143 CTGTGTGCTGGAGGGTAAGGTGG + Intergenic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
933728485 2:85439449-85439471 CTCTGAGCAGGGGTGGATGCAGG + Intergenic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
934576016 2:95402169-95402191 CTGGGCGCAGGTGGGGAAGTGGG - Intergenic
934638193 2:96010026-96010048 CTGGGCGCAGGTGGGGAAGTGGG - Intergenic
934795458 2:97095384-97095406 CTGGGCGCAGGTGGGGAAGTGGG + Intergenic
935553587 2:104483370-104483392 CCGTGTGCTGGTGGGGAAGGTGG + Intergenic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938722202 2:134076743-134076765 CTGGCTGCAGTGGGGGAGGCAGG - Intergenic
941112730 2:161434211-161434233 GTGTGTGCATGGTGGGAGGCAGG - Intronic
941677118 2:168355720-168355742 CTGGGTGCAGGGTGAGAAGATGG - Intergenic
941934923 2:170974740-170974762 CTGTGAGCAGGAGGGAAAGGCGG + Intergenic
942664285 2:178300458-178300480 CTGTTTACAGCGGGGGCAGCGGG + Intronic
942970832 2:181956046-181956068 CTGTGGGCAGGGGTGGCGGCGGG - Intronic
943439926 2:187915994-187916016 CTGAGTGGAGGTGGGGCAGCTGG + Intergenic
944897402 2:204178845-204178867 CTGTGTGCAGCAGGAGAAGTAGG + Intergenic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946401412 2:219470384-219470406 CTGTGGGCAGGGGTTGGAGCCGG - Intronic
947764015 2:232624302-232624324 CTGTGGTCTGGGGGGCAAGCTGG - Intronic
947839192 2:233196845-233196867 CTGTGTACAGCGGGGGTGGCTGG - Intronic
948211143 2:236193987-236194009 CAGTGTGCAGGGCAGGAACCAGG - Intergenic
948386648 2:237584915-237584937 CTGTCTGCAGAGGGGGACCCTGG - Intronic
1168892947 20:1306386-1306408 CTGTCTTCATGTGGGGAAGCCGG + Exonic
1169189623 20:3649950-3649972 CTGTGTGCAGGGATGGCAGGAGG - Exonic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1171816151 20:29787602-29787624 TGGTGTGCAGGGGAGGGAGCCGG + Intergenic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172768114 20:37361789-37361811 CTGTGTGCAGGTAGAGATGCCGG + Intronic
1172768129 20:37361889-37361911 CTGTGTGCAGGTAGAGATGCCGG + Intronic
1172768134 20:37361917-37361939 CTGTGTGCAGGTAGAGATGCCGG + Intronic
1172768143 20:37361981-37362003 CTGTGTGCAGGTAGAGATGCTGG + Intronic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173665602 20:44760915-44760937 ATGTGGGCAGGGGGGGATGTGGG + Intronic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174412557 20:50345473-50345495 CTGTGGTCAGGTGGGGAAACCGG - Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175326021 20:58129096-58129118 ACGTGTGCAGGTGGGGAAGGAGG - Intergenic
1175625193 20:60483892-60483914 CTGGGAGCAGGAGAGGAAGCAGG + Intergenic
1175764068 20:61581074-61581096 CTGTAGGCAGGGGAGGGAGCAGG + Intronic
1175811973 20:61863342-61863364 CTGTCTGCTGGGGGAGAAGGAGG + Intronic
1175815023 20:61878779-61878801 CTGTGTGCAAGGCGGGAGACAGG - Intronic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1178441585 21:32602798-32602820 CTGTGTACAGGAGGGGGAGGAGG - Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1179823589 21:43951576-43951598 CTCTGTGCAGGGGCAGGAGCTGG - Intronic
1180060045 21:45380199-45380221 CTGTGTGCATGGATGGACGCTGG - Intergenic
1180068839 21:45426026-45426048 CTGTGAAAAGGTGGGGAAGCAGG - Intronic
1180294486 22:10872832-10872854 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180319606 22:11308166-11308188 TGGTGTGCAGGGGAGGGAGCCGG + Intergenic
1180497292 22:15902246-15902268 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180592878 22:16955859-16955881 GTGTGTGCAGGGGGAGGAGTGGG + Intergenic
1183479765 22:38057132-38057154 CTGAGTGCAGCTGAGGAAGCTGG + Intronic
