ID: 900278218

View in Genome Browser
Species Human (GRCh38)
Location 1:1847131-1847153
Sequence CACTGAAGGCAGGCAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 2, 1: 0, 2: 12, 3: 84, 4: 712}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900278209_900278218 20 Left 900278209 1:1847088-1847110 CCACAAAGGACACTTATTAGTAA 0: 4
1: 47
2: 72
3: 84
4: 231
Right 900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG 0: 2
1: 0
2: 12
3: 84
4: 712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900278218 Original CRISPR CACTGAAGGCAGGCAGGGAG AGG Intronic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
900567950 1:3343929-3343951 TACTGAAACCAGGCTGGGAGCGG - Intronic
901448237 1:9320920-9320942 CACTGGAGCCTGGCAGGGGGAGG - Intronic
901460461 1:9388161-9388183 CACAGCTGGCAGGCAGGGACTGG + Intergenic
901624661 1:10617225-10617247 CACAGAGGGCAAGAAGGGAGTGG - Intronic
902052719 1:13577009-13577031 CATTGGAGGGAGGCAGGGTGGGG + Intergenic
902112842 1:14097394-14097416 CATTCCAGGCAAGCAGGGAGTGG - Intergenic
902217033 1:14940767-14940789 CTCTGGAAGCAGGCAGGAAGAGG + Intronic
902259283 1:15212416-15212438 GAATGAGGGCAGGCAGTGAGGGG + Intronic
902343795 1:15801109-15801131 CACGGAGGGCAGGCAGGCTGAGG + Intergenic
902515691 1:16988302-16988324 CAGGTAAGGCAGGCAGGGACCGG - Exonic
902654941 1:17860599-17860621 CAATGAATGGTGGCAGGGAGGGG - Intergenic
903471097 1:23587987-23588009 TCCTGAAGGCAGGAAGGGAAGGG + Intronic
903571924 1:24311959-24311981 AACAGGAGGCAGCCAGGGAGAGG - Intergenic
903956499 1:27029665-27029687 CCCTGCAGGGAGGCAGGCAGAGG + Intergenic
904397447 1:30231326-30231348 CAGTGTGGGAAGGCAGGGAGAGG - Intergenic
904635675 1:31879034-31879056 CACTTAAGTCAGGGAGGCAGAGG + Intergenic
905227007 1:36485653-36485675 CTCTGAAGAAAGACAGGGAGAGG - Intergenic
905380947 1:37561247-37561269 TACCTAAGGCAGGAAGGGAGGGG + Intronic
905539392 1:38747898-38747920 AACTGAAGCCAGACAGGGAAAGG + Intergenic
905796483 1:40819113-40819135 GACTCAAGGCAGGCGGGGTGAGG + Intronic
905865906 1:41376526-41376548 CACTGAGGGGTGCCAGGGAGAGG - Intronic
905923485 1:41733997-41734019 CACAGCAGCCAGGCAGGAAGGGG - Intronic
905979933 1:42215865-42215887 AAATGAAGGCAGGCTGGGCGTGG + Intronic
906352805 1:45078666-45078688 CACAGATGGTAGCCAGGGAGTGG - Intronic
906532566 1:46532131-46532153 CAGTGCAGGCCGGGAGGGAGGGG - Intergenic
906612993 1:47216126-47216148 CCCTGAAGGCAGGCCTGGTGGGG - Intergenic
906662359 1:47592318-47592340 CACTGAGAGCTGGCAGTGAGGGG + Intergenic
906773380 1:48505607-48505629 CACTGAAGGGAGGAAGGGAAGGG + Intergenic
906808282 1:48801281-48801303 CGGTGTGGGCAGGCAGGGAGGGG - Intronic
906845822 1:49190691-49190713 CAGTGAAAGGAGGCTGGGAGAGG - Intronic
907256558 1:53183447-53183469 GAATCAAGGCAGGCAGGGTGGGG + Intergenic
907592331 1:55686932-55686954 GACTGAAGGCAGGCAGGAAGGGG - Intergenic
909500800 1:76333056-76333078 CACTAATGGCAGGCAGGGAATGG - Intronic
910684252 1:89900166-89900188 CACTGATGGCAGGCAAAGACAGG + Intronic
911620807 1:100064978-100065000 CACTTGAGGCAGGGAGGTAGAGG - Intronic
912382487 1:109254954-109254976 CACCAAAGGCAGGCTGGGTGTGG - Intronic
912556472 1:110519859-110519881 CACTGAACCCAGGCAGGCTGGGG + Intergenic
913196748 1:116463016-116463038 CACTGAAGCCAGGAAAGCAGAGG - Intergenic
913987939 1:143583011-143583033 CACTGAAGCATGGCAGGGGGAGG - Intergenic
914348146 1:146817291-146817313 CACAGGAGGCAGGCAGCAAGGGG + Intergenic
914507958 1:148305781-148305803 CACTTGAGCCAGGCAGGCAGAGG - Intergenic
915124537 1:153654416-153654438 AGGTGAAGGCAGGCAGGAAGGGG + Intergenic
915287019 1:154859559-154859581 CCCTGCAGGGAGGCAGGGAGAGG - Intronic
915339093 1:155166710-155166732 CGCCCAGGGCAGGCAGGGAGGGG - Intergenic
915491408 1:156251946-156251968 GACCGAAGCCAGCCAGGGAGGGG - Intronic
915515258 1:156409057-156409079 CACTGAGGCCAGGCCAGGAGAGG + Intronic
916002594 1:160631312-160631334 CCCTGCAGGCTGGCAGGGTGGGG + Intronic
916169464 1:161989818-161989840 CACTGAACTCAGGCACGTAGTGG - Intronic
916666642 1:166973624-166973646 CACTGAAGTCAGCCAGGCATCGG - Intronic
917163956 1:172090674-172090696 AACTGAAGGTGGGCAGGGGGTGG - Intronic
917670656 1:177270516-177270538 CATTGGTGGCAGGCAGGGATGGG + Intronic
918042287 1:180920692-180920714 CACAGCAGGCAGGCTGGGGGCGG + Intronic
918139453 1:181708148-181708170 GGCTGTAGGCAGGCAGGGGGTGG + Intronic
918311743 1:183290041-183290063 CACAGAAACCAGGCAGGGAGAGG - Intronic
919395446 1:197041608-197041630 CCCTGTAGGCAATCAGGGAGGGG - Intronic
919917903 1:202150423-202150445 CACTGGAGATAGCCAGGGAGGGG + Exonic
919972412 1:202589826-202589848 CAGTGAATGCAAGCAGGGATGGG - Exonic
919979831 1:202635973-202635995 CAGTGCAGGGAGGCAGGCAGGGG - Intronic
920047073 1:203140255-203140277 GGCTTGAGGCAGGCAGGGAGTGG + Intronic
920176136 1:204103019-204103041 CCCTGGGGGCAGGGAGGGAGAGG + Intronic
920541990 1:206785626-206785648 CAGAGAGGGCAGCCAGGGAGAGG + Intergenic
921471756 1:215557742-215557764 CACTGAAAGCATGGAAGGAGAGG - Intergenic
922160684 1:223077573-223077595 CACAGAAGGATGGAAGGGAGGGG - Intergenic
922867655 1:228873865-228873887 CACTGAAGGAGGGCTGGGATGGG + Intergenic
922903600 1:229157219-229157241 TGCAGAAGGCAGGCAGGGTGAGG + Intergenic
923563412 1:235058995-235059017 GAAAGAAGGCAGGCAGGCAGTGG + Intergenic
923852545 1:237813135-237813157 CCCTGAAGGCAGGAGGGGAGTGG + Intronic
924712754 1:246544155-246544177 CACTGAAGACAAGCAATGAGAGG + Intronic
924716984 1:246584793-246584815 TACCGGAGGCAGGGAGGGAGTGG - Intronic
1062787789 10:279649-279671 CAGTGCAGGGAGGCTGGGAGAGG + Intronic
1062799418 10:368408-368430 CACAGCTGGGAGGCAGGGAGTGG + Intronic
1062883284 10:995827-995849 CACTGCAGGCGTGGAGGGAGAGG + Intronic
1062983510 10:1745360-1745382 CACTGACCACAGGGAGGGAGTGG + Intergenic
1063100052 10:2942448-2942470 GAACGAAGGCAGGCAGGAAGGGG - Intergenic
1064668311 10:17680947-17680969 GACTGAAAGCAGGCAGGGTCTGG - Intronic
1065008705 10:21402704-21402726 CTCTGGATGCAGGCAGGGAGAGG - Intergenic
1065151124 10:22824494-22824516 CCCTGAAGCCAGGTAGGGTGAGG - Intergenic
1066201971 10:33150671-33150693 CACTGAAGTCTGGGAGGGATGGG + Intergenic
1066648518 10:37634695-37634717 CCCTGCAGGCAGGGAGGCAGTGG - Intergenic
1067829892 10:49605481-49605503 GGCTGGGGGCAGGCAGGGAGTGG + Intergenic
1068072292 10:52210262-52210284 AACATAAGGCAGGCAAGGAGAGG - Intronic
1068310441 10:55267101-55267123 GAATAAAGGAAGGCAGGGAGGGG + Intronic
1069197645 10:65572549-65572571 AACTGAAACCAGGCTGGGAGCGG + Intergenic
1069388883 10:67911617-67911639 AACGGAAGGGAGGGAGGGAGGGG - Intronic
1069515951 10:69077372-69077394 GACTGAATGGAGGGAGGGAGAGG - Intergenic
1069558921 10:69416065-69416087 CATTGAAGGCAGCCATGCAGAGG + Exonic
1069571612 10:69497745-69497767 CAGGGAGGGGAGGCAGGGAGGGG + Intronic
1069607888 10:69751571-69751593 GGCTGCAGGCAGGAAGGGAGAGG + Intergenic
1069792229 10:71030072-71030094 CCCTGAAGGCAGGCAGGGCCAGG - Intergenic
1070497097 10:77034573-77034595 CACTGAATGCAGGGAGGTAGAGG + Intronic
1070540785 10:77413698-77413720 AAGTGATGGCAGCCAGGGAGAGG - Intronic
1070629062 10:78071449-78071471 CAATGAAGGCAACCAGGCAGAGG - Intergenic
1070689672 10:78515328-78515350 CAATGAGGGCCAGCAGGGAGGGG + Intergenic
1071354932 10:84784538-84784560 CACCCCAGGCAGGGAGGGAGTGG - Intergenic
1071453068 10:85817938-85817960 CACTGAAGGCAGTGGGGGAAAGG + Intronic
1071793564 10:88981672-88981694 CACTGTAGGGAGGGAGAGAGAGG + Intronic
1073049818 10:100660255-100660277 TACTGAAGGAAGGCAGTGGGTGG + Intergenic
1073076431 10:100827866-100827888 CAGTCCAGGCAGGCGGGGAGGGG - Exonic
1073148917 10:101298519-101298541 CACTGAGGGCTGGCGGGGAATGG + Intergenic
1073203974 10:101758821-101758843 CCTTGGAGGCAGGCAGGGAAGGG + Intergenic
1073267315 10:102235532-102235554 CACTGAAGGCAAGTAGGGAAGGG - Intronic
1073498110 10:103912435-103912457 CAGTGCAGGCAGGCAGGGGCAGG - Intronic
1073517349 10:104088447-104088469 AAGTGAAGGGAGGCAGGCAGCGG + Intergenic
1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG + Intronic
1073981278 10:109156569-109156591 TGCTGAAGGCAGGCTGGCAGGGG - Intergenic
1074035729 10:109736360-109736382 TCCTGAAGGCTGGCAGGGTGGGG - Intergenic
1074419793 10:113298784-113298806 CACTGAAGGATGGCAGTGTGGGG + Intergenic
1075075755 10:119349192-119349214 CATGGGAGGGAGGCAGGGAGGGG + Intronic
1075409856 10:122219306-122219328 CACTGAAGGCGGGCAGAGCCAGG - Intronic
1075699823 10:124462037-124462059 CCCTGCCGGCAGCCAGGGAGCGG - Intronic
1075880565 10:125847227-125847249 CATGGAAGGGAGGGAGGGAGGGG + Intronic
1076187036 10:128458201-128458223 TTCTGAAAGTAGGCAGGGAGGGG + Intergenic
1076224102 10:128759405-128759427 CACTGAAGCCTGGCAGGAGGTGG - Intergenic
1076244510 10:128936023-128936045 CACTGAAGGCAGCCTGGGTCGGG - Intergenic
1076401363 10:130187606-130187628 CACAGAAGGCAGGCAATGAGAGG - Intergenic
1076482731 10:130795507-130795529 CACTGCAGGTATCCAGGGAGTGG - Intergenic
1076484044 10:130804446-130804468 CAGTGAGGCCAGGGAGGGAGTGG + Intergenic
1076499347 10:130924240-130924262 CACGAAAGGGAGGCAGGGAGAGG - Intergenic
1076603922 10:131677228-131677250 ATCTGAAGGCAACCAGGGAGGGG + Intergenic
1076635564 10:131880114-131880136 CCCTGGAGGCAGGCAGGGTGGGG + Intergenic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1076765956 10:132633202-132633224 CACTAAAGGGAGCCAGGCAGGGG - Intronic
1076790459 10:132774543-132774565 CCCAGAAGGCAGGCTGGGTGGGG - Intronic
1077041429 11:525814-525836 CACTTAAGCCAGGCAGGTTGAGG + Intergenic
1077326393 11:1965832-1965854 CACTGAAGGCCAGAAGGGTGGGG - Intronic
1078217527 11:9324206-9324228 CATTAAAGGCAGGCTGGGTGCGG - Intergenic
1078467024 11:11558001-11558023 AACTGAAGGCAGTGAGGCAGGGG + Intronic
1078666311 11:13328526-13328548 CTCAAAAGCCAGGCAGGGAGTGG - Intronic
1078672310 11:13376343-13376365 CACTGCAGGCTGGCAGGAGGAGG + Intronic
1078959476 11:16248207-16248229 CACTGAAAGCAGCCAGGGGTTGG - Intronic
1079464232 11:20713590-20713612 CAATGTGGGCAGACAGGGAGGGG - Intronic
1080567527 11:33525646-33525668 AGCTGCAGGCAGGCAGGGAGAGG + Intergenic
1081132953 11:39402877-39402899 AAAGGAAGGCAGGCAGGCAGCGG - Intergenic
1082749628 11:57002213-57002235 CACCCAAGCCAGGAAGGGAGTGG + Intergenic
1082768478 11:57187216-57187238 CACAGAAGCCAGGGAGGGTGAGG - Intronic
1083264167 11:61538503-61538525 GAGTGGAGGCAGGGAGGGAGGGG + Intronic
1083384383 11:62296774-62296796 CTCTGAAGCCAGGCAGGGCAGGG + Intronic
1083678642 11:64341400-64341422 CACTGAGGGGAGACAGGAAGGGG - Exonic
1084092254 11:66886305-66886327 CAGGGAGTGCAGGCAGGGAGAGG + Intronic
1084108490 11:66997187-66997209 CACTGAGGTCAGGCAGGGCGTGG + Intergenic
1084163484 11:67364082-67364104 CACCAGAGGCAAGCAGGGAGTGG + Intronic
1084266910 11:68009886-68009908 CATTGAGGGAAGGCTGGGAGTGG + Intronic
1084326389 11:68402792-68402814 CACTGCAGGCTGACAGGCAGCGG - Intronic
1084913305 11:72408747-72408769 CACTGAGGGGAGGCAGGGGAGGG - Intronic
1084952214 11:72672877-72672899 CACTGATGCAGGGCAGGGAGGGG - Intronic
1085038437 11:73313201-73313223 CAGAGAGAGCAGGCAGGGAGTGG + Intronic
1085307689 11:75497461-75497483 TCCAGGAGGCAGGCAGGGAGTGG - Intronic
1085449518 11:76623470-76623492 CACAGAAGGAAGGAAGGGAGTGG + Intergenic
1085472955 11:76769665-76769687 CACAGAGGGCAGGAGGGGAGGGG - Intergenic
1085989452 11:81824140-81824162 CACAAAAGGCAGTCAGGAAGAGG + Intergenic
1086086522 11:82960949-82960971 CACTCAAGGCAGGCAAGGGGTGG - Intronic
1086658654 11:89387435-89387457 CAGTGAAGGGAGACAGGGATGGG - Intronic
1089051675 11:115550917-115550939 CAGTTATGGCAGGGAGGGAGGGG + Intergenic
1089640213 11:119843053-119843075 CGCTGAAGGCAGAATGGGAGAGG + Intergenic
1089838847 11:121396257-121396279 GACAGAAGGCATGCAGGCAGGGG - Intergenic
1090094429 11:123729561-123729583 GGCAGAAGGCAGGCAAGGAGGGG - Intronic
1090244897 11:125209178-125209200 CACTTAAGGGAGTCAGGGTGGGG + Intronic
1090312409 11:125753224-125753246 AACAGAAGGCAGGCAGGGCGCGG + Intergenic
1090404053 11:126466752-126466774 CAGTGAAGGGAAGCAGGGAAGGG - Intronic
1090688161 11:129148668-129148690 CACTGGTGACAGACAGGGAGGGG + Intronic
1091281133 11:134382531-134382553 CACTGCGGACAGGCAGGGAAAGG - Intronic
1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG + Intergenic
1091368163 11:135038855-135038877 TCCTGAAGGCAGGCAGGGCCAGG + Intergenic
1202809374 11_KI270721v1_random:21011-21033 CACTGAAGGCCAGAAGGGTGGGG - Intergenic
1091452490 12:581964-581986 CAGTGCAGGGAGCCAGGGAGAGG - Intronic
1091549577 12:1527859-1527881 CTCTGAAGGCAGGCACTGATGGG - Intergenic
1091619619 12:2076512-2076534 AAGTGAAGGGAGGAAGGGAGGGG - Intronic
1091820543 12:3472415-3472437 CACTGAAGGCAGGACAGGAGTGG + Intronic
1091920553 12:4301060-4301082 GACTGGGGGCAGGAAGGGAGGGG - Exonic
1092083416 12:5736534-5736556 CACTGGAGGGAGGGAGGCAGGGG - Intronic
1093003187 12:14022752-14022774 AAATGAAGGCAGGCTGGGTGAGG - Intergenic
1094534341 12:31307711-31307733 GAATGAAGGCAGTAAGGGAGAGG + Intronic
1096652182 12:53067265-53067287 CAGGGAGGGCAGGCAGGGGGAGG + Intronic
1096869431 12:54584120-54584142 TACTGAAGGCAGGAAGGTGGTGG - Intronic
1098139486 12:67437267-67437289 GCCAGAAGGCAGGCAGGGAGGGG - Intergenic
1098394689 12:70005587-70005609 CCCTTAAGGCAAGGAGGGAGAGG + Intergenic
1098726360 12:73972784-73972806 CACTGAAGCCAGTCAGGGGGTGG + Intergenic
1099049638 12:77767493-77767515 CACTGGAGCCAGGGATGGAGTGG + Intergenic
1100253168 12:92852715-92852737 CTTTGAAGGCAGGCAGCTAGAGG + Intronic
1100527337 12:95432125-95432147 GTCAGAAGGCAGGCACGGAGAGG + Intergenic
1100592798 12:96045023-96045045 CACTGAAGGGAGGAAGAGAAGGG - Intergenic
1102194187 12:111012719-111012741 CACTAGAGGCAGGCAGGAAGGGG - Intergenic
1102424940 12:112836470-112836492 CACTGAAGGAAGGCAGAGAAAGG - Exonic
1102496290 12:113321347-113321369 CACTGCAGGAAGACAGGGAGGGG + Exonic
1102565124 12:113792052-113792074 GAAAGAAGGCAGGAAGGGAGAGG + Intergenic
1102913671 12:116737553-116737575 GAAGGAAGGGAGGCAGGGAGAGG + Intronic
1103183143 12:118932499-118932521 CACTGGAGGCTGGGAGGCAGAGG - Intergenic
1103301513 12:119931130-119931152 CACTTGAGGCTGGAAGGGAGAGG + Intergenic
1103521297 12:121538072-121538094 CGCGGAAGGAAGGCAGCGAGCGG - Intronic
1103685092 12:122725970-122725992 CATGGCAGGCAGGCAGGCAGAGG - Intergenic
1104032883 12:125078116-125078138 CACTGGAAACAGGCAGTGAGTGG + Intronic
1104512368 12:129392346-129392368 TACTGAGGCCAGGCAGGGGGCGG - Intronic
1104734507 12:131128725-131128747 CACTGAAGGCCGCCATGGGGTGG - Intronic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1107835890 13:44412373-44412395 TACTGAAAGCAGGGAGGGAAAGG - Intergenic
1107975428 13:45683847-45683869 GACAGAAGGCAGCCTGGGAGAGG - Intergenic
1108320346 13:49283353-49283375 CACTGAAAGAAGGCAGAGATGGG + Intronic
1108566082 13:51699279-51699301 CACTGAAGGAAGGGATGGAGAGG - Intronic
1109148991 13:58820451-58820473 TACTGAAGACAGGCTGGGTGTGG - Intergenic
1109458673 13:62626488-62626510 CACTGAAGGAAGGAAGGGAATGG - Intergenic
1109812236 13:67528444-67528466 CACTGAAGCCAGGGAGGTTGAGG + Intergenic
1109850533 13:68057312-68057334 CACTGCAGCCAGGCAGGCATAGG - Intergenic
1110563202 13:76931284-76931306 GACTGAAGGCAGGAAGGAATAGG - Intergenic
1110926395 13:81159543-81159565 AAGTGAAAGCAGGCAGGGAAGGG - Intergenic
1112391864 13:98992401-98992423 AACTGAAGGGAAGCTGGGAGGGG - Intronic
1112547918 13:100389750-100389772 ACCTGGTGGCAGGCAGGGAGGGG + Intronic
1112572470 13:100606660-100606682 CACTGCAGGGAGGCAGGTGGTGG - Intronic
1112770785 13:102792717-102792739 CACTGACAGCAGCCAGGAAGAGG + Intronic
1112794939 13:103046688-103046710 GAATGAAGGCAGGGAGGGAATGG - Intronic
1112989038 13:105488192-105488214 CACAGAAGGCAGGCAGGTTGGGG - Intronic
1113238578 13:108311579-108311601 CACTGAAGAAGGGCATGGAGAGG + Intergenic
1113541881 13:111115496-111115518 CCCGGGAGGCAGGCGGGGAGGGG - Exonic
1113580735 13:111426793-111426815 CTCTGGAGCCAGGCAGGGAGAGG - Intergenic
1113639202 13:111945038-111945060 CGCTGAGGGCAGGCTGGAAGGGG - Intergenic
1113743425 13:112726209-112726231 CACTGCATGCGTGCAGGGAGAGG + Intronic
1113743456 13:112726341-112726363 CACTGCATGCGTGCAGGGAGAGG + Intronic
1114455792 14:22852851-22852873 GATTAAGGGCAGGCAGGGAGTGG - Intergenic
1115001121 14:28420763-28420785 CACAGAGGGCTGGCAGGGTGAGG + Intergenic
1115402212 14:32974688-32974710 CTCTCAAGGCAGGAAGGGTGAGG + Intronic
1115773789 14:36693385-36693407 TGCTGATGACAGGCAGGGAGGGG + Intronic
1117028476 14:51646026-51646048 CACTGAAGAGAGGCCGGGTGCGG + Intronic
1117249574 14:53923000-53923022 CACTGAAACCAGGGAGGCAGAGG - Intergenic
1117613561 14:57508877-57508899 CAGTGATGGAAGGCAGGGAATGG - Intergenic
1117735535 14:58765163-58765185 CAATAATGGCAGGCAGGGAGGGG - Intergenic
1117960302 14:61155635-61155657 CTCTTAAGGCAAGTAGGGAGTGG + Intergenic
1118387844 14:65271419-65271441 CAATGCAGGAAGGCAGGGAGGGG + Intergenic
1118800362 14:69184064-69184086 ACTTGAAGGCAGGCAGGGAGTGG - Intergenic
1118835915 14:69477816-69477838 CAGTGAAGGCAGCCAGGAGGGGG - Intergenic
1119996269 14:79257155-79257177 CTTTGAAGGCAGGGAGGGCGAGG + Intronic
1120142815 14:80947338-80947360 CACAGAAAGCAGAAAGGGAGGGG + Intronic
1120148017 14:81000907-81000929 CACTTACAGCTGGCAGGGAGAGG + Intronic
1121279283 14:92687733-92687755 CTGGGAAGCCAGGCAGGGAGGGG + Intronic
1121573153 14:94962460-94962482 CACTGCAGGGAGGCAGTGAAAGG - Intergenic
1121627796 14:95399391-95399413 CACTGAGGACAGGCAGTGTGAGG - Intergenic
1121965708 14:98302679-98302701 CACTGAAGGCCAGAAGGAAGTGG + Intergenic
1122226799 14:100285294-100285316 CACTGCAGGGTGGCAGGGAAGGG - Intergenic
1122440994 14:101731708-101731730 CTCTGAAAGCAGCCTGGGAGGGG + Intronic
1122627312 14:103091149-103091171 TCCTGAAGCCAGGGAGGGAGAGG + Intergenic
1122632576 14:103113802-103113824 TACTGAAGCCAGGAAGGGAGGGG - Intergenic
1123028497 14:105439701-105439723 CCCTGCAGGCAGGCACAGAGAGG - Intronic
1123414247 15:20083454-20083476 AAGGGAAGGCAGGCAGGGTGGGG + Intergenic
1123523589 15:21090565-21090587 AAGGGAAGGCAGGCAGGGTGGGG + Intergenic
1125404885 15:39341834-39341856 CTCTGAAGGCAGTGAGTGAGAGG - Intergenic
1125933579 15:43616604-43616626 CAGTGAAGGAGGGCAGGGGGTGG + Exonic
1125946677 15:43716066-43716088 CAGTGAAGGAGGGCAGGGGGTGG + Intergenic
1126411122 15:48374157-48374179 GATTGGAGACAGGCAGGGAGTGG - Intergenic
1128260142 15:66227645-66227667 CAGAGAGGGCAGGAAGGGAGAGG + Intronic
1128650311 15:69407218-69407240 CACTGAAGCCTGTCAGGCAGAGG - Exonic
1129336045 15:74852791-74852813 CACTAAAGCCAGGCAGGGCAGGG - Intronic
1129458969 15:75690416-75690438 CAGGGAAGGCAGCCAGAGAGTGG + Exonic
1129724840 15:77896476-77896498 CAGGGAAGGCAGCCAGAGAGTGG - Intergenic
1129737567 15:77974690-77974712 TACTGAAGGCAGGTGTGGAGAGG - Intergenic
1130167904 15:81481975-81481997 GAAAGAAGGAAGGCAGGGAGGGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132004314 15:98212921-98212943 CCATGAATGCAGGAAGGGAGGGG + Intergenic
1132386772 15:101406281-101406303 GGCTGGAGGAAGGCAGGGAGCGG + Intronic
1132651773 16:1024415-1024437 CACAGAAGGCACTCAGGGAGGGG + Intergenic
1132710877 16:1266662-1266684 CGGGGAAGGCAGGCAGGGATGGG + Intergenic
1133021924 16:2970489-2970511 TACTAGAGGCCGGCAGGGAGGGG + Intronic
1133027596 16:2995477-2995499 CTGGGAAGGGAGGCAGGGAGAGG - Intergenic
1133094723 16:3435369-3435391 CACTGCAGGCAGCCAGGGAAAGG - Exonic
1133157875 16:3888566-3888588 AACTGAAAGCAGGCCGGGTGCGG - Intergenic
1133218571 16:4307980-4308002 CTCGGAAGGCAGGAGGGGAGGGG + Intergenic
1133919483 16:10139318-10139340 CCCTGTGGGGAGGCAGGGAGAGG + Intronic
1133977443 16:10609406-10609428 CACAGAAGGCAGGCAGGGTCCGG + Intergenic
1135496480 16:22956016-22956038 GACTGGAGGCAGGCAATGAGAGG - Intergenic
1135720282 16:24811509-24811531 AACAGAAGTCAGGCAGGCAGAGG + Intronic
1136228914 16:28875858-28875880 CCCTGAAGGCTGGCAGGGCTGGG - Intergenic
1136524895 16:30822726-30822748 CACTGGAGCCCGGGAGGGAGAGG - Intergenic
1136608331 16:31351601-31351623 GAGTGACTGCAGGCAGGGAGAGG + Intergenic
1136627766 16:31472357-31472379 CAGGAAAGGCAGGAAGGGAGAGG - Intronic
1137056324 16:35748147-35748169 GACAGAATGCAGGAAGGGAGTGG - Intergenic
1137395741 16:48115209-48115231 CACTGAGGCCATGCATGGAGTGG + Intronic
1137476933 16:48817367-48817389 CTCTGCAGGCTGGCTGGGAGTGG - Intergenic
1137531043 16:49279371-49279393 GCCGGAAGGGAGGCAGGGAGAGG - Exonic
1137679136 16:50323965-50323987 CACTGCAGACAGGAAGTGAGGGG - Intronic
1137845541 16:51684411-51684433 TTCTAAAGGCAGGCAGGCAGAGG - Intergenic
1137982835 16:53084452-53084474 CACAGAAGCCTGGCAGGGTGCGG + Intronic
1138123852 16:54422778-54422800 CACTGGAGGCTTGCAGGGTGGGG - Intergenic
1138484469 16:57328960-57328982 CAATGAAGGCAGGCCAGGTGCGG - Intergenic
1139851501 16:69953375-69953397 CACTGAGTGGATGCAGGGAGGGG - Intronic
1139880477 16:70176287-70176309 CACTGAGTGGATGCAGGGAGGGG - Intronic
1139985891 16:70898254-70898276 CACAGGAGGCAGGCAGCAAGGGG - Intronic
1140329797 16:74043625-74043647 AACTAAAGGCAGGGAAGGAGAGG + Intergenic
1140897776 16:79340251-79340273 TGTTGAAGGCAGGCAGGAAGAGG - Intergenic
1141088644 16:81114783-81114805 TACTGAAGCCAGGCTGGGTGCGG - Intergenic
1141099665 16:81188035-81188057 CCCTGAATGCAGGCAGCAAGGGG - Intergenic
1141619897 16:85231642-85231664 CTCCTAAGGAAGGCAGGGAGAGG - Intergenic
1141787928 16:86214093-86214115 CACTGCAGGCATGCATGGTGTGG + Intergenic
1142569679 17:865128-865150 CACTGAAGGAGCACAGGGAGGGG - Intronic
1142747416 17:1966862-1966884 CCCTGAAGGCAGTGAGGGAGGGG - Intronic
1142890448 17:2939679-2939701 CACTCAGGGCAGGGATGGAGGGG + Intronic
1142976214 17:3646119-3646141 CCCTGAAGGCAATCAGGCAGGGG + Intronic
1143168112 17:4909214-4909236 CACTGAAGGCAGAGAGGCCGCGG - Intergenic
1143563676 17:7709215-7709237 CACTGCAGGCATGCTGGGAGGGG - Exonic
1143591813 17:7889525-7889547 CAGTGAAGGGAGGCAGGGCTTGG + Intronic
1144832519 17:18139664-18139686 GCCTGAAGGCAGGCTGGGTGTGG - Intronic
1144947953 17:18979373-18979395 CTCTGGAGGCAGGCAGAGAAGGG - Intronic
1145035412 17:19537255-19537277 CAGAGAAGGCAGGCAGGTTGAGG + Intronic
1146566807 17:33920553-33920575 CAGAGAAGGGAGACAGGGAGGGG + Intronic
1146957689 17:36946348-36946370 CCCTGAAGGCAGGTGGCGAGAGG - Intergenic
1147324475 17:39663709-39663731 CGCTGAAGCCTGGCAGGGGGCGG - Intergenic
1147327693 17:39677599-39677621 AAGTGAAGGGGGGCAGGGAGGGG + Intronic
1147553633 17:41462670-41462692 CTCTGAAGGAAGTCAGGCAGTGG - Intronic
1147562125 17:41515739-41515761 CACTGAGGGCAAGCAGGGAGGGG + Intronic
1147721372 17:42541605-42541627 CACTGCAGGCAGGAGGTGAGTGG + Intronic
1147759417 17:42787880-42787902 CACCGAGGGCAGGCAGAGATGGG - Exonic
1147869689 17:43578661-43578683 CTCTGAATGCAGCAAGGGAGAGG - Intronic
1148772980 17:50077522-50077544 CCCAGAAAGCAGGCAGGCAGAGG - Intronic
1148798887 17:50210810-50210832 CACTGAGGAGAGGCGGGGAGGGG + Intergenic
1149463289 17:56851732-56851754 AGCTGAAGGAAGTCAGGGAGTGG + Intronic
1149566370 17:57643411-57643433 CGCTGTGGGCAGGCAGGGAGAGG + Intronic
1150432745 17:65131570-65131592 CACAGAAGTCAGGCAGAGAAGGG - Intergenic
1150491791 17:65579305-65579327 CCTTGGAGGCTGGCAGGGAGAGG + Intronic
1150639927 17:66942608-66942630 CACTGAAGACAGGGGAGGAGGGG + Intergenic
1151346474 17:73505847-73505869 CCCTGCAGGCATTCAGGGAGTGG - Intronic
1151463946 17:74272624-74272646 CACTAAAGGCAGGTGGGTAGTGG + Intergenic
1151668322 17:75558094-75558116 CACTCAAGGCAGGCAGGGGATGG + Intronic
1151907130 17:77056088-77056110 CCCTGAAGGCAGCCAGCGAGGGG - Intergenic
1152020780 17:77779272-77779294 CACTGAAAGGAGGCAGGGAGGGG - Intergenic
1152449450 17:80367727-80367749 CACTGAAGAAAGGCAGGGACAGG - Exonic
1152471195 17:80490922-80490944 CACAGAATGTTGGCAGGGAGGGG + Intergenic
1153640289 18:7150778-7150800 CTCTGAAGAAAGGCAGGGACTGG - Intergenic
1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG + Exonic
1153956574 18:10101514-10101536 CACAGAAGGAATGAAGGGAGAGG - Intergenic
1154041258 18:10858644-10858666 CACGGGAGGAAGGCAGGGACTGG + Intronic
1154119961 18:11644266-11644288 CCCTGTGGGCAGGGAGGGAGGGG + Intergenic
1156020840 18:32597789-32597811 CACAACAGGCAGGCAGGGAGGGG + Intergenic
1156271718 18:35541047-35541069 CTCTGCAGGCAGGCTGGGTGAGG - Intergenic
1156372156 18:36481161-36481183 GACTGAAGGAAGGAGGGGAGCGG + Intronic
1156520843 18:37721298-37721320 CACTGAAGGCAGGTGGAGGGAGG - Intergenic
1156904233 18:42335374-42335396 CTTTGAAGGCAGGCAGGCAGGGG - Intergenic
1158175902 18:54655412-54655434 CACTTAAGCCAGGGAGGCAGAGG - Intergenic
1158288331 18:55910561-55910583 CAGTGAAGACTGTCAGGGAGTGG + Intergenic
1158391648 18:57049915-57049937 AACTCAAGGGAGGTAGGGAGAGG - Intergenic
1159931461 18:74316373-74316395 CACAGAAGCCAGGCCGGAAGAGG + Intronic
1160346903 18:78139617-78139639 CACTGAGGGCACGAGGGGAGAGG - Intergenic
1160520764 18:79506776-79506798 CCCAGAAGCCAGGCAGGAAGTGG - Intronic
1160762981 19:795169-795191 CCCTGAAAGCAGACAGGCAGGGG - Intergenic
1161168267 19:2800150-2800172 AAATAAAGGCAGGCAGGAAGTGG - Intronic
1161371993 19:3917756-3917778 GACTGAAGGCCAGGAGGGAGAGG + Exonic
1161696569 19:5771994-5772016 AAATGAAGGAAGGAAGGGAGGGG - Intronic
1161698335 19:5782534-5782556 CACTGCAGGCAGGGCGGGAAGGG - Intergenic
1161948256 19:7452345-7452367 CACTGAATTCAGGCCGTGAGAGG + Intronic
1162435301 19:10654533-10654555 CACTGAGGGCGGGCGGGGGGAGG - Intronic
1162785048 19:13029662-13029684 ACCTGAAGGTAGGGAGGGAGGGG - Intronic
1163008495 19:14410689-14410711 CACTGAGGGCAGGCGGGGCCTGG + Intronic
1163465869 19:17468478-17468500 AACTGAGGGCAGGCTGGGCGTGG - Intergenic
1163500035 19:17670818-17670840 CACTTAAGCCAGGGAGGCAGAGG + Intronic
1163638802 19:18450270-18450292 CACTCCAGACAGGCAGGGAGAGG + Intronic
1163712730 19:18856499-18856521 CAGTGGAGGCTGGCAGGGAGTGG - Intronic
1163775200 19:19213258-19213280 CACCCCAGACAGGCAGGGAGGGG + Intronic
1164807811 19:31130337-31130359 GACTGAAAGCAGGTAAGGAGTGG - Intergenic
1165781543 19:38437339-38437361 GAATGAAGGCAGGCTGGGCGAGG - Intronic
1165877599 19:39020141-39020163 CACTTAAGGCAGGTAGGGATAGG + Intronic
1165992034 19:39821479-39821501 CAATGAAAGCAGGCTGGGTGCGG - Intergenic
1166072626 19:40395781-40395803 CACTGAAGGCAGAGTGAGAGAGG + Exonic
1166409378 19:42546685-42546707 CACTGAAGGCTGACAGTGAGTGG + Intronic
1166689144 19:44812415-44812437 GAAGGGAGGCAGGCAGGGAGGGG + Intronic
1167472816 19:49684899-49684921 CTGGGGAGGCAGGCAGGGAGGGG - Intronic
1167736209 19:51295980-51296002 CCCAGCAGGCATGCAGGGAGAGG + Intergenic
1168153631 19:54461690-54461712 CCATGAAGGCAGGGAGGGAGGGG - Exonic
1168350598 19:55673837-55673859 CACTGAAGGCAGGAAGGGACAGG - Intronic
925001160 2:403862-403884 CAATGAAAGCAGCCAGGAAGTGG - Intergenic
925466425 2:4110728-4110750 CACGGAAGGAGGGCAGGGAATGG - Intergenic
925947568 2:8879912-8879934 AAGTGATGGCAGGAAGGGAGGGG + Intronic
926111954 2:10189227-10189249 CACTGCCCGCAGGAAGGGAGGGG - Intronic
926926538 2:17993589-17993611 CCATGAAAGCAGCCAGGGAGAGG + Intronic
927461544 2:23303216-23303238 CACAGAAGGTAGAAAGGGAGAGG + Intergenic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927976297 2:27341117-27341139 CACTTAAACCAGGCAGGGAGAGG - Intronic
928026185 2:27741247-27741269 GACTGCAGGGAGGGAGGGAGGGG - Intergenic
928320936 2:30282393-30282415 GCCTGAGGGCAGGCAGGGTGGGG - Intronic
928636277 2:33250473-33250495 CACCTAAGGCAGGGAAGGAGAGG + Intronic
928660938 2:33501073-33501095 CACTGAGGGAAGGCAGGAATGGG - Intronic
929783624 2:44973586-44973608 CACTGCAGGCATGGAGGAAGGGG + Intergenic
930102280 2:47612710-47612732 CACAGAGGGCAGGGAAGGAGTGG + Intergenic
930182553 2:48377691-48377713 CACTGAAAGCTAACAGGGAGAGG + Exonic
931134126 2:59377592-59377614 CACATAAGGCAGGAAAGGAGAGG + Intergenic
931229909 2:60365447-60365469 CACTGGCGGCAGGCAGAGTGAGG - Intergenic
931940211 2:67243710-67243732 CACTGCAGGCTGGCATGGATAGG + Intergenic
932447162 2:71787985-71788007 CCCTGAAGGCAGGGAGATAGAGG - Intergenic
932487095 2:72090809-72090831 CACAGAAGTCAGGCAGGAAGAGG - Intergenic
932620851 2:73264252-73264274 CACAGAAGGCAGGCAGGGGCAGG + Intronic
933710171 2:85319463-85319485 CACTGAAGAAAGGCCGGGCGCGG - Intronic
933775659 2:85769799-85769821 AACTGAATCCAGGCAGGGTGCGG - Intronic
933971324 2:87472170-87472192 GAATGAAGGGAGGGAGGGAGGGG - Intergenic
934111469 2:88747386-88747408 AGGTGCAGGCAGGCAGGGAGGGG - Intronic
934165497 2:89290419-89290441 CACAGAAGGCAGTCAGTGATAGG + Intergenic
934201777 2:89892043-89892065 CACAGAAGGCAGTCAGTGATAGG - Intergenic
934220059 2:90074395-90074417 CACTGCATGCATGGAGGGAGGGG - Intergenic
934743251 2:96741085-96741107 CACTTCAGCCAGGGAGGGAGAGG - Intergenic
935211827 2:100945283-100945305 CACTGACTGCAGGCAGGGAGGGG + Intronic
935303613 2:101716033-101716055 CCATGAAGGTAGGCAGGGGGTGG - Intronic
935331089 2:101978618-101978640 CACTGGAGGAAGGCACGGTGGGG + Intergenic
935512776 2:103996260-103996282 CACTGGGGTCAGTCAGGGAGTGG + Intergenic
935635087 2:105243798-105243820 AAACGAAGGGAGGCAGGGAGAGG - Intergenic
935875374 2:107500712-107500734 CACTGAAGAGAGGGAGGGAGAGG - Intergenic
936850188 2:116886823-116886845 CACTGGAGCCTGTCAGGGAGTGG + Intergenic
937078374 2:119123593-119123615 CCCTGAAGACACGCCGGGAGGGG - Intergenic
937091695 2:119210821-119210843 AACTGAAGGCAGGCTGGGCATGG - Intergenic
937265815 2:120614069-120614091 CACGGATGGCAGGCGGGGTGAGG - Intergenic
937410382 2:121669851-121669873 CAGTGTGGGCAGACAGGGAGGGG + Intergenic
937492367 2:122383163-122383185 CACCCAAGCTAGGCAGGGAGGGG + Intergenic
937814690 2:126238138-126238160 CCCTGAGGACTGGCAGGGAGGGG - Intergenic
937839827 2:126513826-126513848 CAGTGCAAGGAGGCAGGGAGTGG + Intergenic
937982857 2:127625211-127625233 CAGTCAGGGCATGCAGGGAGGGG + Intronic
937987676 2:127645823-127645845 TACTGATGGGGGGCAGGGAGGGG - Intronic
938992563 2:136644170-136644192 CAAGGAAGGAAGGAAGGGAGGGG + Intergenic
940601856 2:155873382-155873404 CACTGAAAGCAAGGAAGGAGAGG + Intergenic
940868200 2:158837779-158837801 GTCTGAAGGCATGCAGGGAGGGG + Intronic
941013989 2:160333583-160333605 CTCAGAAGGAAGGCAGGGAATGG + Intronic
941189113 2:162354522-162354544 AACTGAACCGAGGCAGGGAGGGG + Intronic
941826819 2:169908050-169908072 CAATAAAGGCATGGAGGGAGAGG - Intronic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
942881585 2:180868321-180868343 CTCTGAAGTCAGGCTGGCAGTGG + Intergenic
944267068 2:197740127-197740149 CAATGAAGGGATGCAGTGAGTGG + Intronic
945081447 2:206090159-206090181 CACTTTTGGCAGGCAGAGAGAGG - Intergenic
945241013 2:207676909-207676931 CCCTGAAGGTAGGCAGGGGCTGG + Intergenic
945443945 2:209913697-209913719 CACTTAAGGCAAGCAGAGAGAGG + Intronic
945669348 2:212784644-212784666 CATTGAAGGAAGGGAAGGAGAGG + Intergenic
945760315 2:213905735-213905757 CAGGGAAGGATGGCAGGGAGAGG + Intronic
945925217 2:215796391-215796413 GTCTGAAGGAAGGCAGAGAGTGG - Intergenic
945995506 2:216432697-216432719 AACTGAAGGCAGACAAGGTGAGG - Exonic
946165018 2:217858493-217858515 CTCTGGAGGGAGGGAGGGAGAGG + Intronic
946304495 2:218848007-218848029 AACTCAAAGCAGGCCGGGAGCGG + Intergenic
946618889 2:221539804-221539826 CAATGAAGGCTGGAAGGGTGTGG + Intronic
946731024 2:222709582-222709604 CACTGCAGGCAGCCAGTGAAAGG + Intronic
947154147 2:227144716-227144738 CAATGATGGCAGCCAGAGAGAGG - Intronic
947426606 2:229989339-229989361 CACTTGAAGCTGGCAGGGAGAGG - Intronic
947644918 2:231731553-231731575 CAGTGAAGGCATGCTGGGAGCGG + Intergenic
947904566 2:233751072-233751094 CTCTGAAGGCAGCCAGGAGGAGG + Intronic
948206166 2:236163878-236163900 CCATGAAGCCTGGCAGGGAGGGG - Intergenic
948254206 2:236554135-236554157 CCCAGAAGGGAGGAAGGGAGAGG - Intergenic
948643499 2:239389767-239389789 CACTGATGTCAGGAAGGAAGGGG - Intronic
948720622 2:239897903-239897925 AACTGAAGGGATGCAGGAAGGGG - Intronic
948720701 2:239898368-239898390 CTCTGGAGGCTGGCAGGCAGGGG - Intronic
949010759 2:241677056-241677078 ACCAGAAGGCAGGCAGTGAGAGG + Intronic
1169208902 20:3754825-3754847 CCCAAAAGGAAGGCAGGGAGAGG + Intronic
1169968847 20:11247219-11247241 CTCTGGAGCCAGGGAGGGAGGGG + Intergenic
1169992852 20:11522858-11522880 GACTGGAGGCAGGCGGGGGGAGG + Intergenic
1170540281 20:17380758-17380780 TCCTTAAGGCAGGAAGGGAGGGG - Intronic
1170567518 20:17615416-17615438 AGCTGAAGGCAGGCAGGGGCTGG - Exonic
1170577499 20:17675532-17675554 CAGAGAAGGGGGGCAGGGAGTGG + Intronic
1170963374 20:21044857-21044879 TATTCAAGGCAGGCAGGGAGTGG + Intergenic
1171097259 20:22343768-22343790 TACTGGAGGCAGGCGTGGAGGGG + Intergenic
1171373427 20:24676099-24676121 GGCTGTAGGCAGGCAGGGTGGGG - Intergenic
1172296051 20:33811800-33811822 CATTGAAGGGAGTCGGGGAGGGG - Intronic
1172859193 20:38033917-38033939 CAGTGAGGCCCGGCAGGGAGCGG - Exonic
1172943590 20:38671472-38671494 CTCTCTAGGCAGGGAGGGAGAGG - Intergenic
1173082002 20:39877401-39877423 CCCTGGAGGCCTGCAGGGAGCGG + Intergenic
1173161335 20:40654690-40654712 CATTGAAGGCAGGCCCGTAGTGG - Intergenic
1173608896 20:44352242-44352264 CTCTCCAGCCAGGCAGGGAGTGG - Intergenic
1173950772 20:46991677-46991699 GACTGAAGGCTGGCTGGGAGCGG + Intronic
1174015185 20:47482185-47482207 CACAGAATTCAGGCTGGGAGTGG - Intergenic
1174916006 20:54654646-54654668 CAAAAAAGGCAGGCAGGGTGAGG + Intergenic
1175046977 20:56116214-56116236 CAATGAAGGGAGGCAGGGGAGGG + Intergenic
1175082602 20:56433498-56433520 CACTGAAGGGTGGTAGAGAGGGG + Intronic
1175340998 20:58228787-58228809 CTCGGGCGGCAGGCAGGGAGGGG - Intergenic
1175503977 20:59469151-59469173 CCCTGGAGGCAGTCGGGGAGAGG + Intergenic
1175538629 20:59733943-59733965 GGCTGAAGGCAGGAAGGCAGAGG - Intronic
1175609532 20:60339310-60339332 CATTTAAGCCAGGCAGAGAGAGG + Intergenic
1175818696 20:61896907-61896929 AAGTGATGGCAGGGAGGGAGGGG + Intronic
1176031412 20:63014805-63014827 GACTGAGGGCAGGCGGGAAGAGG - Intergenic
1176178342 20:63738877-63738899 CAGGGCAGGGAGGCAGGGAGGGG - Exonic
1176205875 20:63887864-63887886 CACTGCAGGCAGCCAGGGTCAGG - Intronic
1176653124 21:9567612-9567634 GGCTGAAGCCAGGCAGGGAAAGG - Intergenic
1177651131 21:23963677-23963699 CACTGCAGCCAGGCAGGCATAGG - Intergenic
1178263119 21:31117919-31117941 CACTGAGGGCAGGGATGGATGGG + Intergenic
1178939775 21:36895524-36895546 CAATGGGGGCAGGCTGGGAGGGG - Intronic
1179413104 21:41177317-41177339 GACAGAAGGAAGGCAGGAAGGGG + Intronic
1179566870 21:42254373-42254395 CACTGAGGGGTGGTAGGGAGGGG + Intronic
1179818378 21:43922440-43922462 CCCTCAAGGCAGGCAGCGAGTGG + Intronic
1179964849 21:44796934-44796956 CAGTGAAGGCAGGATGGGGGTGG - Intronic
1180094747 21:45550835-45550857 CAGAGGAGGGAGGCAGGGAGGGG - Intergenic
1180145635 21:45917056-45917078 CCCTGAAGACAGGGAGGGGGTGG - Intronic
1180205160 21:46255319-46255341 CAGTGAGGGCAGCGAGGGAGGGG + Intronic
1180728230 22:17961830-17961852 AACTGGAGGCAGGCAGGCCGTGG - Intronic
1180733655 22:18000680-18000702 CTCGGAAGGCAGCCAGGGAAGGG + Intronic
1180972875 22:19824738-19824760 CACTCAAGGGAGGCAGGGGCAGG + Intronic
1181005454 22:20011316-20011338 CACTGCAGACAGACAGGGAAGGG + Intronic
1181066106 22:20306842-20306864 GCCCCAAGGCAGGCAGGGAGGGG - Intergenic
1181754025 22:25010112-25010134 GATTGCAGGCGGGCAGGGAGAGG - Intronic
1181850656 22:25747662-25747684 CAATGGAGGCTGGCAGGGTGGGG + Intronic
1182229274 22:28824636-28824658 CACTTAAGCCCGGGAGGGAGAGG + Intergenic
1182545872 22:31076114-31076136 AAGGGAAGGCAGGCAGGGTGGGG - Intronic
1182717467 22:32369241-32369263 CAGTGAAGGAAGGCAGAGTGAGG + Intronic
1182811871 22:33123703-33123725 CACAGAAGGGAGGAAGGGAAGGG + Intergenic
1182941363 22:34280536-34280558 CACTGGAGGCAGGTGGGAAGAGG + Intergenic
1182990422 22:34762403-34762425 CACTGAAAGCATGCAAGAAGAGG + Intergenic
1183165287 22:36142960-36142982 AACTAAAGGCAGGTAAGGAGCGG - Intronic
1183270595 22:36860405-36860427 CATTGGAGGCAGGCAGGGCAAGG + Intergenic
1183675809 22:39298278-39298300 CAGAGAAGGCAGGAAGGGACAGG + Intergenic
1184251556 22:43263261-43263283 CACTCCAGGCAGACAGAGAGGGG - Intronic
1184264646 22:43340529-43340551 CACAGAGTTCAGGCAGGGAGGGG + Intronic
1184343571 22:43899487-43899509 CACCCAAGACAGGCAAGGAGAGG - Intergenic
1184428410 22:44426716-44426738 CACTGAAAACAGGCGGGGCGTGG + Intergenic
1184645191 22:45891496-45891518 ACCTGAAGGCGGGGAGGGAGTGG - Intergenic
1184681408 22:46074172-46074194 CACGGAGGGCAGGCATGGTGTGG + Intronic
1184747042 22:46462103-46462125 CAAGGCAGGCAGGCAGGCAGAGG - Intronic
1184787250 22:46677895-46677917 CACTGAGGGCAGGCGAGGGGTGG - Exonic
1184942123 22:47776671-47776693 GAATGAAGGCAGTCAGGCAGAGG - Intergenic
1185258607 22:49849573-49849595 GAAGGAAGGCAGGGAGGGAGGGG + Intergenic
1185305115 22:50111045-50111067 GAGGAAAGGCAGGCAGGGAGGGG - Intronic
949752496 3:7370704-7370726 GTCTGAAGGCAGGGAAGGAGGGG - Intronic
950122258 3:10489646-10489668 GACTGATAGGAGGCAGGGAGAGG - Intronic
950257682 3:11519515-11519537 CATGAAAGGCAGGCAGTGAGAGG + Intronic
950495790 3:13333566-13333588 CTCTCAAGACAGGCATGGAGAGG - Intronic
950506300 3:13396975-13396997 CAGCGATGGGAGGCAGGGAGAGG - Intronic
950847074 3:16024890-16024912 CACTGAAAGCACTCAGGCAGAGG + Intergenic
951697232 3:25457874-25457896 CACAGAAGGAAGGTGGGGAGCGG - Intronic
952015000 3:28945893-28945915 CACTGAAGGGAGGCGGCGGGGGG - Intergenic
952801302 3:37294674-37294696 CACTTAAGACAGGCCGGGTGCGG - Intronic
952881122 3:37986915-37986937 CTCTGAGGGCAGACAGGGATGGG - Intergenic
952901740 3:38115651-38115673 GACTGAAGGCAGGAGGGGAGGGG + Intronic
953103876 3:39856361-39856383 CTCTAAAATCAGGCAGGGAGCGG - Intronic
953151599 3:40330118-40330140 CACTCCTGGAAGGCAGGGAGTGG + Intergenic
953279335 3:41537853-41537875 CATTTAAGGCAGGAAGGGATAGG - Intronic
953519017 3:43623154-43623176 CACTTAAAGCCGGCAGGGCGCGG - Intronic
953862959 3:46561112-46561134 CTCTGGGGGCAAGCAGGGAGAGG - Intronic
954006274 3:47593765-47593787 CACTGGAGATAGGCAGGGTGTGG - Intronic
954072401 3:48152363-48152385 CCAGGAAGCCAGGCAGGGAGGGG - Intergenic
954218901 3:49140327-49140349 CAGAGAAAGCAGGAAGGGAGAGG - Intergenic
954304199 3:49716950-49716972 CACTGCAGGGGGGCAGGGAAGGG - Exonic
954634731 3:52065336-52065358 CCGTGTGGGCAGGCAGGGAGGGG - Intergenic
954681703 3:52349573-52349595 CTCTGCAGACAGGCAGGGATGGG - Intronic
954714879 3:52522016-52522038 CACTGAGGGCAGGGAGGGAGTGG - Exonic
955797036 3:62648129-62648151 CAATGAGGGCAGGCAAGAAGAGG - Intronic
955948924 3:64222592-64222614 CATGGTAGGCAGGCAGGCAGGGG + Intronic
956739737 3:72266493-72266515 CTCTGGAGGCAGGCTGGGAAGGG + Intergenic
957776171 3:84759346-84759368 CATTGCAGGAAGACAGGGAGGGG + Intergenic
959740688 3:109715884-109715906 CACTGAATGCAGGAAAGCAGGGG - Intergenic
959947573 3:112142878-112142900 TACAGAGGGCAGGGAGGGAGGGG - Intronic
960284094 3:115808166-115808188 GAAGGAAGGAAGGCAGGGAGGGG - Exonic
960557102 3:119042299-119042321 CTCAGTGGGCAGGCAGGGAGGGG + Intronic
960815617 3:121668847-121668869 CACTGTTGACAGCCAGGGAGAGG - Intronic
961396802 3:126599248-126599270 GAAGGAAGGAAGGCAGGGAGAGG - Intronic
961471288 3:127114801-127114823 CACACCATGCAGGCAGGGAGAGG - Intergenic
961501442 3:127338504-127338526 CAGAGCAGGCAGGCAAGGAGAGG + Intergenic
961584984 3:127915143-127915165 GACTGAAGGCCTGCGGGGAGGGG - Intergenic
961810438 3:129518825-129518847 CACTGCGGGTAGGCACGGAGGGG - Intronic
961826160 3:129600212-129600234 GCCTGAAGGCAGGCAGGGGTGGG - Intronic
962241659 3:133755574-133755596 CCCTGTAGGCAGGCAGGGCTCGG - Intronic
962571592 3:136718932-136718954 AAAAAAAGGCAGGCAGGGAGGGG + Intronic
962736512 3:138329941-138329963 CTCTGAACCCAGCCAGGGAGAGG + Intergenic
964331516 3:155608366-155608388 CAGTGTGAGCAGGCAGGGAGGGG + Intronic
965043703 3:163547078-163547100 CACTGAAGGAAATAAGGGAGTGG - Intergenic
965618926 3:170622968-170622990 CACTGAAGCAGGGGAGGGAGGGG + Intronic
966607163 3:181832909-181832931 CTCAGAAGGCGGGCAGGAAGAGG - Intergenic
967845943 3:194042841-194042863 CAATAAAGGGAGGCAGAGAGAGG + Intergenic
968654533 4:1772800-1772822 CCCTGATGGAAGGCAGGAAGGGG + Intergenic
968998975 4:3964945-3964967 CACTGGACCCAGGCAGTGAGGGG - Intergenic
969588007 4:8105665-8105687 CGCAGAAGGCAGGCAGGCACGGG + Intronic
970286116 4:14518059-14518081 CAGTGATGGCAGGCAGGATGTGG + Intergenic
970388370 4:15580348-15580370 GTCTGAAGGCAGCCAGGCAGTGG + Intronic
970488200 4:16545219-16545241 GACAGAAGGAAGGGAGGGAGGGG - Intronic
972789260 4:42355130-42355152 CATGGAATGAAGGCAGGGAGGGG + Intergenic
972991780 4:44829488-44829510 CAATGAAGGCTGCCAGGTAGAGG + Intergenic
973812704 4:54587294-54587316 TACTAAAGCCAGGCTGGGAGTGG - Intergenic
974509980 4:62826798-62826820 CAATGAGGTGAGGCAGGGAGGGG + Intergenic
974797150 4:66767162-66767184 CAGTGAAAGCAGCCAGGAAGAGG + Intergenic
975249408 4:72160783-72160805 CAAAGAAGGGAGGGAGGGAGGGG - Intergenic
975353883 4:73376819-73376841 TACTGAAGGCAGGAAGGCAAAGG - Intergenic
975415831 4:74103256-74103278 GATTGAAGGCAGGCTGGGAGTGG + Intergenic
975644737 4:76535023-76535045 CACTGAGGCCAGGCAGGAATAGG - Intronic
975763152 4:77637123-77637145 CACTGCAGCCAGGCAGGCACAGG - Intergenic
975891339 4:79032378-79032400 GAAAGAAGGGAGGCAGGGAGAGG - Intergenic
977687124 4:99859821-99859843 CATTGAAGCCTGGCAGGGTGTGG - Intronic
978692580 4:111532939-111532961 CACTGAGGCCTGTCAGGGAGTGG - Intergenic
978981950 4:114957949-114957971 CAGTGAAAGCAGCCAGGAAGGGG - Intronic
980915706 4:139031437-139031459 CACTCAGGGCAGGCCGGGCGTGG - Intronic
980981013 4:139654582-139654604 CACTGAAGGGAGGAAAGGAGAGG - Intergenic
981523737 4:145691764-145691786 CACTGAGGGCAGAGAGGGAAGGG + Intronic
981536147 4:145801909-145801931 CACTCATGGCAGGGAGGGTGGGG + Intronic
982313155 4:154006166-154006188 TACAGAAGGCAGGCAGAGAAGGG + Intergenic
984781799 4:183533210-183533232 TACTGAAGGGCAGCAGGGAGAGG + Intergenic
984814713 4:183825599-183825621 CACAGAGGACGGGCAGGGAGGGG - Intergenic
985655201 5:1128120-1128142 TCCTTAAGGCAGGCTGGGAGTGG + Intergenic
985926302 5:3022129-3022151 CAAAGAAGACAGGCAGGCAGGGG - Intergenic
986270900 5:6229919-6229941 ACCTGAAGGAAGTCAGGGAGAGG - Intergenic
986304650 5:6506318-6506340 CACTGAGGCCTGCCAGGGAGGGG + Intergenic
986628633 5:9747434-9747456 CACTCAAGGCAGAATGGGAGGGG + Intergenic
986835554 5:11633312-11633334 CAATGAAGGCAAGGAGGCAGTGG + Intronic
987179154 5:15348252-15348274 CACTGAAGGCGGGCAGAGGTGGG - Intergenic
987232118 5:15905795-15905817 AACAGAAGGCAGGAATGGAGAGG + Intronic
987844062 5:23258645-23258667 CAATGAAAGCAGGCACGAAGTGG + Intergenic
988156583 5:27459608-27459630 CACAGAAGGAAAGCAGAGAGAGG + Intergenic
989369583 5:40692105-40692127 CACTGAGGTCTGGCAGTGAGAGG - Exonic
990425380 5:55682951-55682973 GAAGGAAGGCAGGCAGGCAGAGG + Intronic
990528774 5:56653795-56653817 CAAGGAAGGCAGGCAGTGGGAGG - Intergenic
990925961 5:61022933-61022955 CACTAAAGGCAGGCCGGGCATGG - Intronic
991556162 5:67896990-67897012 CACTTCAGGAATGCAGGGAGTGG + Intergenic
992904089 5:81328162-81328184 GCCTGCAGGCAGACAGGGAGTGG - Intergenic
994744015 5:103656438-103656460 ATATGAAGGCAAGCAGGGAGTGG - Intergenic
995168433 5:109076511-109076533 CACTTGAGCCAGGGAGGGAGAGG - Intronic
995585461 5:113643701-113643723 CACTGAAGGCAGGGATTGGGAGG + Intergenic
996873324 5:128215788-128215810 CAAGGAAGGCAGGCAAGGAGAGG + Intergenic
997695231 5:135856340-135856362 CTCAGAAGGCTGCCAGGGAGAGG - Intronic
997786027 5:136714844-136714866 CACTGGAGGCAAGCAGGAGGAGG - Intergenic
997934094 5:138095752-138095774 CACTGAAGGCAAGCAGAGCCTGG + Intergenic
998001839 5:138631670-138631692 CACTGAGGACAAGCAGGGATGGG - Intronic
998066450 5:139163120-139163142 CAAGGAAGGCAGGCAGGGATCGG + Intronic
998105824 5:139468586-139468608 CACCAAAGGCAGGCAGGCTGAGG - Intergenic
998119383 5:139563022-139563044 CACTTAAGGGAGGCAGAGACAGG - Intronic
998199882 5:140111357-140111379 CACGGAAGAAAGGCAGGGACTGG + Intronic
998253895 5:140570432-140570454 CACTGAAGGCCTGCGAGGAGAGG - Intronic
998945987 5:147339611-147339633 CAATGAACGCAGCCAGGAAGGGG + Intronic
998957454 5:147453000-147453022 GACTGAACGCAGGCAAGAAGGGG + Intronic
999267922 5:150278905-150278927 CACAGAATGTAGGCAGGGAGGGG + Intronic
999509837 5:152238202-152238224 GACTGAAGTCAGACAGGTAGAGG + Intergenic
1000264438 5:159621225-159621247 CTATGTGGGCAGGCAGGGAGGGG + Intergenic
1001071647 5:168590509-168590531 CACAGAAGGCAGGAAAGAAGGGG + Intergenic
1001167626 5:169385007-169385029 CCCTTAGGGCAGGAAGGGAGAGG - Intergenic
1001571815 5:172735204-172735226 GAGTGAAGGCAGGGAGGGGGTGG + Intergenic
1001650057 5:173309826-173309848 CATTCAAGGTTGGCAGGGAGGGG + Intergenic
1001799766 5:174532765-174532787 CACTGAAGGAAGGGAGGAGGAGG + Intergenic
1002094241 5:176821773-176821795 AAGTGACCGCAGGCAGGGAGTGG + Intronic
1002548507 5:179969329-179969351 CAGAGAAGGCAGGCAGTGACTGG - Intronic
1003244610 6:4373472-4373494 TTCTGAAGGCACGCAGGGAAGGG + Intergenic
1003253844 6:4457322-4457344 CACTCAAGCCAGGCAGAGTGTGG + Intergenic
1003261301 6:4518612-4518634 GACTGAAGGCAGGCATGGTGAGG - Intergenic
1004001445 6:11600587-11600609 CTCAGAAGGGAGGAAGGGAGGGG + Intergenic
1004307045 6:14510416-14510438 CACTGAAGGCAGACAGTGGTTGG - Intergenic
1004934849 6:20497150-20497172 CAAGGAAGGGAGGAAGGGAGGGG + Intergenic
1005436253 6:25815244-25815266 GAATGAAGGGAGGGAGGGAGGGG + Intronic
1005753146 6:28902479-28902501 AACTGTAGGCAGGCCGGGCGCGG + Intergenic
1006190045 6:32202039-32202061 CACTGGAGCCAGGGAAGGAGAGG - Intronic
1006624674 6:35388923-35388945 CACAGAGGGCAGGCACTGAGAGG - Intronic
1006830469 6:36964944-36964966 CACAGGTGGCAGGCAGGAAGGGG + Intergenic
1007168460 6:39845655-39845677 CACTAAAGACAGGAAGAGAGAGG - Intronic
1007176794 6:39902686-39902708 TACTTAAGACATGCAGGGAGAGG - Exonic
1007297414 6:40835833-40835855 CCCTGCAGGCAGGCAGGAAAGGG + Intergenic
1007353684 6:41294461-41294483 CACTGAAAGCAGGCATGGGCAGG - Intergenic
1007374155 6:41444946-41444968 AACTGAAGGCATGTAGGCAGAGG + Intergenic
1007572658 6:42904388-42904410 CTCTGAATGCAGGCTGGGAGTGG + Intergenic
1007781906 6:44259202-44259224 GACTGAAGCCAGGCAGGGTCTGG - Exonic
1008580833 6:52905055-52905077 CAATGAGGTCAGGGAGGGAGTGG - Intronic
1008679505 6:53857195-53857217 GAATGAAGTCAGTCAGGGAGAGG + Intronic
1008889875 6:56475765-56475787 CACTGAAGCCAGGGAGGTGGAGG + Intronic
1009360337 6:62803324-62803346 AAGTGCAGGCAGGCAGGAAGGGG - Intergenic
1010176426 6:73033136-73033158 CACTCCAGGTAGGCAGCGAGGGG + Intronic
1010502518 6:76618021-76618043 TACAGAAGACAGGGAGGGAGTGG + Intergenic
1010512607 6:76739003-76739025 CTCTGAAGGCAGGCTGGGTGTGG + Intergenic
1011074239 6:83421006-83421028 CCCTGTATGCAGACAGGGAGGGG + Intronic
1011230659 6:85158032-85158054 TACAGAAGGTAGGCAGAGAGTGG - Intergenic
1011406939 6:87025457-87025479 CAGTGAAGGAAGGATGGGAGGGG + Intergenic
1012444522 6:99294339-99294361 AAGTGAACGCAGGCAGGCAGAGG + Intronic
1012549859 6:100456280-100456302 CACCGAAGGCAGGAGGCGAGGGG - Intronic
1014750125 6:125245875-125245897 CACTGTGGGCAGACAGGTAGGGG - Intronic
1015365526 6:132393404-132393426 CACTGAAAGCAAGGAAGGAGAGG + Intronic
1015774985 6:136804818-136804840 CACTGAAGCCTGGGAGGCAGAGG + Intergenic
1015828585 6:137342988-137343010 CTCTGGAGGCAGGCAGGCTGGGG + Intergenic
1017870465 6:158482326-158482348 AAATGAAGGCTGGCAGGCAGAGG - Intronic
1017880827 6:158561075-158561097 CACTGAAGGCAGCCTCCGAGGGG + Intronic
1018232767 6:161691248-161691270 CACTGAACTCAGGAAGTGAGAGG - Intronic
1018329737 6:162714368-162714390 CACTGGTGACAGGGAGGGAGGGG + Intronic
1018995842 6:168709916-168709938 CAGGAAAGGCAGGCAGGGAGGGG + Intergenic
1019096692 6:169587069-169587091 GACTTAAGGCAGGAAGGGATAGG - Intronic
1019390576 7:784353-784375 CCCGGCAGGCAGTCAGGGAGGGG - Intronic
1019420793 7:949802-949824 CAGGGCAGGCAGGCAGGAAGCGG + Intronic
1019530941 7:1503082-1503104 CTCAGAAGGCAGGCCGGAAGGGG + Exonic
1019735154 7:2646832-2646854 GCCTGAGGGCAGGCAGGAAGCGG - Exonic
1020120583 7:5500996-5501018 CAGAGCAGACAGGCAGGGAGAGG + Exonic
1020245263 7:6424461-6424483 CAGGGAAGTTAGGCAGGGAGGGG + Intronic
1020808166 7:12816755-12816777 CACTGAAGCCTGTCAGGGGGTGG - Intergenic
1020855914 7:13422304-13422326 CACAGAAGGAAGGAAAGGAGTGG + Intergenic
1021115827 7:16745322-16745344 CACTGAAGGCAGGTTGTCAGTGG + Intergenic
1021482724 7:21135615-21135637 GAATGAAGGCGGGCAGGAAGAGG + Intergenic
1021896686 7:25243209-25243231 GAATGAAGGAAGGGAGGGAGTGG - Intergenic
1022145759 7:27538830-27538852 CACTGAAGGCAGGAACAGAGAGG + Intronic
1023157580 7:37266114-37266136 CAGTGGAGGCTGGCAGGCAGAGG - Intronic
1023199250 7:37675980-37676002 CACTGAAGGCATGGGAGGAGTGG - Intergenic
1023270304 7:38455530-38455552 CACTGAAAGCAAGCAAGGAGAGG + Intronic
1023607202 7:41941687-41941709 CGCTGGAGGCAGCCAGTGAGTGG + Intergenic
1023636484 7:42216249-42216271 CACTGAATGTGAGCAGGGAGCGG + Intronic
1024245018 7:47462874-47462896 CACAGAAGGCAGCCAGAAAGTGG + Intronic
1024996526 7:55276809-55276831 CAATGCAGGCAGGCATGCAGGGG + Intergenic
1025991418 7:66500002-66500024 CACTTGAGCCAGGGAGGGAGAGG + Intergenic
1026081267 7:67223592-67223614 CACTTAAGCTAGACAGGGAGGGG + Intronic
1026317421 7:69239251-69239273 CTCTGATGGCTTGCAGGGAGGGG - Intergenic
1026377058 7:69762388-69762410 CACTGGAGCCAGGGAGGCAGAGG - Intronic
1026526341 7:71156643-71156665 GAAGGAAGGGAGGCAGGGAGGGG - Intronic
1027444794 7:78261061-78261083 TAAGGAAGGCAGACAGGGAGTGG - Intronic
1027557541 7:79685071-79685093 CACTAGAGGCAGGGAGAGAGAGG + Intergenic
1027600611 7:80235599-80235621 CATTGAAGGGATTCAGGGAGGGG + Intergenic
1027733367 7:81903396-81903418 CAGTGAAGGCAGGCAGGAAGGGG - Intergenic
1029312511 7:99680232-99680254 GAATGAAGGCAGCCATGGAGGGG - Intergenic
1031018530 7:116601460-116601482 GACTGAAGGCAGGCAGAGACTGG - Intergenic
1031723050 7:125200840-125200862 CTCTGAAGGCAGGCGAGCAGGGG - Intergenic
1032221309 7:129996474-129996496 AACTGAAAGCAGGCTGGGCGTGG - Intergenic
1032328017 7:130950489-130950511 CCCTGAAGGCAGTCAGAGAATGG + Intergenic
1032423605 7:131802623-131802645 CACTGAATGCAGGCAGGAAGAGG + Intergenic
1032775965 7:135113065-135113087 CACTGAATGTAGGCCGGGTGTGG - Intronic
1032931483 7:136677604-136677626 CACAGCAGGCAGGGAGGGACAGG + Intergenic
1033203132 7:139391875-139391897 CAATGAAGCCAGGCCGGGCGTGG - Intronic
1033369523 7:140696039-140696061 CATTCAAAGCAGGCAGAGAGGGG + Intronic
1034434889 7:151058682-151058704 CACTGGAGTCAGCCAGGGTGTGG + Exonic
1034606815 7:152323788-152323810 AAGGGAAGGGAGGCAGGGAGGGG + Intronic
1035240575 7:157526689-157526711 CTCTGAAGGAAGGCTGGGAATGG - Intergenic
1035312057 7:157975674-157975696 CACGGAGGGCAGGCAGGGGCTGG - Intronic
1036582392 8:10087478-10087500 CACTGAAGGAAAGCAGGGAAAGG + Intronic
1036595354 8:10206905-10206927 CACTGAAGCCACGCTTGGAGGGG - Intronic
1036604310 8:10292717-10292739 CCCTGAAAGCAGGCAGGGCTTGG + Intronic
1036658349 8:10691956-10691978 CAGTGAAGGCCGGAAGTGAGAGG - Intronic
1037575358 8:20197523-20197545 CACTGAGGCGAGGCTGGGAGAGG - Exonic
1037892131 8:22628993-22629015 CAGCGAAGGCAGGGAGGGAAGGG - Intronic
1037982105 8:23261658-23261680 CCCTCAAAGGAGGCAGGGAGTGG - Exonic
1038027554 8:23605784-23605806 CACTGAAGGCAAACAGAGTGGGG + Intergenic
1038038099 8:23703161-23703183 GAGTGAAGGCTGCCAGGGAGAGG - Intronic
1038521299 8:28234363-28234385 CACGGAAGCCCAGCAGGGAGAGG + Intergenic
1038553829 8:28492623-28492645 GCCTCTAGGCAGGCAGGGAGGGG - Intergenic
1038665147 8:29531399-29531421 TTCTAAAGGCAGGCAGGCAGAGG - Intergenic
1039365525 8:36924407-36924429 CATTGATGTCAGGGAGGGAGTGG - Intronic
1039895999 8:41716925-41716947 TAGTGAAGGCAGGAAGGGAAGGG - Intronic
1039984411 8:42435824-42435846 CACTGAAGGATGGCCGGGTGTGG + Intronic
1040380138 8:46864613-46864635 AATTGAAGGCAGGAAGAGAGTGG + Intergenic
1040820092 8:51546677-51546699 TGGTGCAGGCAGGCAGGGAGGGG + Intronic
1040891674 8:52323781-52323803 CACTGAAGACAGGCCGGAAGTGG - Intronic
1041116471 8:54542643-54542665 CACTGGAGCCTGTCAGGGAGTGG - Intergenic
1041466127 8:58159277-58159299 CCCAGAAGGCAGCCAGCGAGAGG + Intronic
1041719806 8:60965550-60965572 CCCTGATGGAGGGCAGGGAGGGG + Intergenic
1042274212 8:66986228-66986250 CAGTGATGTCAGGCAGGGCGCGG - Intronic
1042283015 8:67075625-67075647 CACTGAAGCCAGGCTGCCAGGGG - Intronic
1042422063 8:68602804-68602826 CACTGAAACCATGCAGAGAGGGG + Intronic
1042489255 8:69380033-69380055 CATTGAAGGAAAGCAGGGGGAGG + Intergenic
1042554407 8:70022028-70022050 CACTGAGGGAGGGGAGGGAGAGG + Intergenic
1043104448 8:76090139-76090161 CAGTGTGGGCAGGCAGGGAGGGG - Intergenic
1043115950 8:76254550-76254572 CACCTAAGGCAGGGAAGGAGAGG + Intergenic
1045252157 8:100491346-100491368 CATGGAAGCCAGCCAGGGAGGGG - Intergenic
1045387694 8:101687322-101687344 CACAGAAGGCAGACTGGGTGAGG - Exonic
1045685119 8:104703647-104703669 CAGAGAAGGGAAGCAGGGAGAGG - Intronic
1046802501 8:118443957-118443979 CACTGAAGGCAGGAAAAGAGAGG + Intronic
1047628931 8:126684587-126684609 GAGTGAAGGCAGGCAGGGAGAGG + Intergenic
1048279754 8:133096366-133096388 CTGTGAAGGTAAGCAGGGAGGGG + Exonic
1048381773 8:133871711-133871733 CTCTGAAGGAGGCCAGGGAGGGG + Intergenic
1048423037 8:134295906-134295928 CACTCACGGGAGGCAGGGAGGGG - Intergenic
1049241173 8:141538040-141538062 AACTGAGGCCAGGCGGGGAGAGG + Intergenic
1049318944 8:141985694-141985716 CACTGGAGGCAGCCAGGGCTGGG - Intergenic
1049331470 8:142056337-142056359 CACTGAGGGATGGCAGGAAGGGG + Intergenic
1049465835 8:142750935-142750957 CACGGAAGGCGGGCAGGGCTGGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049661811 8:143822961-143822983 CACAGGAGGCAGGAAGGGACAGG + Intronic
1049812829 8:144583148-144583170 CACTGTGGGCTGGGAGGGAGGGG - Intronic
1050176228 9:2872024-2872046 GACTGGAGGCTGGCGGGGAGGGG + Intergenic
1050424800 9:5502021-5502043 CACTGCAAGCAGGCATGGACAGG - Intergenic
1051017722 9:12501218-12501240 TACTGGAGCCAGGGAGGGAGGGG - Intergenic
1051050073 9:12922106-12922128 CACTTAAGGAAGCCAGGGACCGG - Intergenic
1052929469 9:34044479-34044501 CACTTAAGCCAGGGAGGCAGAGG + Intronic
1053150337 9:35739122-35739144 CACAGAAGGGAGGCAGGGAATGG + Intronic
1053231805 9:36416490-36416512 AAGTTAGGGCAGGCAGGGAGGGG - Intronic
1053784721 9:41645776-41645798 CACTGGAGGCATACGGGGAGAGG - Intergenic
1054941156 9:70743642-70743664 CACTGAGGTCAGCCAGGGATGGG + Intronic
1055766825 9:79672345-79672367 CACTGTGGGCGGGCAGTGAGGGG + Intronic
1056155933 9:83837785-83837807 CAGAGAAGGCAGGCATGGAAAGG - Intronic
1056354602 9:85785779-85785801 CAGAGAAGGCAGGCATGGAAAGG + Intergenic
1057819640 9:98321311-98321333 CACTGAATGTGGGCATGGAGGGG - Intronic
1057954633 9:99397764-99397786 CACTGAAGCCTGTCAGGGGGTGG - Intergenic
1057975382 9:99600532-99600554 CACTGAATGCTGGCAGCCAGTGG - Intergenic
1058590229 9:106557723-106557745 GAATGGAGGCAGGGAGGGAGTGG - Intergenic
1059392673 9:114008757-114008779 CAGTGAAGGCAGCCAGGCTGGGG + Intronic
1060462873 9:123875267-123875289 CTCTGAAGGCAGGGAGGGAGGGG + Intronic
1060793674 9:126501343-126501365 CACTGAGGGCAGGAGAGGAGAGG + Intronic
1061149940 9:128822886-128822908 CACTGAAGACAGGCTGGGAGCGG - Intronic
1061499326 9:130993204-130993226 CTTTGAGGGCAGGCAGGGAGTGG - Intergenic
1061526673 9:131170979-131171001 GACTGAGGGCAGGGAGGGTGGGG - Intronic
1061673528 9:132202507-132202529 CCTGGAAGGCAGGCAGGGGGTGG + Intronic
1061676217 9:132217306-132217328 CACAGAAGGCAGGCAGCCTGAGG + Intronic
1061735681 9:132655930-132655952 CACTGAACGCAGGCTAGGAATGG + Intronic
1062095187 9:134699476-134699498 CAAGGAAGGGAGGGAGGGAGGGG - Intronic
1062266838 9:135690447-135690469 AGCTGAGGGCAGGCAGGGGGAGG + Intergenic
1062285481 9:135770784-135770806 CAGGAAGGGCAGGCAGGGAGCGG + Intronic
1062495874 9:136831440-136831462 CTCTGAGGGAAGGCAGGGACAGG + Intronic
1062677443 9:137755237-137755259 CAGGGAAGGGAGGCAGGGAAGGG - Intronic
1203630855 Un_KI270750v1:71152-71174 GGCTGAAGCCAGGCAGGGAAAGG - Intergenic
1185643141 X:1599463-1599485 CACTGAGGGCAGCCCGGGCGCGG - Intronic
1186733140 X:12432002-12432024 GAGTTAAGGCAGGCAGGGAGGGG - Intronic
1187200837 X:17132347-17132369 TACTGAAGGCAGAGAGGGAGAGG + Intronic
1187231775 X:17430194-17430216 CAAGGAAGGAAGGGAGGGAGGGG - Intronic
1187560437 X:20397866-20397888 CATGGAAGGGAGGTAGGGAGAGG - Intergenic
1188920138 X:35964285-35964307 CACTGAAGGCAAAAAGGCAGTGG - Intronic
1189247731 X:39576442-39576464 CAGTGAAGGAAGGCAGGGAACGG - Intergenic
1189535997 X:41935998-41936020 CAGAGGAGGGAGGCAGGGAGAGG + Intergenic
1189544698 X:42029386-42029408 CAGGGAAGCCAGGAAGGGAGTGG - Intergenic
1189698716 X:43694085-43694107 CACTGAAGCCAAACATGGAGTGG + Intronic
1189701329 X:43717973-43717995 CACTGCAAGGAGGCAGGGAAGGG + Intronic
1190059991 X:47204619-47204641 CACTGATACCAGGTAGGGAGCGG + Intronic
1190387861 X:49900453-49900475 CGCTGCGGGCAGGGAGGGAGTGG - Intergenic
1191096087 X:56674071-56674093 CACAGAAGCTTGGCAGGGAGAGG + Intergenic
1191210086 X:57875656-57875678 CTTTGCAGGCAGACAGGGAGGGG + Intergenic
1192273674 X:69608777-69608799 CACTGTGGGCAGGCAGGGTCAGG + Intergenic
1193250752 X:79288564-79288586 CACTGCAAGCAGGCATGGACAGG - Intergenic
1193460051 X:81779854-81779876 CACGCAAGGAAGACAGGGAGTGG - Intergenic
1193605405 X:83561923-83561945 CACTGGAGCCAGTCAGGGTGTGG - Intergenic
1193680200 X:84509366-84509388 AAGTGAAGGCAGGCTGGGTGCGG - Intergenic
1194512380 X:94812033-94812055 CACTGCAGGCAGGCACTGACAGG + Intergenic
1195064996 X:101232514-101232536 CACTGCTGGGAGGCAGGCAGCGG + Intronic
1196624025 X:117857241-117857263 AACTGAAGTCAGGAAGGGAAAGG + Intergenic
1196684911 X:118502818-118502840 CACTGAATACAGTCAGGGAGGGG + Intronic
1196884304 X:120228342-120228364 CACTGAAGCCAGGCAGACATAGG + Intergenic
1197155272 X:123263564-123263586 CACTGCAGGCAGGCAGTGCTTGG + Intronic
1197822115 X:130552006-130552028 CACTGAAGTCAGAGAGGAAGGGG + Intergenic
1199794473 X:151181041-151181063 CACTGAAGGCAGACTTGGAGTGG - Exonic
1200561417 Y:4708276-4708298 CAGTGAAGGCAGGCAGAGAGGGG - Intergenic
1200807131 Y:7444528-7444550 CTCTTAAGGAAGGGAGGGAGGGG + Intergenic
1201385703 Y:13437474-13437496 CACAGAAGGAAGGCACAGAGTGG + Intronic
1201550515 Y:15212424-15212446 CAAGGAAGGGAGGGAGGGAGGGG + Intergenic
1201650519 Y:16279922-16279944 CAAGGAAGAAAGGCAGGGAGGGG - Intergenic
1202369961 Y:24189672-24189694 CAGGGAAGGCAGCCAGAGAGTGG + Intergenic
1202500823 Y:25480445-25480467 CAGGGAAGGCAGCCAGAGAGTGG - Intergenic