ID: 900269174

View in Genome Browser
Species Human (GRCh38)
Location 1:1778424-1778446
Sequence GCTCGGCGGCGCCGGCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 464}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900269174_900269180 8 Left 900269174 1:1778424-1778446 CCCCGGCGCCGGCGCCGCCGAGC 0: 1
1: 0
2: 6
3: 47
4: 464
Right 900269180 1:1778455-1778477 GCCGCGCCCGCCCACTGCGCAGG 0: 1
1: 0
2: 1
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900269174 Original CRISPR GCTCGGCGGCGCCGGCGCCG GGG (reversed) Intronic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900582129 1:3414505-3414527 GCTCGGCGGGGCGGGCGGCTCGG + Intronic
901109551 1:6784685-6784707 GGCGGGCGGCGCCGGGGCCGTGG + Intergenic
901199167 1:7457042-7457064 GCACGGCGGCGCAGGGGGCGGGG - Intronic
901434003 1:9235096-9235118 GGTTGGAGGCGCCGGGGCCGGGG - Intronic
902067484 1:13700272-13700294 GCTCTGAGGCGCTGGCGCGGCGG + Intronic
903034480 1:20485443-20485465 GGTCAGCGGCGCTGGGGCCGGGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905580803 1:39081729-39081751 GCTCCCCGGCGCCGGCCGCGGGG - Intronic
905617105 1:39408921-39408943 GCCCGGCGGGGGCGGGGCCGGGG - Intronic
905867099 1:41382354-41382376 GCCCGGCGAGGCGGGCGCCGCGG + Exonic
906495736 1:46302885-46302907 GCTCGGGGGCGCGGGGGGCGAGG - Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
907051097 1:51330395-51330417 GCCCGGGGGCGCGGGCGGCGCGG - Intronic
908501219 1:64745225-64745247 GCGCGGCGGGGCTGGGGCCGGGG + Exonic
909622515 1:77683579-77683601 CCTCGGCGGCGCCCGACCCGCGG - Intergenic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913250633 1:116909955-116909977 GATCGGCGGGGCCGGCTCCCGGG + Intergenic
913518263 1:119623290-119623312 GCGCGGGGGCGGCGGCGCTGCGG - Exonic
919847040 1:201648815-201648837 GCCCGGCGGCGGCGGCGGCATGG + Exonic
921945703 1:220884599-220884621 CCTTGGCGGCGGCGGCGCCTCGG + Exonic
922817111 1:228457670-228457692 GCGCGTGGGCGCCGGCGCCCCGG - Exonic
922832431 1:228610520-228610542 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922832991 1:228612761-228612783 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922833552 1:228615002-228615024 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922834669 1:228619484-228619506 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922836338 1:228626161-228626183 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922836896 1:228628400-228628422 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922837455 1:228630642-228630664 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922838016 1:228632883-228632905 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922838574 1:228635123-228635145 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922839132 1:228637348-228637370 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922839692 1:228639589-228639611 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922840253 1:228641820-228641842 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922840813 1:228644061-228644083 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922841376 1:228646292-228646314 GCTCGGGAGCGCGGGAGCCGGGG - Intergenic
922851334 1:228735901-228735923 GCTGGTCGGCGACGGCGCGGTGG + Exonic
923318548 1:232805671-232805693 GTTCGGCGGCGGGAGCGCCGGGG - Exonic
924524734 1:244835767-244835789 GGTCGGCGGGGCGCGCGCCGCGG + Intronic
1063418239 10:5890304-5890326 GCCCGGCGGCGGCGGCAGCGGGG + Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064764754 10:18659552-18659574 GCTCCGCGCAGCCCGCGCCGCGG + Exonic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1071529394 10:86377363-86377385 CCTGGGCGGCGCCGGCGACTGGG - Intergenic
1071532560 10:86400944-86400966 GGAAGGCGGCGCCGACGCCGCGG + Intergenic
1072454105 10:95561261-95561283 GCTCGGCGGCGGCAGCGCCGGGG - Intronic