1183574945 22:38682110-38682132 CGGGGTGCAGAGCGGGAAGCGGG + Intronic
1183620349 22:38968392-38968414 CTGTGCCCAGGGGGCGAAGACGG + Intronic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1184077168 22:42188791-42188813 CTGTGTGCAGGGGCTGAAATGGG + Intronic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1184670008 22:46007443-46007465 CTGGGAGCAGGGGGAGATGCCGG - Intergenic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1184763723 22:46560927-46560949 TTGTGTGCAGGGAGAGGAGCTGG + Intergenic
1185091564 22:48778530-48778552 CTGAGTGCAGCTGGGGAAGGAGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
1185297546 22:50061854-50061876 GTGTGTGCGGGGGGGGATGCAGG - Intronic
950041657 3:9923645-9923667 CTTTCTGCAGAGGGAGAAGCAGG + Intronic
950056924 3:10032451-10032473 GTGTGTGGAGGGGGGGAATGGGG + Intronic
950099259 3:10347083-10347105 CTGAGACCAAGGGGGGAAGCAGG - Intronic
950545600 3:13636309-13636331 GTGTGTGCAGGGAGGCACGCGGG + Intronic
950565463 3:13767308-13767330 CGAGGTGCAGGGGGAGAAGCGGG - Intergenic
951798823 3:26572544-26572566 CTGTGTGGAGTGGGGGGAGGGGG - Intergenic
953407174 3:42665230-42665252 CTGTGTGGAGTGGGGCAGGCAGG + Exonic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
954384913 3:50238904-50238926 CGGTGTGCGGGCGGGGCAGCAGG - Intronic
954876245 3:53804875-53804897 CTGTGTCCAAGGGAGGAGGCGGG + Intronic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955388771 3:58503036-58503058 CTGTGTGCCCTGGGGCAAGCAGG + Intergenic
955780505 3:62479178-62479200 CTGTGTGCAGTTGGGGAAATTGG + Intronic
955967839 3:64407214-64407236 CTGGGTGCAGCAGGGGAAGGCGG - Intronic
959819622 3:110717614-110717636 GTGTGTGCAGTTGGGGAAGGGGG + Intergenic
961554431 3:127688496-127688518 CTGGGTGCAGGAGAGAAAGCGGG + Intergenic
962281142 3:134052778-134052800 CTGTGTGAAGCGGTGGAAGAAGG + Intergenic
962461841 3:135621384-135621406 CTGGCTGCAGCAGGGGAAGCAGG + Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
964187652 3:153965884-153965906 CTGTGTGGGGTGGGGGAAGGGGG + Intergenic
965993084 3:174844945-174844967 CTCTCTGCAGGTGGGGAAGTGGG + Intronic
967183873 3:186929645-186929667 CTGTGTGCTGGGTGGGAAAGGGG - Intergenic
967325199 3:188231692-188231714 CTGTGTGGAGCGGTGGAAGGCGG - Intronic
967962820 3:194939399-194939421 CTGGGTGCAGGGGAGGTAGAGGG + Intergenic
968483994 4:850005-850027 CTGTGTGCAGCGTGGACAGCAGG + Exonic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
969111529 4:4847273-4847295 CTGAGTGGAGGGGGCTAAGCAGG - Intergenic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969260165 4:6028353-6028375 CTGTGCGCAGGGGCGGGGGCAGG - Intronic
969293847 4:6257563-6257585 CTGTGTGAGGGTGGGGAAGGAGG + Intergenic
969680004 4:8637599-8637621 CTGTGTGGTGGGCGGGGAGCTGG + Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
972169110 4:36323267-36323289 CTGTGTCAAAGGGAGGAAGCAGG + Intronic
972276269 4:37560676-37560698 CTAGATGCAGGGAGGGAAGCTGG - Intronic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
975380472 4:73694747-73694769 CTGTGTGCAGGAGAGAAAACAGG + Intergenic
976846673 4:89496516-89496538 CTGTGTGCAGTGGGCTAAGAAGG + Intergenic
977607392 4:98996104-98996126 ATGTGGGCTGGGGCGGAAGCGGG + Intronic
978072688 4:104491800-104491822 CATGGTGCAGGGGGGGAAGAAGG + Exonic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
980246149 4:130245649-130245671 CTGTGTTCAGGTGAGGAAACTGG + Intergenic
980538947 4:134167291-134167313 CTGTGTGCATGTGTGGTAGCAGG + Intergenic
981014210 4:139956646-139956668 CTTTGTGCAGGGGTGGAGTCTGG - Intronic
