ID: 900283013

View in Genome Browser
Species Human (GRCh38)
Location 1:1883897-1883919
Sequence GGTTTCAGAAAATTTCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900283013_900283015 23 Left 900283013 1:1883897-1883919 CCTATGAGAAATTTTCTGAAACC 0: 1
1: 0
2: 0
3: 25
4: 259
Right 900283015 1:1883943-1883965 TCATCTAATTATAAAGTGTCCGG 0: 1
1: 0
2: 0
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900283013 Original CRISPR GGTTTCAGAAAATTTCTCAT AGG (reversed) Intronic
900073572 1:793461-793483 GGTTCCAGCATATTTATCATTGG - Intergenic
900283013 1:1883897-1883919 GGTTTCAGAAAATTTCTCATAGG - Intronic
900497723 1:2983665-2983687 GGTTTCTGAAAATAGCTCCTTGG + Intergenic
902215190 1:14930338-14930360 AGTTTCAGAAAAGCTCTCCTGGG + Intronic
905741139 1:40372949-40372971 TGCTACAGATAATTTCTCATTGG - Intronic
906745044 1:48215591-48215613 CGTTTCAGAAAATCCCTCTTGGG - Intergenic
907642229 1:56202457-56202479 AGTGTCAGAAAATTACTCATTGG - Intergenic
907755715 1:57308437-57308459 GCTTTCATAAAATTTTTCAAAGG - Intronic
909247708 1:73309404-73309426 GGTTTCAGAATTGTTATCATAGG - Intergenic
909523251 1:76593578-76593600 GCTTTCATAAATTTTCTCTTTGG + Intronic
911650075 1:100377924-100377946 GGTTTCAGAAAAATTATCCTAGG - Intronic
913471869 1:119196374-119196396 TCTTTCAGAAAATCTCTCGTAGG + Intergenic
919441881 1:197644740-197644762 GGTATCAGAAAATTTACTATTGG + Intronic
920587735 1:207183813-207183835 TTTTTCAGAAAATTTCTGATGGG - Intergenic
921176705 1:212601543-212601565 AGGTTAAGAAAATTGCTCATAGG - Intronic
922269435 1:224018368-224018390 GGTTCCAGCATATTTATCATTGG - Intergenic
922276530 1:224083947-224083969 GGATTCAAAGATTTTCTCATTGG - Intergenic
1065118288 10:22503541-22503563 GGTTTCCCCAAACTTCTCATAGG - Intergenic
1066094681 10:32060738-32060760 GGTTTAAGAAATATTTTCATGGG + Intergenic
1066342437 10:34549168-34549190 TCTTTCAGAGGATTTCTCATGGG - Intronic
1067200551 10:44168090-44168112 GTTCTAAGAAAATTTCTCACTGG - Intergenic
1068003119 10:51359983-51360005 GTCTTCAGAAAATTGCTCAGGGG + Intronic
1068335035 10:55623818-55623840 AGTGTCAGAAAATTTATCATTGG + Intronic
1068722485 10:60261540-60261562 GGTTTCAGAAATTTTAACTTAGG + Intronic
1068976932 10:63020356-63020378 GGTTTTAAAAAATTTATCTTAGG - Intergenic
1069097139 10:64272586-64272608 TGTTTCAGAAAATTTGTCTCAGG + Intergenic
1071213837 10:83375788-83375810 GGCTTCTGAAAATTTCAGATTGG + Intergenic
1071426898 10:85566341-85566363 GGATTCAAAAATTTTCTGATTGG - Intergenic
1072003877 10:91223119-91223141 ATTTTCAGAATATTTGTCATTGG + Intronic
1072299074 10:94041521-94041543 GGATCCAGAAACTTTCTCAAGGG - Intronic
1076114269 10:127884578-127884600 GGATTCAGAAGAGTTCTCCTTGG - Intronic
1078124321 11:8544927-8544949 GTTTTTAGAATATTTCTTATTGG - Intronic
1078168131 11:8908514-8908536 GGTTTTAGCACATTCCTCATAGG - Intronic
1079015479 11:16865287-16865309 GGTTTGTGAAAATGCCTCATGGG - Intronic
1079300865 11:19277834-19277856 GTTATCAGAAAATTTGTCATTGG + Intergenic
1082036952 11:47652719-47652741 GGATTCAGAGATTTTCTGATTGG - Intergenic
1082619625 11:55404075-55404097 GGTTCCAGAAAATTCATAATGGG - Intergenic