1073059430 10:100724546-100724568 GCTCCGCGGCGGCGGCGACCAGG + Intergenic
1073138044 10:101230330-101230352 GCTAGGCGGGGCCGGCAGCGGGG - Intergenic
1073578052 10:104641461-104641483 GCCCGGCGGCCCCGGCTTCGCGG + Exonic
1075587156 10:123666311-123666333 GCCGGGCGGCGGCGGCGCCGAGG + Intergenic
1075645516 10:124093496-124093518 CCTCTGCGGCTCCGGCTCCGCGG + Exonic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076638932 10:131901077-131901099 GCTCGGCTGCAGCGGCGCGGAGG + Exonic
1076890704 10:133281834-133281856 GCCCTGCGGCGCCGGCTCCGGGG - Intronic
1078066317 11:8081445-8081467 GCCCGGAGGGGCCGGCGCGGGGG - Intronic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1081870467 11:46380723-46380745 GCTCGTCGGGGCCGGGGGCGGGG + Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083302004 11:61744438-61744460 GCTTGGCGGGGCTGGCTCCGTGG - Exonic
1083318070 11:61828408-61828430 GCTCGGCGGCCCCCTCGCCCTGG - Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083885784 11:65572867-65572889 CGTTGGCGGCGCCGGCGGCGTGG - Exonic
1084112512 11:67023279-67023301 GCTCGGCCGGGCCGGGGCGGCGG - Intronic
1084128766 11:67118439-67118461 GCCCCGTGGCGGCGGCGCCGGGG + Intergenic
1084177071 11:67428527-67428549 CCATGGCGGCGCCGGCCCCGCGG - Exonic
1084650606 11:70487101-70487123 GCTCGGTGGCTCCGGGGCCTGGG + Intronic
1084968111 11:72754926-72754948 GATGGGCGGCGCGGGCGGCGAGG - Exonic
1085197890 11:74683369-74683391 GCGCGGCCGGGCGGGCGCCGTGG + Intergenic
1085346040 11:75768762-75768784 GCTCCGGGACGCCAGCGCCGCGG + Exonic
1086666569 11:89491243-89491265 GCGCGGCGGGGCCGGCGGCATGG - Exonic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1088462090 11:110093023-110093045 GCTCGGGCGCGCCCGAGCCGGGG + Intergenic
1088920630 11:114257848-114257870 TCGCGGCGGCGCGGGCGCTGGGG + Exonic
1089346985 11:117796993-117797015 GCTGGGCGGCGGAGGCGGCGGGG - Intronic
1089432691 11:118436647-118436669 GGTCGGCGGTGGCGGCCCCGGGG + Exonic
1089563238 11:119356481-119356503 CCTCGGAGGCGCGGGCGCTGCGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1091000997 11:131910781-131910803 GCTCGGCGGGGCAGGGGCTGCGG - Intronic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091550375 12:1531206-1531228 GGTCGGCGGCGCAGGCGGGGCGG + Intronic
1091558669 12:1594415-1594437 GCGCGGCGGCGCGGGCGGAGCGG - Intronic
1091596966 12:1884815-1884837 GCTCATCAGCGACGGCGCCGTGG - Exonic
1091740829 12:2959451-2959473 ACGCGGCGGCGCCGGAGCTGCGG - Exonic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1091823259 12:3491755-3491777 GCTGAGCGGCGGCGGCGGCGCGG - Intronic
1092108928 12:5945360-5945382 GCTGCGCGGCGCCGGCGGCCGGG - Intronic
1092245022 12:6859252-6859274 GCTCGGCGGCAGAGGAGCCGGGG - Intronic
1095752684 12:45729287-45729309 TTTCGGCGGCGGCGGCGGCGGGG - Intergenic
1096337129 12:50764687-50764709 GCTCGGCGGACACCGCGCCGAGG - Intronic
1096482416 12:51951587-51951609 TCCCGGCGGAGCCGGCGCCGCGG - Intergenic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1097989926 12:65824205-65824227 CCTCGGCGGCGGCGGCGCCCGGG - Exonic
1098550336 12:71755017-71755039 GGTCGGCGGGGCCGGGGCGGTGG + Exonic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1099014267 12:77325586-77325608 TCTCGGCGTGGCCTGCGCCGGGG + Intergenic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101302380 12:103495576-103495598 GCTCGTCTGGGCCGTCGCCGGGG + Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103510090 12:121467742-121467764 GCCCGGGGGCGCCCGGGCCGTGG + Intronic
1103561284 12:121794354-121794376 GCCCGGAGCGGCCGGCGCCGAGG - Intronic
1103623893 12:122204561-122204583 GCCGGGCGGCGGCGGCGGCGGGG - Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103901904 12:124307670-124307692 GCTGGGCGGCGCAGGCCCCAGGG + Intronic