981354651 4:143774397-143774419 GGGGGTGCAGGGGGGAAAGCTGG + Intergenic
982149294 4:152434953-152434975 GTGTGTGGGGGGGGGGGAGCGGG - Intronic
983906515 4:173188632-173188654 CTGTCTTCAGGGGAGGAATCTGG + Intronic
984251697 4:177343518-177343540 CTGGGGGCAGGGGAGGGAGCTGG + Intronic
984824826 4:183915170-183915192 CTGTGGGCAGTCGGGGTAGCAGG + Intronic
985173600 4:187177573-187177595 CTGTGTGTGGTGGGGGAAGTTGG - Intergenic
985589018 5:755265-755287 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985603698 5:847781-847803 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985702056 5:1379431-1379453 CCGTGTGGTGCGGGGGAAGCCGG - Intergenic
986333818 5:6738002-6738024 ATGTGTGGTGGTGGGGAAGCAGG - Intronic
986441574 5:7787189-7787211 CTGTGTGCAGGGGAGGAACAGGG - Intronic
987083036 5:14442650-14442672 CTGTCTGCAGGTGTGCAAGCTGG + Intronic
989109946 5:37897391-37897413 TTGTGTGCAGGTGGGGACGTAGG + Intergenic
990800731 5:59599739-59599761 CTGTGTGCAGTGGAGTAAGTGGG + Intronic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
996851607 5:127959333-127959355 AGGTGTGCAGTGGGTGAAGCAGG + Intergenic
997344414 5:133176347-133176369 CTGGGGGCACGGGGGGTAGCGGG - Intergenic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998991403 5:147821839-147821861 CTGTGTGGTGGGGCAGAAGCTGG - Intergenic
999208889 5:149870579-149870601 CTGTGTGCATGGGATGAAGGAGG + Intronic
1000281984 5:159790063-159790085 CTGTTTGCTGGGGAGGAAGGCGG + Intergenic
1000956843 5:167553816-167553838 CTGTGTGAAGGAGGGGACTCTGG - Intronic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002426071 5:179176674-179176696 CTGTGTGCAGAAGGGGCAGGTGG - Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003981995 6:11398480-11398502 CTCTGTGCAGGAGGTGAAGAAGG + Intergenic
1004510269 6:16278974-16278996 CTGTGGGCATGGGAGGGAGCTGG + Intronic
1005994786 6:30924501-30924523 CTGGGGGCAGGGGGGCAACCAGG - Exonic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007400839 6:41601386-41601408 CTGTGTTGAGGAGGGGCAGCAGG - Exonic
1007407920 6:41645358-41645380 CTCTGTGCAGGGGCGGCAGGAGG - Intronic
1013032986 6:106354464-106354486 TTGTGTGGTGGGGGGGAAGGGGG - Intergenic
1013050982 6:106534817-106534839 GTGTGTGTAGGGGTGGAAGTGGG + Intronic
1016208782 6:141503860-141503882 TTCTGTCCAGGGGAGGAAGCTGG - Intergenic
1018669310 6:166166717-166166739 ATGGGTGCCGGGGGGCAAGCCGG - Exonic
1018697177 6:166399467-166399489 CGGTGTGCTGGGGGGTAAGACGG + Intergenic
1019123834 6:169825927-169825949 CTGAGTGCAGGGAGATAAGCTGG - Intergenic
1019615008 7:1955286-1955308 GTGGGTGCAGGGGCGGCAGCCGG + Intronic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1022370420 7:29765758-29765780 CTGTGAGCTGGAGGGGAGGCAGG + Intergenic
1022660351 7:32361141-32361163 CTTTGTACAGTTGGGGAAGCTGG + Intergenic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1023768208 7:43531642-43531664 AGGGGTGCAGGGGAGGAAGCTGG - Intronic
1024397885 7:48889932-48889954 CCTTGTGCAGGGGGAGGAGCTGG + Intergenic
1024754685 7:52516024-52516046 CTGTGTGCATGGGAGGAATTTGG - Intergenic
1025262247 7:57426865-57426887 GTGTGTGTAGGGGGGGGGGCGGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026498250 7:70921741-70921763 CTGGGTGCATGGGAAGAAGCCGG + Intergenic
1026796073 7:73366920-73366942 CTGTGGGGAGGAGGGGCAGCAGG - Intergenic
1026879064 7:73897092-73897114 CTGTGTTCCTGTGGGGAAGCAGG - Intergenic
1029002429 7:97168034-97168056 CTTTGTGCAGGGGAGGAGCCTGG + Intronic