1082683712 11:56211796-56211818 GGCTTCAGGAAATCTCACATGGG - Intergenic
1085705261 11:78781564-78781586 GGTTTCCAAAAGTTTCTCTTGGG + Intronic
1086055416 11:82640556-82640578 TGTTTCAGAAATTTAGTCATTGG - Intergenic
1086382648 11:86273747-86273769 AGTGACAGCAAATTTCTCATCGG - Intronic
1086654471 11:89335721-89335743 TGTTTCAGTGAATTTGTCATTGG + Intronic
1086758818 11:90601464-90601486 GTTTCCAGACAATCTCTCATTGG - Intergenic
1086891964 11:92268758-92268780 GGCTTCAGAAAACTTCTGATTGG + Intergenic
1087928634 11:103949817-103949839 GGCTTGAAAAAATTTCACATAGG + Intronic
1087991127 11:104746074-104746096 GGTTTCAAACATTTTCTGATTGG - Intergenic
1088393664 11:109343742-109343764 GTTTTCAGAGATCTTCTCATAGG - Intergenic
1090151640 11:124390707-124390729 TTTATCAGAAAAGTTCTCATAGG - Intergenic
1090874074 11:130773419-130773441 AGTCTCAGAAGTTTTCTCATTGG + Intergenic
1091041013 11:132281281-132281303 GGTTTCAGGAGTTTTCTCACAGG + Intronic
1091931088 12:4395874-4395896 TATTTCAGAAAATTTCTAACTGG - Intergenic
1092645745 12:10570132-10570154 TGATTCAGAGATTTTCTCATTGG - Intergenic
1097611327 12:61824994-61825016 GGTTTCAGATAAATTCCCATGGG + Intronic
1101568522 12:105932298-105932320 GGTGTCAGACAATGTCTGATGGG + Intergenic
1104250419 12:127088396-127088418 GGTTTCAAATAATTTCTATTAGG + Intergenic
1105231688 13:18502248-18502270 GATTTCAGAAAAATTCTGCTGGG - Intergenic
1106219493 13:27733881-27733903 GGTTTGAGAATAATTCTCTTTGG - Intergenic
1106342465 13:28843583-28843605 GGATTCAGTAAATGTCACATGGG + Intronic
1107483590 13:40805394-40805416 CCTTTCAGAAAATCTCTGATAGG - Intronic
1107722248 13:43261045-43261067 GCTTTCAGAAAACTTCTCCTGGG + Intronic
1107768508 13:43763953-43763975 GGAATCAGATAAATTCTCATAGG - Intronic
1108135267 13:47350401-47350423 GTTTTGAGAAAGTTTCTCAGAGG - Intergenic
1109358104 13:61259003-61259025 GTCTTCAGATATTTTCTCATAGG + Intergenic
1111039078 13:82720727-82720749 GGTTTCTGAAATTTTCTATTTGG + Intergenic
1111745580 13:92265013-92265035 GTTTTCAGAAAGGTGCTCATGGG - Intronic
1111792256 13:92872214-92872236 GGGTTCAGAAAACTTTTGATAGG + Intronic
1112224000 13:97519626-97519648 GGCTTCAGAATATTTCTTTTTGG - Intergenic
1114018820 14:18457931-18457953 GGTTTCAGAACACTGCTAATGGG - Intergenic
1117275254 14:54187478-54187500 CTTTTCTGAAAATTCCTCATTGG + Intergenic
1119088723 14:71760545-71760567 GAATTCAGAAAATGTTTCATGGG - Intergenic
1119571859 14:75681883-75681905 GGTGTCAGACAATTCCTTATGGG - Intronic
1127063088 15:55207502-55207524 GGTTTCTGAATATTTTTCATAGG - Intronic
1127187669 15:56496101-56496123 GGTTTGAGAAAATATTTAATAGG + Intergenic
1127271327 15:57404420-57404442 GGTTTCAGAAAATCTGTGACAGG - Intronic
1133136893 16:3718335-3718357 GGATTCAGATACTTTCTGATTGG + Intergenic
1135518098 16:23151906-23151928 GGCTTGAAAAAATTCCTCATTGG + Intergenic
1135738039 16:24948924-24948946 GTTTTAAGAAAATTTACCATGGG - Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1135912581 16:26574907-26574929 GGATTCAAAAATTTTCTGATTGG - Intergenic
1137509019 16:49081956-49081978 GGTGTCAGAAAAGGTCTCTTGGG - Intergenic
1138119571 16:54388478-54388500 GCTTTCAGAAAATTCCACATTGG + Intergenic
1139824479 16:69746231-69746253 TGATTCAGAAAGTTCCTCATCGG + Intronic
1140951543 16:79823177-79823199 AGTTTCAGAAACTTTGGCATGGG + Intergenic
1141122618 16:81372582-81372604 GGTTTCAGAAAAATACGCGTAGG - Intronic
1141545126 16:84761774-84761796 GATTTCAGAAAGGTTCCCATCGG - Intronic
1141719518 16:85748269-85748291 GGATTCAAAAATTTTCTGATTGG + Intronic
1144189766 17:12833801-12833823 GGATTCAGAGATTTTCTGATTGG + Intronic
1145191869 17:20848927-20848949 AGTGTCAAAAAATTTATCATTGG + Intronic
1145402079 17:22548962-22548984 AGTGTCAGAAAATTTATCATTGG + Intergenic
1145989494 17:29070406-29070428 GGTTTTAGAAAATATGTCCTAGG + Intergenic
1146246699 17:31291105-31291127 GGTTCCAAAACATTTCTCATTGG + Intronic
1148194439 17:45703079-45703101 GGTCTCAGAAAACTGCACATAGG + Intergenic
1149795896 17:59519693-59519715 GGATTCAGACAATTTGTCAAAGG + Intergenic
1156226837 18:35117947-35117969 GGTTTCAGAGAATTTTTCACAGG - Intronic
1156319067 18:36001105-36001127 TGTTTAAGAAAATTTATCACGGG - Intronic
1156826055 18:41431172-41431194 GCGTTCAGGAAATTTCTCTTGGG - Intergenic
1156912000 18:42422213-42422235 GGTTTAAAAAAATATGTCATTGG + Intergenic
1156968533 18:43126890-43126912 CAATTCAGAAAATTTCTCCTTGG - Intergenic
1158626723 18:59078022-59078044 AGTTAAAGAAAATATCTCATGGG - Intergenic
1159228028 18:65565878-65565900 GTTTTCACAAAAATTTTCATAGG + Intergenic
1159677219 18:71299871-71299893 GGTTTCAGAAAATGTATCACTGG - Intergenic
1159831854 18:73286757-73286779 GGTGTCAGGAAATGTCTCAGTGG - Intergenic
1166592794 19:44015816-44015838 GGGTTCAAAGATTTTCTCATTGG + Intergenic
925168299 2:1733401-1733423 GGTGTCAGTAGATTCCTCATGGG + Intronic
925282375 2:2693621-2693643 GGTTTCACAAAATTTGTCCAAGG - Intergenic
925471574 2:4167786-4167808 AGTTTCAGAAATTTTTTCATTGG + Intergenic
929292195 2:40205975-40205997 GGTGACACAAAAATTCTCATTGG + Intronic
931149965 2:59561831-59561853 GGTTTTAGTAATTTTATCATGGG + Intergenic
935718459 2:105959489-105959511 GCTTCCAGAAAATTTCCCTTTGG + Intergenic
936677693 2:114734270-114734292 GGTTGCAAAATATTTCTTATGGG - Intronic
938943463 2:136189436-136189458 GGTTTCAGAAAATATCTTGCAGG - Intergenic
939324848 2:140674536-140674558 GGATTCAAAGAATTTCTGATTGG - Intronic
939388225 2:141530489-141530511 GGTTATTGAATATTTCTCATGGG + Intronic
939904208 2:147890672-147890694 AGTTTCAGAAAATTTTAAATTGG + Intronic
939973796 2:148693184-148693206 AGTTTCAGAAAATTTCACTCTGG + Intronic
940897871 2:159097906-159097928 TGTCCCAGAAGATTTCTCATGGG - Intronic
944579783 2:201122243-201122265 GTTTCCAGAAAATTTTGCATGGG + Intronic
944741196 2:202614198-202614220 TGTTTCAAAAAATTTCACAGTGG + Intergenic
944756376 2:202766199-202766221 CGTTTCAGAAAATGTAACATTGG - Exonic
944967405 2:204950787-204950809 GATTGCAGAAGATATCTCATAGG + Intronic
946987142 2:225286149-225286171 GCTTTCAGACAATTACTCATTGG - Intergenic
947253779 2:228138579-228138601 GATTTTAGAAAATGTGTCATAGG + Intronic
948420326 2:237856044-237856066 GGTGACAGAAGAGTTCTCATGGG - Intergenic
1169121759 20:3100866-3100888 GATATCAGAAAATATCTCAGTGG - Intergenic
1169853813 20:10081846-10081868 CATTTCATAAAATTTATCATTGG + Intergenic
1169935020 20:10874395-10874417 GGTTTTAGATAATTTCTCCTGGG + Intergenic
1172531789 20:35636073-35636095 GGTATCAGATGAGTTCTCATAGG - Intronic
1174014497 20:47476889-47476911 GGTTTCAAAGATTTTCTGATTGG - Intergenic
1174252761 20:49231801-49231823 GGATTCAGAGAAATCCTCATGGG - Intronic
1175520974 20:59602788-59602810 GGATTCAGAAACCTTCCCATGGG + Intronic
1175671214 20:60904333-60904355 GTTTCCAGATAATTCCTCATAGG + Intergenic
1177182818 21:17761712-17761734 TGTTTCAGAAAAATAGTCATTGG - Intergenic
1178277951 21:31255893-31255915 GGCTTCAGAGAATTTGTCCTGGG - Intronic
1178466101 21:32849468-32849490 GATTTCTGAAACTTTTTCATCGG - Intergenic
1178771738 21:35511122-35511144 ACTTTCAGAAAATTTCCCAGGGG - Intronic
1179188704 21:39105665-39105687 GCTTTGAGAAAATATCTCCTGGG + Intergenic
1180077672 21:45471254-45471276 GGTGTCAGGAACTTTCTCTTTGG + Intronic
1180443320 22:15388754-15388776 GGTTTCAGAACACTGCTAATGGG - Intergenic
1181839580 22:25645126-25645148 GATTTCACCAAATTTCTTATGGG - Intronic
1181966467 22:26659394-26659416 GATTTCAGAACAGTTCTCAATGG - Intergenic
1182040328 22:27233542-27233564 GGATGCAGAAAATATCTCAATGG + Intergenic
949778802 3:7662777-7662799 TTTTTCAGAAAATTTGACATAGG - Intronic
950195854 3:11008656-11008678 GGTTTCAGGGAATTTCACACAGG + Intronic
950852520 3:16076280-16076302 GGTTTCCAAAACTTTCTAATAGG + Intergenic
952561588 3:34600588-34600610 AGTTTTACAAAATTTCTCCTAGG + Intergenic
952610784 3:35206416-35206438 GGGTCCTGAAAATTCCTCATGGG + Intergenic
953217640 3:40936145-40936167 GGTCTGACAAAATCTCTCATAGG - Intergenic
955617463 3:60824261-60824283 GCTTTCAAAATATTTCGCATAGG - Intronic
956822383 3:72965602-72965624 GGATTCAGAAAATTTCCTCTTGG - Intronic
957773833 3:84729531-84729553 GGATTCAAAGATTTTCTCATTGG - Intergenic
958746590 3:98143158-98143180 TATTTAAGAAAAGTTCTCATAGG - Intergenic
958820924 3:98973017-98973039 AGTTTCAGAAGAATTCTCATTGG - Intergenic
964260322 3:154828074-154828096 GGATTCAAAGATTTTCTCATTGG + Intergenic
965250038 3:166331374-166331396 GGCTGAAGAAAATTTCTTATTGG + Intergenic
965922343 3:173932711-173932733 GGTTTCATCAAATTTCTTAGAGG + Intronic
969667403 4:8568075-8568097 GGATTCAGAGATTTTCTGATTGG + Intronic
969992121 4:11275449-11275471 GGGTGCAGAAAATTTATCCTGGG - Intergenic
970784638 4:19781299-19781321 TGTTTCAGAGATTTTCTCAGAGG + Intergenic
971534021 4:27725664-27725686 TGGTTCAGAAATTTTCTGATGGG + Intergenic
972176665 4:36416616-36416638 AAATTCAGAAAATCTCTCATAGG - Intergenic
972778253 4:42263629-42263651 GGTTTTAAAAATTTTCTGATAGG + Intergenic
972988176 4:44791402-44791424 GCTTTCAGAAAATTGATAATTGG + Intergenic
974464459 4:62236714-62236736 AGTTTTAGAAAATTTGTCTTTGG + Intergenic
974622663 4:64381180-64381202 GTTTTCAGCCAGTTTCTCATTGG + Intronic
974722045 4:65752802-65752824 GGTTTCAGATAGTTTCTTCTGGG - Intergenic
974795915 4:66749385-66749407 GTTTTCAGCATATTTCTCAATGG + Intergenic
975338350 4:73207673-73207695 TGTTTCAAAATATTTCTCTTTGG - Intronic
976780100 4:88749226-88749248 GCTTTCAAAAAATTCCTCAGAGG + Intronic
977073268 4:92420101-92420123 GGTTTCACAAAATGTATCACTGG + Intronic
