ID: 900269870

View in Genome Browser
Species Human (GRCh38)
Location 1:1781551-1781573
Sequence CGGGCAAGAAGCAGAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900269861_900269870 15 Left 900269861 1:1781513-1781535 CCAAAGTCCATCAGGTGTTCACC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 164
900269868_900269870 -6 Left 900269868 1:1781534-1781556 CCTTCTAGTGGGGCAGACGGGCA 0: 1
1: 1
2: 1
3: 14
4: 97
Right 900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 164
900269862_900269870 8 Left 900269862 1:1781520-1781542 CCATCAGGTGTTCACCTTCTAGT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900269870 Original CRISPR CGGGCAAGAAGCAGAATTGG TGG Intergenic
900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG + Intergenic
900332566 1:2143430-2143452 CTGGAAAGAATCTGAATTGGAGG + Intronic
900887689 1:5427138-5427160 CGTCCCAGAAGCAGAATTGTTGG + Intergenic
907875264 1:58480373-58480395 AAAGCAAGAAACAGAATTGGGGG - Intronic
912542999 1:110431088-110431110 GGAGCAAGGAGCAGATTTGGAGG - Intergenic
916540874 1:165752859-165752881 GTGGCAAGAAGAGGAATTGGAGG - Intronic
917203340 1:172541932-172541954 TGGGCAACTAGAAGAATTGGTGG + Intronic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
918115056 1:181488905-181488927 GGGGAAAGCAGCAGAATTTGAGG - Intronic
918833636 1:189431456-189431478 CAGGCAAAAAGATGAATTGGGGG - Intergenic
920683993 1:208095295-208095317 CAGGGAAAAAGCAGAAATGGAGG - Intronic
924017671 1:239744912-239744934 AGGTCAAGAAGCAGAAATTGAGG + Intronic
1071201717 10:83227010-83227032 AGGGCAAGAAGGAGAATTTGTGG - Intergenic
1072417527 10:95261564-95261586 CTTGCAAGAACCAGAATTTGAGG + Intronic
1073975908 10:109100815-109100837 GGGGCAAGAATGAGAAGTGGGGG + Intergenic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1076247470 10:128958568-128958590 CGGCCAAGAAGGAGAAATGTGGG - Intergenic
1076570644 10:131430551-131430573 TGGGAAAGAAGTAGAAATGGTGG - Intergenic
1079648817 11:22900627-22900649 AGGTCTAGAAGCATAATTGGAGG + Intergenic
1080276413 11:30507929-30507951 GTTCCAAGAAGCAGAATTGGAGG + Intronic
1083259032 11:61513288-61513310 AGGGCAAGAAACAGGGTTGGGGG + Intergenic
1083509740 11:63197483-63197505 CTGGCAAAAAGAAGAAATGGAGG + Intronic
1083882881 11:65557241-65557263 CCCGCAAGAAGCAGACTTGCTGG - Intronic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1085171233 11:74451624-74451646 CTGGGAAGAAGTAGAATTTGTGG - Intergenic
1086763808 11:90669174-90669196 CAGGCAAGAAGCAGGATTCAGGG - Intergenic
1086879685 11:92138765-92138787 CGGGCAAGAAGCAGGTTCAGTGG + Intergenic
1087781461 11:102305165-102305187 TGGGGAAGAAAAAGAATTGGAGG + Intergenic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1091280995 11:134381570-134381592 AGGGGAAGAGGCAGACTTGGGGG + Intronic
1091571442 12:1690657-1690679 TGGGCAAGAGCCAGAATTTGAGG - Intronic
1091726190 12:2848292-2848314 AGGGGAAGAAGCTGAAATGGTGG - Intronic
1092111803 12:5969688-5969710 CGGCCAAGAAGCAGCACTGTGGG + Intronic
1095136089 12:38605783-38605805 TGGGCAAGAAGGAGAAAAGGGGG + Intergenic
1096201087 12:49683659-49683681 TGGGAAGGAACCAGAATTGGAGG - Intronic
1100888135 12:99095199-99095221 CGACCAAGAAACAGAATTGCTGG - Intronic
1101878971 12:108613708-108613730 GGAGCCAGAAGCAGAACTGGGGG - Intergenic