1031969853 7:128056295-128056317 CTGTGTTCAGGGGCAGTAGCTGG + Intronic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1032198878 7:129805261-129805283 GTGGGTGCAGGGGGAGAGGCAGG - Intergenic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1033357725 7:140614010-140614032 CAGTGAGCAGGAGGGGAAGGAGG - Intronic
1033570942 7:142627538-142627560 GTGTGTGCAGGGGGTGGGGCGGG + Intergenic
1034267338 7:149787566-149787588 GTGAGTGCAGGCGGGAAAGCAGG + Intergenic
1034394083 7:150807022-150807044 CTGGGAGAAGGGGAGGAAGCAGG - Intergenic
1034968367 7:155404876-155404898 CACTGGGCAGGGGAGGAAGCAGG + Intergenic
1035785504 8:2256847-2256869 CAGAGAGCAGGGTGGGAAGCAGG + Intergenic
1035807304 8:2464869-2464891 CAGAGAGCAGGGTGGGAAGCAGG - Intergenic
1035839403 8:2794682-2794704 CCGTGTGCAGGGGTGAAAGGCGG - Intergenic
1037010941 8:13841648-13841670 AAGTGTGCATGGGGGGATGCTGG + Intergenic
1037086857 8:14862798-14862820 CTGTGTCTAGAGGGGAAAGCAGG - Intronic
1038310915 8:26445645-26445667 CTGTGGGCAGGTGAGGAAACTGG - Intronic
1038843166 8:31204796-31204818 CTGTTTGGAGGTGGGGAAGGAGG - Intergenic
1039165170 8:34670933-34670955 ATGTGTGTGGTGGGGGAAGCAGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039920842 8:41893478-41893500 CTGTGTGCGGGGGGTGGAGGAGG - Intronic
1040562022 8:48531410-48531432 CTGAGTGCAGGGGAGGATGGGGG - Intergenic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041551043 8:59101975-59101997 CTGTGGGCAGGTGAGGATGCAGG + Intronic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1043516111 8:80996532-80996554 CTGTGAGCAGGAGGGTGAGCGGG - Intronic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1043660582 8:82735991-82736013 CTGTGTGCAGCCTGGGGAGCTGG + Intergenic
1044729563 8:95219172-95219194 CTGAGGGCAGGAGGGGGAGCTGG - Intergenic
1045324046 8:101103625-101103647 CTGTGTGCTGGGGGAGGGGCAGG - Intergenic
1048855745 8:138685293-138685315 CAGGGTGCAGCGGGGGAAGAAGG - Exonic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049248007 8:141572960-141572982 CTGTGTGCAGGGCGGGGTGGCGG + Intergenic
1049377960 8:142298042-142298064 CTGTGCGGACGGGGGGTAGCAGG - Intronic
1049393079 8:142381996-142382018 CTGTGTGTAGGGGGGGTGTCAGG - Intronic
1049618863 8:143588893-143588915 AGGTGGGCAGGGGAGGAAGCTGG + Intronic
1049676137 8:143890096-143890118 CTGGTTGCAGGAGGGGATGCAGG - Intergenic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050785263 9:9393010-9393032 CTGTGTGATGGGGCGGGAGCTGG + Intronic
1052883248 9:33618648-33618670 GTGTGTGCAGGGGGTGGGGCAGG + Intergenic
1053647389 9:40131378-40131400 CTGTGGGCTAGGGGGGCAGCTGG - Intergenic
1053758338 9:41332465-41332487 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1054537190 9:66244792-66244814 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1055611467 9:78030454-78030476 CTGTGTACTGGGGGCGAGGCGGG - Intronic
1055757671 9:79572883-79572905 CGGTGCGCAGGGGGCGACGCGGG - Intronic
1055765981 9:79664104-79664126 CTGCGTGCAGAGGGGTAATCTGG + Intronic
1056383235 9:86074572-86074594 CAGTGTGCAGGGGTGGAGGCTGG + Intronic
1056552658 9:87664304-87664326 CTATGCGCAGGGGGTGAAGGGGG - Intronic
1057355124 9:94325832-94325854 CTGTGTGCTGGGCCGGGAGCGGG + Exonic
1058431745 9:104926768-104926790 CTGGGCGCAGATGGGGAAGCTGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059436791 9:114282000-114282022 CTGGGTGCAGGGGTGGATGGCGG - Intronic
1059676033 9:116540610-116540632 CTGTGTGCAGGGCACCAAGCAGG + Intronic
1059730291 9:117050457-117050479 CTGGGAGCAGGGGAGGAAGCAGG - Intronic
1060270224 9:122134971-122134993 CTGTGTCCAGGCTTGGAAGCTGG + Intergenic