1104001598 12:124863896-124863918 GTCCGGCGGCGCCGGCGATGGGG - Intronic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104376173 12:128267081-128267103 GCTCGGCGGGGGCGGGGCCCGGG + Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104854223 12:131894646-131894668 GCTCTGAGGCCCGGGCGCCGCGG + Exonic
1104901141 12:132190123-132190145 GCCCGGCGGGGTCGGAGCCGAGG - Intergenic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1105022848 12:132828773-132828795 GCTCGGAGGCCGCGGCGCCTCGG - Intronic
1105040374 12:132956351-132956373 GCTCGGCGGTGCACCCGCCGGGG + Intergenic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1105578472 13:21673851-21673873 GCTCGGCCGCCCGGGCCCCGCGG + Intronic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1106187843 13:27424719-27424741 GCTTGGAGGCGCCGGCGCCCTGG + Exonic
1106340251 13:28820264-28820286 CCTGGGCGGTGCCTGCGCCGAGG + Intergenic
1106517157 13:30465381-30465403 GCTCGGCGGCGGCGGCGGGAGGG - Intronic
1107605097 13:42048824-42048846 GGCCGCCGGAGCCGGCGCCGCGG + Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1108688924 13:52845805-52845827 GCTCCGCGGCGCGCACGCCGAGG - Exonic
1112091740 13:96090621-96090643 GCTCGGCTGCGGCTGCGGCGTGG - Intergenic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1113200999 13:107867343-107867365 GCCCGCGGGCGCCGCCGCCGGGG + Intergenic
1113655708 13:112066991-112067013 GCTCGGCGGCCCCGGCTCTCCGG + Intergenic
1114649070 14:24271632-24271654 GCTCGGAGGCGCGTGCGCGGGGG + Intronic
1114659404 14:24334987-24335009 ACTCCGCTGCGCCAGCGCCGCGG - Exonic
1115120033 14:29927769-29927791 GCTCGGGGCCGCCGGCACTGGGG + Intronic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1117898204 14:60509113-60509135 GATTGGCGGCGCGGGCGCCATGG - Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1119219474 14:72894207-72894229 GGTGGGCGGGGCCTGCGCCGTGG + Intergenic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119456804 14:74763335-74763357 GCTCGGGAGCGCCGGCGCACTGG + Intergenic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1122470798 14:101964700-101964722 GCCCGGGGGCGGCGGCGGCGAGG + Exonic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122658611 14:103279421-103279443 GCACCGCGGAGCCGTCGCCGTGG - Intergenic
1122889071 14:104724303-104724325 GCTTGACGCCGCCTGCGCCGGGG - Intronic
1122917379 14:104865362-104865384 GCTGGGCGGGGCCGCCGCCTAGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1124476995 15:30044436-30044458 GCTGGGCGGCGACGGCGACATGG + Intergenic
1124652434 15:31483765-31483787 GCTCTGGCGCGCTGGCGCCGGGG + Exonic
1125594218 15:40874013-40874035 GCTGGTGGGCGACGGCGCCGTGG - Exonic
1125603903 15:40929460-40929482 GCTGGGCGGCGACCGCGCCGAGG - Exonic
1125677858 15:41512073-41512095 ATGGGGCGGCGCCGGCGCCGGGG - Intronic
1126634118 15:50765410-50765432 GCTGGGCGGGGCCGGGGCCAAGG - Intronic
1127071259 15:55289949-55289971 CCTCGGAGGCGCGGCCGCCGGGG - Intronic
1128153539 15:65377850-65377872 GTCCCGCGGGGCCGGCGCCGGGG + Exonic
1128547717 15:68579130-68579152 GCTCGGCCGAGCCGCCGGCGGGG + Exonic
1129322354 15:74782252-74782274 GCCCGGCTGCGCCGCCGTCGGGG + Exonic
1129644739 15:77419841-77419863 TCTGGGTGGCGCCGCCGCCGGGG - Intronic
1129676003 15:77632690-77632712 GCCCGCCGGCCCCGGCCCCGCGG - Intronic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1131056710 15:89379204-89379226 GCTCGGCGGCTGCGGCTCCGGGG - Intergenic
1131215110 15:90529916-90529938 GCTCGCTGGCTCCGGGGCCGCGG + Intronic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132099743 15:99014983-99015005 GCACCCCGGCGCCGGCTCCGGGG - Intergenic
1132111593 15:99105703-99105725 GCGCGGCGGGGCCGGTGGCGCGG - Exonic
1132419298 15:101652068-101652090 GCTCGGTGTCGCCGGAGCGGAGG + Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132665980 16:1081552-1081574 GCTCAGCGGGGCTGGGGCCGGGG - Intergenic
1132769517 16:1553492-1553514 GCTCGGCGTGGCCGGAGCCTGGG + Intronic
1132778521 16:1610532-1610554 ACTCGGCGGCGCCGGGATCGTGG + Intronic
1132947137 16:2537959-2537981 GCGGGGCGGCGCCGGGGGCGGGG + Exonic
1133285526 16:4688872-4688894 GCTCGGCGGCGCTGGGATCGGGG - Exonic
1133634671 16:7653911-7653933 GATCGGGGGCGGGGGCGCCGCGG - Exonic
1135321757 16:21502157-21502179 CCTCGGGGGCCCCGGCGACGTGG - Intergenic
1135437210 16:22437108-22437130 CCTCCGCGGCCCCGGCGACGTGG + Intronic
1135517684 16:23149223-23149245 GCTCGCCGCCGCCGGCGGCCCGG + Exonic
1136261775 16:29082242-29082264 ACTCTGCGGCGCAGGAGCCGGGG - Intergenic
1136365194 16:29806439-29806461 GCCCCGCGGGGCCGGGGCCGGGG - Intronic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1139410068 16:66751709-66751731 GTTGGGCGGCGCAGTCGCCGCGG - Exonic
1142156351 16:88534359-88534381 GCTCCGGGGAGCGGGCGCCGCGG - Exonic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142336137 16:89490496-89490518 GCTCGGCGGCGGCGCCTCCCCGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143166334 17:4899069-4899091 CCTCGGGGGCGGCGGCGCCCAGG + Exonic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144592388 17:16535770-16535792 CCTCCGCTGCGCAGGCGCCGTGG - Intergenic
1144604665 17:16653835-16653857 GCTCGGCGGTGCCGGCCTCCAGG + Exonic
1145110355 17:20156452-20156474 GCCCGGCGGCCCCGGCGCCCAGG - Intronic
1145979982 17:29005660-29005682 GCCCGGCTTGGCCGGCGCCGGGG + Intronic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1146433635 17:32822582-32822604 GCTCGGCGCGGCCGCCTCCGCGG - Intronic
1148013374 17:44503523-44503545 GCTGGCAGGCGCCTGCGCCGCGG - Intergenic
1148183047 17:45620524-45620546 CCTCGGCGGCGCCCGCTCCCCGG - Intergenic
1148265806 17:46225167-46225189 CCTCGGCGGCGCCCGCTCCCCGG + Intronic
1148445277 17:47733639-47733661 GCTCGGCGGGGCGGGCACCAAGG - Exonic
1149994562 17:61399933-61399955 GCTGGCCCGCTCCGGCGCCGGGG - Exonic
1150285237 17:63950436-63950458 GCTCCCCGGGGCCGGGGCCGGGG - Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1151662344 17:75525591-75525613 GCTCGGCGCCGCAGGGGCGGGGG - Intronic
1151747140 17:76017787-76017809 GCTCAGCGGGGCCCGCGCCCAGG + Exonic
1151812450 17:76452687-76452709 GCTGGGCGGCGCGGGCGGCAGGG - Intronic
1151828598 17:76537252-76537274 GGTCGGCGGAGCAGGCGGCGTGG - Intronic
1151828694 17:76537570-76537592 GCTCGGCGGCGGCGGTGGCGGGG + Exonic
1152628651 17:81399802-81399824 GCGCGGCGGCAGCGGCGCTGCGG - Exonic
1152697501 17:81804322-81804344 GCGCGGCGGGGCCGGGGGCGCGG + Intronic
1152923992 17:83079429-83079451 AATCGGGGGCGCGGGCGCCGGGG - Intergenic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1157613788 18:48975514-48975536 GCACGGCGGCGGAGGGGCCGAGG + Intergenic
1158259051 18:55587935-55587957 GCTCCGCGCCTCCCGCGCCGCGG - Intronic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1160453040 18:78978803-78978825 GCGCGGCGACGACGGGGCCGGGG + Intergenic
1160453340 18:78979743-78979765 GCCCGGCGGCGGCGGCGGGGGGG + Intergenic
1160453596 18:78980668-78980690 GCGCGGCGGCGGAGGCACCGTGG - Intronic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160455389 18:78995485-78995507 GCTCGGCCGCACCGCAGCCGGGG - Intronic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160909678 19:1468847-1468869 GCTCAGCGTCGCCAGCTCCGAGG - Exonic
1160909913 19:1469631-1469653 GCCCGACGGCGCCGTCCCCGCGG + Exonic
1160912674 19:1482086-1482108 ACACGGCGGCGCCCGCGCTGAGG - Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160957173 19:1699145-1699167 GCCGGGCGGGGCGGGCGCCGCGG + Intergenic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161006794 19:1941199-1941221 GCTCCGCCGCGCCCGCTCCGGGG - Exonic
1161279077 19:3435281-3435303 GCCCCGCGGCGCCCGCGCAGTGG - Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1161963059 19:7533525-7533547 TCCCGGCGGCGCAGGCGCAGAGG + Exonic
1162019757 19:7863070-7863092 GATCGGCGGGGCCGGGGTCGGGG + Intronic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162778659 19:12995639-12995661 GCTCGGCCCCGCCGGCTCCGGGG - Exonic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163023444 19:14495935-14495957 GCAGGGTGGGGCCGGCGCCGTGG - Intronic
1163138652 19:15331972-15331994 GGTGGGGGGCGCGGGCGCCGCGG - Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163262272 19:16198331-16198353 GCTCCCCGGCGCCGGGGCCGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163551178 19:17967169-17967191 GCCCGGGGGCGGCGGGGCCGGGG - Intronic
1163607222 19:18281886-18281908 CCTTGGCGGAGGCGGCGCCGGGG - Intergenic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1164644049 19:29845065-29845087 GCTCCGCGGGGCCTGCGGCGGGG + Intergenic
1164835057 19:31350679-31350701 GCTGGGCGGCGTGGGCGGCGGGG + Intergenic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165745980 19:38229618-38229640 GCGCGGCGGCAGCGGCGCCCCGG - Intronic
1165760068 19:38315882-38315904 GCTTGGCGGCGGCGGCTGCGGGG - Exonic
1165961616 19:39539777-39539799 GCCCGGCGGCGGCGGCGGCCAGG - Exonic
1166042802 19:40213613-40213635 CCCCGGGGGCGCGGGCGCCGTGG + Exonic
1166808126 19:45499030-45499052 GCTGAGCCGCGCTGGCGCCGTGG + Exonic
1167220329 19:48195057-48195079 GCTGGGCGGCGCCGGCCGCGAGG + Exonic
1167258124 19:48443087-48443109 GCCCGCCGGCGCCCGCGCGGTGG + Exonic
1167376416 19:49114555-49114577 GGTGGGCGGGGCGGGCGCCGGGG + Intronic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168343810 19:55641053-55641075 GGCCGGCGGCGCCGGGGACGCGG - Intronic
1168343812 19:55641059-55641081 GCTCCGGGCCGGCGGCGCCGGGG - Intronic
926101711 2:10122436-10122458 GGTCGGGGGCGCCGCCGCCCAGG - Exonic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927606564 2:24491498-24491520 GCTCCTCGGGCCCGGCGCCGCGG - Intergenic
927652345 2:24920203-24920225 GCGCGGCGCCGGCGGCTCCGGGG + Intergenic
927714289 2:25342123-25342145 GCTCCGCAGCGCCGGGGCCGGGG - Intronic
927938035 2:27086331-27086353 GGTGGGCGGCGCCCGCGCGGGGG - Exonic
928143541 2:28751685-28751707 GCGCGGCGGCCCAGGCGTCGAGG + Intronic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929537505 2:42792747-42792769 GCGCGGCGGCGGCAGCGCTGGGG + Intergenic
931348718 2:61470488-61470510 GCGCGGTGGCGCGGCCGCCGCGG - Intronic
931348871 2:61470930-61470952 GCGCCGAGGCGCCGGCGGCGGGG + Intergenic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
935237501 2:101151097-101151119 GCTCGCCGGGGCGGGCGCGGCGG - Intronic
935570878 2:104659296-104659318 GCTACGCGGCGCTGGCGGCGGGG + Intergenic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936234687 2:110732802-110732824 GCTCGGCGGCTTCGGGGGCGCGG - Intronic
937045144 2:118847168-118847190 GCTCGGCCGCCCCGCCGCCCCGG + Exonic
937997085 2:127702140-127702162 CCTTGGCGAGGCCGGCGCCGCGG - Exonic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
944615208 2:201452145-201452167 GCTCAGCGGGGCCCGGGCCGCGG + Intronic
946250103 2:218406450-218406472 CCTGGGTGGGGCCGGCGCCGGGG + Intergenic
946404168 2:219483875-219483897 GCTCGGCGGTGCCGGCCCCGGGG - Exonic
946622378 2:221573347-221573369 GCCCGGCTGCTCCGGCCCCGGGG + Intronic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948824681 2:240568504-240568526 GCCGGGCGGCGGCGGCGGCGGGG - Intronic
948862080 2:240757479-240757501 GCTCGGTGGCGTCGGAGTCGGGG + Exonic
1168756773 20:324180-324202 GCTCCGCGGCGCGGGGGGCGGGG - Intergenic
1168757339 20:326351-326373 GCTCGGCGGCCCCCGCGGCCAGG - Exonic
1169131464 20:3168185-3168207 GCTCGGCCGCACCGGGGCCCTGG + Intronic
1169204566 20:3732600-3732622 ACCCGGCGGCGCAGGCGGCGCGG + Intergenic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1170999199 20:21396612-21396634 GCCCGGCGGCGTCGCGGCCGCGG - Intronic
1172272766 20:33663801-33663823 CCTCGGCGGGGCCGGCTTCGCGG - Exonic
1172274977 20:33674435-33674457 GCGCGTCGGCGCCGGCGCCAAGG - Intronic
1172359609 20:34303003-34303025 GCGCGGCGGCCCCGGCGTCGCGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1174204267 20:48827815-48827837 GCCCGGCGGCGACGGGGCCGGGG - Exonic
1174258697 20:49277944-49277966 GCGGGTCGGCGCGGGCGCCGGGG + Intronic
1174258796 20:49278262-49278284 GCCCGCCGGCTCCGCCGCCGGGG - Intronic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1175847474 20:62066118-62066140 GCTCAGGGGCGCGGGCGCCGGGG + Intergenic
1175873764 20:62220112-62220134 GGTCCGCGGGGCCGGGGCCGGGG + Exonic
1176157031 20:63627063-63627085 ATTCGGCGGCGGCGGCGGCGCGG + Intergenic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176278214 20:64286480-64286502 GCGCGCCTGCGCCGGCGCGGTGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176550579 21:8219195-8219217 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176569509 21:8402236-8402258 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176577421 21:8446465-8446487 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1178457806 21:32771708-32771730 GCTCGGCGCTGCCGGGGCCGCGG - Exonic
1178922595 21:36748132-36748154 GCTCGGTGGCGCCGCAGCCCCGG - Exonic
1179511812 21:41878798-41878820 GCCGGGCGGCGTCGTCGCCGAGG - Exonic
1179893690 21:44350251-44350273 GCTCGGAGCCGCCCGCGCCCCGG - Intronic
1179921701 21:44510871-44510893 CCTCGGCGGGGGCGGGGCCGGGG + Intronic
1180614773 22:17120233-17120255 CCGCGGGGGCGCCGGCGGCGCGG - Exonic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181478031 22:23180590-23180612 GCACGGCGGCGGCGGGGCTGTGG + Exonic
1183093970 22:35541254-35541276 GCTCGGCGGGGCCCGGGCAGGGG - Exonic
1183401780 22:37609073-37609095 GCTGGACCGCGCCGGGGCCGGGG - Intronic
1183546293 22:38456050-38456072 GCTCCGCGCCGCGGGCCCCGCGG - Intergenic
1183856099 22:40636296-40636318 GCTCTGCGACTCCGGCCCCGAGG + Intronic
1184046708 22:41976714-41976736 GCTTGCGGGCGCGGGCGCCGCGG + Intronic
1184557392 22:45240745-45240767 GCTCGGGGGCGGCGGCGGCGGGG + Intronic
1184593858 22:45502815-45502837 GCGCGGCGGAGGCGGGGCCGCGG - Intronic
1184680715 22:46071124-46071146 CCTCGGCCGCGCGGGCCCCGGGG + Intronic
1184759488 22:46536744-46536766 GCGCGGCCGCGCAGCCGCCGGGG + Exonic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185278756 22:49961043-49961065 GGCCGGCGGGGCCGGGGCCGGGG + Intronic
1185315593 22:50177930-50177952 GCTCGGCGGGGTTGGCGCTGGGG - Exonic
1185343004 22:50299916-50299938 GTCTGGCGGTGCCGGCGCCGGGG - Intronic
1185398448 22:50604210-50604232 GCGCGGGGGCTCCGGCTCCGAGG - Exonic
1185420279 22:50731060-50731082 GGCCGGGGGCGCCGGGGCCGGGG - Intergenic
1203255478 22_KI270733v1_random:135538-135560 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950215303 3:11154538-11154560 ACTCACCGGCGCCGGCTCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950650217 3:14402549-14402571 GCTCGGCCGGGCCGGGGGCGGGG - Intergenic
950683917 3:14603026-14603048 GCCCGGCGGGGGCGGGGCCGGGG - Intergenic
950730091 3:14948583-14948605 GGTCGGCGGGGGCGGGGCCGGGG + Intronic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955228437 3:57079306-57079328 GCTGGGCGGGGCCGGGGGCGGGG + Exonic
956678190 3:71754300-71754322 GCCCGGCGGCGCCCCCGCCGCGG - Exonic
956813659 3:72888447-72888469 GCTCGGGGGCGCGGACGCGGGGG - Exonic
959539836 3:107525151-107525173 GCGCGGGGACGTCGGCGCCGGGG - Intronic
960639146 3:119810208-119810230 GCGCGGGCGGGCCGGCGCCGGGG + Intronic
961377308 3:126475598-126475620 GCACGGCGGCGCTGCCGCCGAGG - Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
963107619 3:141660272-141660294 TCTCCCCGGCGCCGGCGCCCTGG + Intergenic
963939492 3:151085544-151085566 GCCCGCGGGCCCCGGCGCCGAGG - Intergenic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966696288 3:182793545-182793567 GCCGGGCGGGGGCGGCGCCGGGG + Exonic
968353406 3:198080973-198080995 GCCCGGCGGCGGCTGCACCGGGG - Intergenic
968479045 4:825882-825904 GCTGGGCGAAGCCGGGGCCGCGG + Intronic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
968831604 4:2935047-2935069 GCTCCGCGGGGCAGGCGTCGTGG - Intergenic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
974385568 4:61200195-61200217 GCTAGGTGGAGCCCGCGCCGCGG + Intergenic
978795746 4:112705994-112706016 ACTCTGCGGCGCAGGAGCCGGGG + Intergenic
982712204 4:158768942-158768964 CCACGGCGGCGGCGGCGGCGCGG - Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984167524 4:176320285-176320307 GCACGGCAGCCCCGGCGCGGCGG - Intronic
984734858 4:183099381-183099403 CCTCGCCGGCGCCCGCGTCGCGG + Exonic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
984895704 4:184537648-184537670 TCTCGGAGGCGCAGGCGCAGTGG + Intergenic
985894267 5:2739622-2739644 GTCCGGCGGCGACGGCGGCGGGG - Intergenic
986330457 5:6713435-6713457 TCTCGGCGGCGACAGCGCGGGGG - Intergenic
986813632 5:11385050-11385072 GCGCGGCGGCGCGGGCAGCGTGG + Exonic
987035094 5:14011577-14011599 GCTCGGCCGCGCATGCGCCGCGG + Intergenic
987132477 5:14872044-14872066 GCCCGGGGGCGGCGGCGCTGAGG + Intergenic
989637996 5:43556794-43556816 GCTGGTCGGGGCCGGAGCCGGGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992796079 5:80256098-80256120 GCGAGGCGGGGCCGGCGGCGGGG - Intergenic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
993903816 5:93602437-93602459 GCTCGAGGACGCCGGCGCCCAGG - Intergenic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
995623897 5:114056199-114056221 GCTCGCCCGCGCCCGCGCCCCGG + Intergenic
997265107 5:132490775-132490797 GCTCGGTGGCGCCGCTGCCCTGG - Exonic
997584061 5:135034355-135034377 GCGCGGCGGCGCGGGCGGCTTGG - Intronic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1007154061 6:39725206-39725228 GCCCCGCCGCGCCGGCGCCCCGG + Intronic
1007154064 6:39725209-39725231 CCTCCGGGGCGCCGGCGCGGCGG - Intronic
1007431486 6:41779822-41779844 GCCCGGCGCCGCCCGGGCCGCGG - Exonic
1007927793 6:45663737-45663759 GCTGGGCCGCCCCGGGGCCGAGG + Intronic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1011643078 6:89433248-89433270 GCTGGGCGGCGCCGAGGCCCTGG + Intronic
1013009575 6:106107137-106107159 GCGCTGCGGCCCCGGCGCCTGGG + Exonic
1013619289 6:111872891-111872913 GCGCGGGGGCGCCGGCGGCCGGG + Intronic
1019200004 6:170306590-170306612 GCGCGCAGGCGCCGGCGGCGTGG - Intronic
1019472876 7:1230425-1230447 CCTCGGCTGCGGCGGCGCCGCGG - Intergenic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020281784 7:6653552-6653574 TTTCGGCGGCGGCGGGGCCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022351099 7:29566454-29566476 GCTGGGCGGCGCAGGTGGCGTGG - Exonic
1022923223 7:35037066-35037088 TCCCGGCGGCGCCGGCGCTAGGG + Intronic
1026017417 7:66682203-66682225 GCTCGCCCGCGTCTGCGCCGTGG - Intronic
1026470915 7:70693926-70693948 GCTGGGCCGACCCGGCGCCGGGG + Intronic
1026817190 7:73522077-73522099 GCGCGGCCGCGCCGGCGGTGAGG - Exonic
1027061898 7:75092779-75092801 CGTCGGCGGCGTCGGCGGCGGGG - Intronic
1028762336 7:94509913-94509935 GGTCGGGGGCGCCGCGGCCGCGG + Exonic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029640763 7:101817446-101817468 GCGCGGAGTCCCCGGCGCCGCGG + Intronic
1029715145 7:102321585-102321607 GCCCGGCCGCGCGCGCGCCGTGG + Exonic
1029821230 7:103149413-103149435 CCTCGGCGGAGCCAGCGCGGCGG - Intronic
1030138607 7:106284264-106284286 CCTCTGCGGCTCCGGCGCGGAGG - Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1030739040 7:113086477-113086499 GCTCGGCGGCGCCTGCGCGCTGG + Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031317272 7:120273371-120273393 GCGCGGTGGGGCCGGGGCCGGGG - Intergenic
1031629685 7:124032327-124032349 GCCCGGCGGCGACGACCCCGTGG - Exonic
1032298897 7:130668708-130668730 GCTCGCCGGCTGCGGCGCCTGGG - Exonic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032391295 7:131556729-131556751 GCCGGGCGGGGCCGGGGCCGGGG + Intronic
1033299656 7:140175809-140175831 GTTCGCCGGCACCGGCGCCCGGG + Intronic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1034441209 7:151086846-151086868 GTTCGGCGGCGCGGGGCCCGGGG + Exonic
1035212392 7:157337484-157337506 GCTCGGCGGGGCCGGCAGCGTGG + Intronic
1035587337 8:786125-786147 GCTCAGCTGGGCCGGCGCAGGGG + Intergenic
1036454056 8:8892917-8892939 GCGCGTCGGCCCCGGCCCCGGGG + Exonic
1036789478 8:11708611-11708633 GCGCGGCGACACCGGCGGCGGGG - Exonic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1038789813 8:30658248-30658270 GCTTGGCTGCCCTGGCGCCGCGG - Exonic
1038883502 8:31639657-31639679 GCTCGGGCGCGGCGGCGGCGCGG + Intronic
1039554740 8:38467906-38467928 GCCGGGAGGCTCCGGCGCCGGGG + Intronic
1039618236 8:38974159-38974181 GGCCGGCGGAGGCGGCGCCGTGG + Exonic
1040471255 8:47737626-47737648 GCGCGGCGGCTCCGGCGACGTGG + Exonic
1042040221 8:64581387-64581409 CCTGGGCGGCGGCGGCGGCGGGG + Exonic
1043502821 8:80873883-80873905 GCTCTCCGGGGCGGGCGCCGGGG + Intronic
1044257524 8:90082808-90082830 GCCCGGCAGCGCCCGCGCCCAGG - Exonic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1049273856 8:141709867-141709889 GCTGGGCTGGGCCGGCCCCGCGG - Intergenic
1049616569 8:143578150-143578172 GTTCGGCGGCGCCTTCGCCTTGG - Exonic
1049659929 8:143815407-143815429 GCTCGGCGGGCTCGGGGCCGGGG + Intergenic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1050230922 9:3525589-3525611 CCTCGGCGGCGGCGCCGCAGCGG + Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050744160 9:8857792-8857814 GCTGGGCGGCGGCGGCGACCAGG - Intronic
1052872730 9:33523963-33523985 GCCCGGCGGCGGCTGCACCGGGG + Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053752683 9:41273148-41273170 GCTCGGCGGCGGCTGCACCGGGG - Intergenic
1054258211 9:62837500-62837522 GCTCGGCGGCGGCTGCACCGGGG - Intergenic
1057152722 9:92809013-92809035 GCCCGGCGGCGGCTGCACCGTGG + Intergenic
1057488719 9:95506371-95506393 GGCCGGGGGCGCGGGCGCCGCGG + Intronic
1058861293 9:109119848-109119870 GCTCTCCCGGGCCGGCGCCGCGG - Exonic
1060263101 9:122092936-122092958 ACTGGGCTGCGCCGGGGCCGGGG + Exonic
1060283475 9:122228846-122228868 GGGCGGCGGGGCCGGCGCCTCGG - Intronic
1060479260 9:124008592-124008614 CCTCCGCGGCCCCGGCTCCGTGG + Intronic
1060555278 9:124504741-124504763 CCTCGCCGGCGGCGGCGGCGCGG - Intronic
1061275892 9:129569205-129569227 GCTACGCGGGGCCGGGGCCGGGG + Intergenic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062294779 9:135818663-135818685 GCGCCGCGGCGCAGGCGTCGTGG - Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062499522 9:136846282-136846304 GCGTGGCGGCGCCAGCGCGGGGG - Exonic
1062538535 9:137031465-137031487 GCTGGCCAGCGCCGACGCCGTGG - Exonic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1202800563 9_KI270719v1_random:170876-170898 GCCCGGCGGCGGCTGCACCGGGG + Intergenic
1203771686 EBV:52927-52949 AGTCGGCGGCGGCGGCGCTGAGG + Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471874 Un_GL000220v1:118673-118695 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185736581 X:2500739-2500761 GCTCGGGGGCGGGGGCGCGGGGG - Intronic
1186426120 X:9465278-9465300 ACTCGGCGGCGGCGGGGCGGGGG + Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1189322985 X:40097492-40097514 CCTCGGCGGGGCCGACCCCGAGG - Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic
1190062259 X:47219055-47219077 GCGCCGCCGCGCCGGCCCCGCGG + Intronic
1190329312 X:49226052-49226074 GCTCGGCGGAGGCGGCGGCTGGG + Exonic
1195668350 X:107449918-107449940 GCGCGGCAGCGGCGGCGCAGCGG - Intergenic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1198321358 X:135521414-135521436 GCCCGGCGGGGCGGGCGGCGAGG + Intronic