1102231113 12:111263130-111263152 GGGGCAAGAAGGAGAAATGAAGG - Intronic
1103488267 12:121296966-121296988 AGGGCAAGGAGCAGAAAGGGAGG + Intronic
1104067390 12:125317021-125317043 AGGGCTGGAAGCAGAATGGGGGG + Intronic
1108857974 13:54819546-54819568 CGGGCTTGAAGTGGAATTGGGGG + Intergenic
1110544949 13:76745752-76745774 CCAGCATGAAGCAGAAATGGTGG - Intergenic
1112806280 13:103166984-103167006 CGGGTAAGATGCAAAGTTGGTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1119417603 14:74484329-74484351 TGGGCAAGAAGCAGAGATGGGGG - Intronic
1120884311 14:89440175-89440197 AGGCCAAGAAGCAGCACTGGTGG - Intronic
1123066263 14:105620993-105621015 CGGGCAAGACTCAGCCTTGGTGG - Intergenic
1123070405 14:105640045-105640067 CGGGCAAGACTCAGCCTTGGTGG - Intergenic
1123074996 14:105663705-105663727 CGGGCAAGACTCAGCCTTGGTGG - Intergenic
1123089641 14:105736833-105736855 CGGGCAAGACTCAGCCTTGGTGG - Intergenic
1123095434 14:105764993-105765015 CGGGCAAGACTCAGCCTTGGTGG - Intergenic
1124358890 15:29019837-29019859 AGAGCAAGAAGCAGAAGTGCTGG + Intronic
1132573010 16:652160-652182 CTGGCAAGGAGCAGAGCTGGCGG + Intronic
1134783252 16:16917774-16917796 GTGGCAAGAAGTGGAATTGGAGG + Intergenic
1135383443 16:22013409-22013431 AGGGAAAGAAGGAGACTTGGGGG + Intronic
1135399031 16:22152905-22152927 TGGGAAAGAAGCAGGATTTGAGG + Intronic
1136409404 16:30067370-30067392 CGGGCAGGAGACAGAATGGGTGG + Intronic
1136535558 16:30896981-30897003 CGGGAAAGAATCAGAGCTGGGGG + Intronic
1140130454 16:72156316-72156338 GCGGCAAGAATCAGTATTGGAGG + Intronic
1141997858 16:87646693-87646715 TGGACAAGAAGCAGTTTTGGGGG + Intronic
1142009553 16:87706897-87706919 AGGGCTAGAAGCTGACTTGGTGG - Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1145223305 17:21106839-21106861 CGGCAAAGAAGCATAATTTGGGG + Intergenic
1146635278 17:34499503-34499525 AGGGAAAGGAGCAGAATTGGGGG + Intergenic
1148271150 17:46262845-46262867 AGAGCAAAAAGCAGAATTGATGG + Intergenic
1150601002 17:66650991-66651013 CAGGCATGAAAAAGAATTGGCGG + Intronic
1150742183 17:67788225-67788247 CTAGCAAGAAATAGAATTGGAGG - Intergenic
1150966361 17:69973650-69973672 CAGACAAGAGGTAGAATTGGAGG - Intergenic
1151538053 17:74749624-74749646 CAGGGAAGGAGCAGGATTGGGGG - Intronic
1152234561 17:79132019-79132041 CAGGCAAGACGCAGAGTAGGTGG - Intronic
1152716573 17:81903266-81903288 GGGGCAAGGAGGAGAGTTGGGGG + Intronic
1153198455 18:2625762-2625784 CGGGAAAAAAGCAAAAATGGTGG + Intergenic
1155325300 18:24658487-24658509 GGGGCCAAAAGCAGAAGTGGGGG + Intergenic
1157608933 18:48943934-48943956 CGGGCGAGGGGCAGAAGTGGAGG + Intronic
1159415200 18:68138093-68138115 CAGGCAACAAACAGAATGGGAGG - Intergenic
1159734167 18:72073756-72073778 TGGGACAGAAACAGAATTGGAGG + Intergenic
1162300384 19:9841715-9841737 AGAGCAAGAAGAAGAAGTGGAGG + Intronic
1162865668 19:13544788-13544810 AGGTTTAGAAGCAGAATTGGAGG - Intronic
1165380011 19:35472569-35472591 GGGGCAAGAGGCAGGAATGGAGG - Intergenic
1167299531 19:48670890-48670912 CTGGCGGGAGGCAGAATTGGGGG + Exonic
1167326966 19:48832604-48832626 CGTGCAGGAAACAGAGTTGGGGG + Intronic
1167428517 19:49441724-49441746 TGGGGAAGGAACAGAATTGGGGG - Intronic
925636530 2:5946549-5946571 CAAGCAGGAAGAAGAATTGGAGG - Intergenic
925723529 2:6851472-6851494 CAGGGAAGAAGCAGAACTTGAGG - Exonic
926037282 2:9645716-9645738 CGGGCAAGGACCAGGACTGGGGG - Intergenic
927845143 2:26467502-26467524 CTGGCCAGAAGCAGAAAAGGAGG + Intronic
928515444 2:32040191-32040213 GGGGGAAGAAGCAGTTTTGGGGG + Intergenic
929719241 2:44350672-44350694 GGGGTAAGGAGAAGAATTGGAGG - Intronic
930221691 2:48752889-48752911 CGGAAAATAAGCAGAATTGAGGG - Intronic
931424251 2:62156736-62156758 TGTGAAAGGAGCAGAATTGGAGG - Intergenic
934526582 2:95055884-95055906 CCAGCAAGAAGCAGCTTTGGGGG - Intergenic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
936072036 2:109377438-109377460 CGGGGAAGAAGCAGAGCTGGAGG + Intronic
938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG + Intergenic
939728076 2:145748187-145748209 TGGGGAAGAAGCAGATTTGGGGG + Intergenic
940233039 2:151478603-151478625 GAGGCAAGAAACAAAATTGGGGG + Exonic
940435697 2:153651190-153651212 TGTGCAAGAAGCAGAAGTGTTGG + Intergenic
941070412 2:160948441-160948463 CATGCATGAAGCAGACTTGGTGG + Intergenic
942034712 2:171999779-171999801 CGGGCAAGCAGCAGAACCCGCGG - Exonic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
944206580 2:197164134-197164156 TGGGCTAGAACCAGAGTTGGTGG + Intronic
944555950 2:200888139-200888161 CGGGCAAGTAGGAGATTGGGAGG - Intronic
1170588882 20:17756030-17756052 AGGGTAGGAGGCAGAATTGGGGG + Intergenic
1170775604 20:19372262-19372284 AGGGAAAGAAGCAGAAGTTGAGG + Intronic
1172326498 20:34039755-34039777 CTGGCAGGAATCTGAATTGGGGG - Intronic
1173005769 20:39138624-39138646 TCAGCAGGAAGCAGAATTGGGGG - Intergenic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1173744445 20:45425814-45425836 AGGGCAAGAATCAGAGTGGGGGG - Exonic
1175018056 20:55813023-55813045 TGGGGAAGAAGCATATTTGGTGG + Intergenic
1179613010 21:42564634-42564656 CGGGGAGGAAGCAGAACTGCAGG - Intronic
1182504235 22:30770709-30770731 CGGGAGAGAACCAGAAATGGGGG - Intronic
1185316973 22:50183523-50183545 GGGGCGAGAAGCAGAAAAGGGGG - Intergenic
952240699 3:31529069-31529091 AGGACAAGCAGCAGATTTGGAGG - Intergenic
953447676 3:42981344-42981366 CTGGCTAGAAGCAGCATGGGAGG + Intronic
967576004 3:191093934-191093956 CTGGGAAGAAACAGAAATGGTGG - Intergenic
969436281 4:7191481-7191503 TGGGAAAGATGGAGAATTGGGGG - Intergenic
972356894 4:38287823-38287845 AGGGCAAGAGACAGAATTGAAGG + Intergenic
974859518 4:67502719-67502741 TGGGGAAGAAGCAGATTTTGAGG - Intronic
976688932 4:87847137-87847159 AGGGCAAGAGGGAGAATTTGAGG + Intergenic
978843895 4:113248947-113248969 TGGGCAAAAAGCAGAGTGGGTGG - Intronic
979946319 4:126836387-126836409 CAGACAAGAAACAGAATGGGAGG + Intergenic
988848140 5:35151003-35151025 AGGGCAAAAATCAGAATTGAGGG + Intronic
991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG + Intergenic
991250388 5:64554056-64554078 AGGGCAAAGAGCAGATTTGGAGG - Intronic
991393939 5:66183867-66183889 CTAGCAAGAAGCTGAATTTGTGG - Intergenic
991460917 5:66857417-66857439 ATGCCAAGAAGCAGAATTGCTGG + Intronic
993625189 5:90215359-90215381 TGGGAAGGAAGAAGAATTGGGGG + Intergenic
997771823 5:136562126-136562148 TGGGTAAGGAGAAGAATTGGAGG + Intergenic
1000097768 5:157986411-157986433 CGGCCAAGCAGCACAAGTGGAGG + Intergenic
1002142805 5:177154555-177154577 CGGGAAAGCACAAGAATTGGAGG - Intronic
1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG + Intergenic
1003179420 6:3779477-3779499 CTGGCAATAAGCAAAAATGGTGG - Intergenic
1005132984 6:22533668-22533690 TGAGCAAGAAGCACAAGTGGAGG + Intergenic
1005662902 6:28018400-28018422 CGGGCTAGAGGGAGAATTTGCGG - Intergenic
1005687039 6:28263255-28263277 CGGGCTAGAGACAGAATTGGGGG + Intergenic
1006437003 6:34030951-34030973 GGGGCAAGGAGCAGAACTGGCGG - Intronic
1008612588 6:53197823-53197845 AGGGAAAGAAGCAGAGATGGAGG + Intergenic
1008842516 6:55920973-55920995 CGGGAAAAAAGCAGCGTTGGGGG + Intergenic
1008886842 6:56440644-56440666 CTGGCAAGAAGCCCAGTTGGAGG + Intergenic
1009483299 6:64188638-64188660 AGGGCAAGAAGAAAAATTGTTGG - Intronic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012283134 6:97353899-97353921 GAAGCAAGAAGCAAAATTGGAGG - Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1016046115 6:139482355-139482377 AGAACAAGAAGCAGAAGTGGAGG - Intergenic
1016516160 6:144895034-144895056 CAGGAAAGAAGCAGAAGCGGTGG - Intergenic
1018379569 6:163245989-163246011 CAGGCAAGAGGCAGAGGTGGAGG - Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022308261 7:29171140-29171162 CAGGCAAGAGTCAGAACTGGGGG - Intronic
1023267736 7:38425620-38425642 AGGGCAGGAAGCAGAAGAGGGGG + Intronic
1024516786 7:50266174-50266196 GGGGCAGGAAGAAGAGTTGGTGG - Intergenic
1030448149 7:109673382-109673404 CAGGGATGAAGCAGACTTGGTGG - Intergenic
1032274570 7:130442934-130442956 CCGGCCAGAATCAGAATTGAGGG - Intergenic
1032540879 7:132702072-132702094 CAGGCAGGAAGAAGAATTGGTGG + Intronic
1032692237 7:134299783-134299805 AGGGCAAGAACCATAATTTGGGG - Intronic
1034487484 7:151374966-151374988 CGGGCAGGAAGCAGAGTGGTAGG + Intronic
1038458439 8:27694613-27694635 CGGTTGAGAAGCAGAATTAGGGG + Intergenic
1040724208 8:50362065-50362087 AGGGCAGGAAGCACATTTGGGGG - Intronic
1043446618 8:80325537-80325559 CGTGAGAGAAGCAGAACTGGGGG + Intergenic
1046964332 8:120147002-120147024 AGGGAGAGAGGCAGAATTGGAGG - Intronic
1050610109 9:7343355-7343377 CAGGCAAGAAGCAGAAACTGAGG + Intergenic
1053176746 9:35931216-35931238 CCGACAAGAAGCAGAATAAGGGG - Intergenic
1053290096 9:36874051-36874073 CAGGCAAGACGCAGAATCAGGGG + Intronic
1054828659 9:69599029-69599051 AGAGCAAAAAGTAGAATTGGTGG + Intronic
1056462002 9:86817565-86817587 TGGGAAAGGAGCAGACTTGGTGG + Intergenic
1060128610 9:121074556-121074578 CGCGCAAGCATCAGAAGTGGGGG + Intergenic
1060269477 9:122130727-122130749 CAGGCCAGATGCAGAACTGGGGG - Intergenic
1185588410 X:1257565-1257587 CTGTGTAGAAGCAGAATTGGTGG - Intergenic
1186539069 X:10381878-10381900 CCTGCAAGCAGCAGAAATGGGGG - Intergenic
1186858306 X:13646834-13646856 TGGGCTAGAAGCAGAACTGTGGG + Intergenic
1190356218 X:49607962-49607984 CCAGTAAGAAGCAGATTTGGGGG + Exonic
1198043800 X:132879927-132879949 CAGGCAAGAACAAGAAGTGGAGG - Intronic
1198279019 X:135124097-135124119 CTGGCTAGAAGTAGAATTGTAGG - Intergenic
1198291939 X:135248423-135248445 CTGGCTAGAAGTAGAATTGTAGG + Intergenic
1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG + Intronic
1200240919 X:154493190-154493212 CTGGCAAAAACAAGAATTGGTGG - Intergenic
1201458986 Y:14201564-14201586 AGGGAAAGAAGGAGAAATGGGGG + Intergenic