1061682524 9:132250095-132250117 CTGTGGGCAGGAGGGGAAAGGGG - Intergenic
1061717864 9:132532162-132532184 CTCTGCGCAGGGGCGGCAGCTGG + Intronic
1061841758 9:133362614-133362636 CTGTGGGCAGGGGGTGTGGCAGG - Exonic
1062062707 9:134505157-134505179 CTGTGTGGATGGGTGGATGCGGG + Intergenic
1062200892 9:135302098-135302120 CTGCGTGGAGTGGGGGAACCTGG - Intergenic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062285236 9:135769924-135769946 CTGCGGGCAGTGGGGGAGGCCGG - Intronic
1062437589 9:136553442-136553464 CTCAGTGTAGGGGGGGAAGGGGG + Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062694895 9:137868786-137868808 CTCTGGGCAGGTGGGGAAGGGGG + Intronic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203367837 Un_KI270442v1:273916-273938 TGGTGTGCAGGGGAGGGAGCCGG + Intergenic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186664393 X:11703359-11703381 CTGGGTGCAGGAGGGCAAGTGGG - Intergenic
1187119007 X:16385032-16385054 CAGTGTGCAGGTGATGAAGCAGG - Intergenic
1187405374 X:18999285-18999307 GTTTGTGGAGGGGGGGAAACAGG + Intronic
1188417741 X:29956464-29956486 CTCTGTGCAGGGGTGGGGGCGGG + Exonic
1189262115 X:39686667-39686689 CTTTGTGGAGGGGGGGAATGGGG - Intergenic
1190263555 X:48814665-48814687 GTGTCTGCAGGTGGGGATGCGGG + Exonic
1190455126 X:50619489-50619511 CTGTGGGCCCGGGGGCAAGCAGG - Intronic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1192035363 X:67557136-67557158 GTGGGAGCAAGGGGGGAAGCAGG + Intronic
1193515051 X:82452373-82452395 CTGTGTTGAGGGGAGGGAGCTGG - Intergenic
1193601064 X:83508784-83508806 CTCTGTGCAGAGGCGGCAGCTGG - Exonic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1200119231 X:153782662-153782684 CCGTGTGGAGGTGGGGAGGCAGG - Intronic
1200683629 Y:6242442-6242464 ATGTGTCCAGGGAGGGAACCTGG - Intergenic
1200686212 Y:6262734-6262756 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200745485 Y:6900268-6900290 CTGTGGGCAGGCGGGCAAGGAGG + Intergenic
1200831884 Y:7693362-7693384 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1200989094 Y:9333650-9333672 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200991751 Y:9353980-9354002 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200994405 Y:9374260-9374282 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1200997068 Y:9394606-9394628 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200999584 Y:9463144-9463166 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201002242 Y:9483452-9483474 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1201004901 Y:9503739-9503761 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201007559 Y:9524066-9524088 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1201010190 Y:9544256-9544278 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201049006 Y:9911944-9911966 ATGTGTCCAGGGAGGGAACCTGG + Intergenic
1201070853 Y:10146325-10146347 TGGTGTGCAGGGGAGGGAGCCGG - Intergenic
1201070863 Y:10146359-10146381 TGGTGTGCAGGGGAGGGAGCCGG - Intergenic
1202115011 Y:21464337-21464359 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202119242 Y:21507662-21507684 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202121694 Y:21531202-21531224 GTGTGTCCAGGGAGGGAACCTGG - Intronic
1202157311 Y:21898180-21898202 GTGTGTCCAGGGAGGGAACCTGG + Intronic
1202159758 Y:21921721-21921743 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1202378467 Y:24258035-24258057 CTTAGTTCAGGGTGGGAAGCAGG - Intergenic
1202492315 Y:25412086-25412108 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic