ID: 900266835

View in Genome Browser
Species Human (GRCh38)
Location 1:1761633-1761655
Sequence CGGGCTGTGACCCGGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900266827_900266835 10 Left 900266827 1:1761600-1761622 CCTGAGGATCTCATGTGGAAGCC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
900266826_900266835 11 Left 900266826 1:1761599-1761621 CCCTGAGGATCTCATGTGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900266835 Original CRISPR CGGGCTGTGACCCGGTCTCC AGG Intronic
900179489 1:1304988-1305010 CGGGCTGGGGCCAGGACTCCAGG + Intronic
900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG + Intronic
902447057 1:16474216-16474238 AGGGCTGTGACCCCGCCTCAGGG - Intergenic
904054243 1:27659820-27659842 CAGGGTGTGACCGGGCCTCCGGG - Intergenic
905272998 1:36799206-36799228 AGGGTTGTGCCCCCGTCTCCTGG + Exonic
905509332 1:38506112-38506134 TGGGCTGTGTCCCCATCTCCTGG + Intergenic
906482720 1:46210431-46210453 TGGGATGTGACACTGTCTCCAGG - Intronic
909251791 1:73366949-73366971 CGGGGTGTGACCTTGGCTCCAGG - Intergenic
910745473 1:90569661-90569683 TGTGCTGTGACCCTGTCTTCAGG + Intergenic
915567626 1:156724727-156724749 ATGGCTGGGACCCGGGCTCCAGG + Intronic
920915664 1:210256141-210256163 CAGGCTGTGACAAGGGCTCCTGG + Intergenic
922800510 1:228362706-228362728 GGGGCTGGGAGCCGGTTTCCTGG - Exonic
923035097 1:230280155-230280177 CGGGCTCTGGCCCCTTCTCCCGG - Exonic
1067039398 10:42940956-42940978 CGGGCTGGGCCACGGTTTCCTGG - Intergenic
1068216444 10:53988453-53988475 CAGGCTGTGACACAGTCTCTAGG + Intronic
1069873628 10:71548165-71548187 CAGGCTGTGGCCCTGTCCCCTGG - Intronic
1070678090 10:78428171-78428193 TGGGATCTGACCCTGTCTCCAGG + Intergenic
1072789523 10:98308116-98308138 TTGGCTGTGACTCAGTCTCCAGG - Intergenic
1077912798 11:6587522-6587544 AGGGCTGTGACCCCCTCTCTGGG + Intronic
1084779758 11:71400406-71400428 CGGGCTGTGCCACGGTGGCCTGG + Intergenic
1087518163 11:99193714-99193736 CTGCCTGTGAAACGGTCTCCTGG - Intronic
1089342907 11:117771647-117771669 CCGGATGTGAGCCGGTCTTCCGG - Intronic
1089499876 11:118925707-118925729 GGGGCTGTGACCCGGACCCTCGG - Intronic
1090424433 11:126597227-126597249 CGGGCTCTGGCCCAGGCTCCAGG - Intronic
1091626160 12:2122518-2122540 AGTGCTGTGACCCGGCCTCCCGG + Intronic
1096701019 12:53382820-53382842 CAGGCTGTGAGCCACTCTCCTGG - Exonic
1097125803 12:56773956-56773978 CGGGCTGTGACTCGGGCTTTGGG + Exonic
1097134586 12:56841153-56841175 TGGGCTGTGACTCGGGCTTCGGG - Intergenic
1097148339 12:56957337-56957359 CGGGCTGTGACTCTGGCTTCGGG - Exonic
1103621617 12:122190422-122190444 CTGGCTGTGCCCCGCCCTCCTGG + Intronic
1103902666 12:124311492-124311514 AGGGCTCTGAGCCGGGCTCCGGG + Intronic
1108091331 13:46853180-46853202 CAGGCTGTAACCCCTTCTCCTGG - Intronic
1112387759 13:98956110-98956132 CTGGCTGTGACCCAGCCTCTTGG - Intronic
1118263414 14:64269911-64269933 CAGGCTGTCATCTGGTCTCCTGG - Intronic
1119582968 14:75804085-75804107 CGGGATGTGGCCAGGCCTCCTGG + Intronic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1124147295 15:27139678-27139700 TGGTCTGTGACCCTGTTTCCTGG + Intronic
1127906743 15:63381747-63381769 CGGGCTGTGCCGGGGGCTCCCGG + Exonic
1133191460 16:4136572-4136594 CAGGCTGTGAGCAGGGCTCCTGG - Intergenic
1138627822 16:58266539-58266561 CGGGCTGTGAGCCAGCCTTCTGG + Intronic
1142362449 16:89633869-89633891 TGGGCTGTGCCCCTGTCTCGGGG - Intronic
1142431074 16:90027733-90027755 CGGGCTGTGGCCCAGTCCCCGGG + Intronic
1143108040 17:4539170-4539192 TGGGCTGGGACCCTGGCTCCAGG - Intronic
1145032491 17:19515452-19515474 CTACCTGTGACTCGGTCTCCAGG - Intronic
1148212716 17:45817971-45817993 TGGGCTGTGACCCTGCCTCCAGG - Intronic
1152134371 17:78495230-78495252 CGGGCTGGGAGCCCGGCTCCAGG - Intronic
1152339887 17:79718328-79718350 CTGCCTGTGCCCCGCTCTCCAGG + Intergenic
1152616825 17:81341714-81341736 CCGGCGGTGCCCGGGTCTCCGGG + Intergenic
1153749260 18:8211951-8211973 AGGGCTGTGACCAGGTGTCAGGG + Intronic
1155166031 18:23233180-23233202 TGGGCTGTGACCTGGACACCAGG - Intronic
1160892068 19:1384228-1384250 CGGGCCGTGCCCTGGTCTCGGGG - Intronic
1161014823 19:1978397-1978419 AGGGCAGCGACCCGGTCCCCTGG + Intronic
1161213441 19:3080451-3080473 TGAGCTGTGACCCCGTGTCCCGG + Intergenic
1161401366 19:4067303-4067325 CGGGCTGTGCCCCCGACGCCCGG + Intergenic
1166683393 19:44781523-44781545 GGGGCTGGGACCTGGACTCCTGG + Intronic
1167327972 19:48836796-48836818 GGGGCTGGGACCCTGACTCCTGG - Intergenic
1167432169 19:49461282-49461304 GGGGCTGGGACCTGGACTCCTGG + Intronic
1167432182 19:49461318-49461340 GGGGCTGGGACCTGGACTCCTGG + Intronic
1167597652 19:50435885-50435907 GGGGCTGCGGCCCGGACTCCTGG + Intronic
1167746392 19:51353782-51353804 GGGGCTGGGACCTGGACTCCTGG - Intronic
1167746493 19:51354078-51354100 GGGGCTGGGACCTGGACTCCTGG - Intronic
1168149231 19:54435977-54435999 GGGGCTGGGGCCCGGACTCCTGG + Intronic
932001211 2:67886825-67886847 CGGGGTGTGGCCTGGTCTCAGGG - Intergenic
934678363 2:96265720-96265742 CTGGCTGAGACCCTGACTCCGGG - Intronic
934861214 2:97764855-97764877 CTGGCTGTCACCTGCTCTCCCGG + Intronic
944413580 2:199463507-199463529 CGGGCAGTGACCCGGGCTCGAGG - Intronic
946468057 2:219929912-219929934 CCGGCTGTGACCTTTTCTCCGGG - Intergenic
947875373 2:233464297-233464319 AGGGCTGTGCCTGGGTCTCCCGG + Intronic
948547375 2:238742501-238742523 CAGGCTGGAACCAGGTCTCCTGG + Intergenic
948890582 2:240905270-240905292 CAGGCTGCCTCCCGGTCTCCTGG + Intergenic
1168924757 20:1570280-1570302 TGTGCTGTGACCAGGTCACCTGG + Intronic
1168968095 20:1912339-1912361 CAGGCTGAGTCCCGGGCTCCGGG + Intronic
1172122734 20:32608261-32608283 GGGGCTGAGGCCGGGTCTCCAGG - Intronic
1175545795 20:59776908-59776930 CTGGCTGTGACCAGGCCACCTGG - Intronic
1175852576 20:62101717-62101739 GTGGCTGTGACCTGATCTCCTGG + Intergenic
1181381494 22:22508374-22508396 CGGGCTGGGCCCGGGCCTCCTGG - Intronic
1183230148 22:36577061-36577083 CTAGCTGTGACCTGGTCCCCCGG + Intronic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
1183538453 22:38416385-38416407 GGGACTGTGGCCCGATCTCCTGG - Intergenic
950670495 3:14522617-14522639 CCGTCTGTGACTCAGTCTCCTGG - Intronic
952942301 3:38454087-38454109 CAGGCTGCGGCCCGGGCTCCGGG - Exonic
954286400 3:49622600-49622622 TGGGCTGTGGCCCCCTCTCCAGG - Intronic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
962326679 3:134440380-134440402 TGGGCTCTGACACTGTCTCCAGG - Intergenic
964118700 3:153161505-153161527 TGGGATGTAATCCGGTCTCCGGG + Intergenic
969281273 4:6172295-6172317 CTGGCAGTGACCTGGTCCCCTGG + Intronic
969924069 4:10569234-10569256 TGGTCTGTAACCTGGTCTCCTGG - Intronic
971248454 4:24951136-24951158 CAGGCTGTCACCCGGGCTGCAGG + Intronic
978132479 4:105215028-105215050 CGGGGTCTGACACTGTCTCCGGG + Intronic
984832734 4:183990736-183990758 CTGGCTGTGACACTGTCTCAGGG - Intronic
984977458 4:185242314-185242336 TGGGCTCTGACACTGTCTCCAGG - Intronic
985660937 5:1156153-1156175 CGCGCGCTGACCCGGTCGCCCGG - Intergenic
997640325 5:135444746-135444768 GGGGCTGTTTCCAGGTCTCCCGG - Exonic
1002857373 6:1050319-1050341 TGGGATCTGACCCTGTCTCCAGG - Intergenic
1004381665 6:15137951-15137973 TGGGATGTGACCGGGTCTCAGGG + Intergenic
1007114518 6:39334189-39334211 CGGGGTGTGAACCAGCCTCCTGG - Exonic
1007763182 6:44146140-44146162 TGGGCTGTGACCAGGTCTTCTGG + Intronic
1016820617 6:148342973-148342995 CGGGCGGGGACCCGGCATCCGGG + Exonic
1018961646 6:168453318-168453340 CGGGCTGTGCCTTTGTCTCCGGG + Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1027215314 7:76179783-76179805 GGGGCTGGGCCCGGGTCTCCCGG + Intergenic
1031966889 7:128032964-128032986 CGGGCTGTGTCGTGGGCTCCGGG - Intronic
1033115176 7:138618930-138618952 CCAGCTGGGACCAGGTCTCCTGG - Intronic
1034254500 7:149717046-149717068 CGTGCTCTGCCCCGGTCTCTGGG + Intronic
1036782393 8:11658639-11658661 TCGGATGTGTCCCGGTCTCCAGG - Intergenic
1041124448 8:54621306-54621328 CGGGCTTTGTCCAGGTCTACAGG - Exonic
1044368259 8:91376790-91376812 TGGGCTGTGAGTAGGTCTCCAGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047426210 8:124749196-124749218 TGGGCTGGGACCCAGCCTCCTGG - Intergenic
1048798473 8:138173244-138173266 CGGACTGTAACCCTGACTCCAGG + Intronic
1049166478 8:141128916-141128938 AGGGCTGAGTCCCGGTCCCCCGG + Intronic
1049690551 8:143957076-143957098 CCGGCTGTAGCCCCGTCTCCAGG - Intronic
1055042758 9:71893276-71893298 TGGGATGTGACACTGTCTCCAGG - Intronic
1060129205 9:121078583-121078605 AGGGATGTGACGCTGTCTCCAGG - Intronic
1060411266 9:123401957-123401979 AGGCCTGTGACCCTGTATCCTGG + Intronic
1061033715 9:128101972-128101994 CGTGCTGTGCCCCTGTCTCTGGG + Intronic
1061118134 9:128627487-128627509 CGGGCTGGCACCTGGTCTCTTGG - Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061840477 9:133356231-133356253 CGGGCTGTGATCCAGGCGCCTGG - Intronic
1061950168 9:133931680-133931702 CTGCCTGTGACCCGGTGCCCAGG + Intronic
1062403251 9:136381640-136381662 CTGGCTGTGACTGGGTGTCCTGG + Intronic
1062640109 9:137514576-137514598 CGGGCTGTGGGCGGGTCACCCGG + Intronic
1189718346 X:43887760-43887782 CAGGCTGTGACACAGTCTCTTGG - Intergenic
1195118418 X:101723545-101723567 TGGGATCTGACCCTGTCTCCAGG + Intergenic