977212556 4:94236792-94236814 ATTTTCTGAAAATTTATCATAGG + Intronic
979912576 4:126387191-126387213 TTTTACAGAAAATTTATCATTGG - Intergenic
982091857 4:151886881-151886903 AGTTACAGAAAATTTCTCTTAGG - Intergenic
982654813 4:158134857-158134879 GGTTTCTGCAGATTTCTAATGGG - Intronic
983153017 4:164309005-164309027 GGTTACATAAAATTTTGCATCGG + Intronic
985060897 4:186077491-186077513 GGTTTCAGAAATCTCCTCAGTGG + Intronic
985829331 5:2216563-2216585 GGTTTCAGGGAATATCACATGGG - Intergenic
987392267 5:17387230-17387252 AGACCCAGAAAATTTCTCATAGG - Intergenic
987813159 5:22865535-22865557 GTTTGCAGAAAAATTTTCATTGG + Intergenic
987854184 5:23397423-23397445 GGTGACAGAGAATTTCCCATGGG - Intergenic
989707213 5:44349171-44349193 ACTTTGAGCAAATTTCTCATAGG + Intronic
991119895 5:63000385-63000407 GGTAACGGAAAATTTCTCAAAGG - Intergenic
991519627 5:67481289-67481311 GTGTTCAGAAAATAACTCATGGG - Intergenic
992477792 5:77120762-77120784 GATTTCAGAAAACTCCTCAACGG - Intergenic
992933670 5:81678106-81678128 GTTTTAAGAAAATTCCTGATTGG - Intronic
994862529 5:105216458-105216480 GCTTTCAAAAATTTTCACATGGG + Intergenic
995477366 5:112561833-112561855 GGTTTCAAAGATTTTCTGATTGG - Intergenic
996245455 5:121258388-121258410 GGTGTGAGATGATTTCTCATTGG + Intergenic
996572642 5:124948675-124948697 GTTTTCTGAAAATTTTCCATTGG - Intergenic
996602867 5:125286977-125286999 GGTTTTAGAAAATTTGGGATTGG - Intergenic
996972994 5:129395517-129395539 GGATTCAAAGATTTTCTCATCGG - Intergenic
997829313 5:137135458-137135480 GGTTTTAGCAACATTCTCATAGG - Intronic
998439646 5:142147033-142147055 GTTGTCAGAAACTTTCTCAGAGG + Intronic
998581009 5:143376062-143376084 TGCTTTAGAAAAATTCTCATTGG - Intronic
998936120 5:147232761-147232783 GGTATCAGAAAAAATATCATGGG - Intergenic
999211605 5:149894339-149894361 AATTTCAGAAAATTTCTCTGGGG + Intronic
999679802 5:154046269-154046291 TGTTTCAGAGAATTTATAATAGG + Intronic
1002783991 6:387378-387400 GTTTTCAGAAAATTGCCCAAAGG + Intergenic
1003787026 6:9498005-9498027 GGATTCAGAGATTTTCTGATGGG + Intergenic
1005276806 6:24228280-24228302 GCTTGCAGAAATTTACTCATTGG + Intronic
1005636782 6:27760360-27760382 GGTCTCAGAAAAATTCCCAGGGG - Intergenic
1005676090 6:28156843-28156865 GGTTTCAGAGATTTTCTCCATGG + Exonic
1006473234 6:34239771-34239793 GTTTTCCTAAAACTTCTCATTGG - Intronic
1006605549 6:35254388-35254410 GGTTTTAGAAAATATTTTATAGG - Intergenic
1007330881 6:41107476-41107498 GGGTTCAGAAAACTCCTCAAGGG + Intergenic
1008061624 6:47003628-47003650 GGATTCAAAGATTTTCTCATTGG - Intronic
1008306779 6:49912510-49912532 GCTTTGAGAAAATGTCTCAAAGG + Intergenic
1012357426 6:98332925-98332947 GGATACAGAAGATTTCTCAAAGG - Intergenic
1015261688 6:131245125-131245147 TGTTTCAGAATCTTTCTCTTTGG + Intronic
1015687283 6:135879025-135879047 GGTTTCATAAAATTTTACATGGG - Intronic
1016724871 6:147351965-147351987 GCTTTTTGAAAATTTCACATAGG + Intronic
1017267304 6:152462786-152462808 GGGTTCAGAAAGTTTCTTATGGG + Exonic
1018010544 6:159666023-159666045 GGCTTCAGGACAATTCTCATTGG + Intergenic
1018069618 6:160152193-160152215 AATGACAGAAAATTTCTCATTGG + Intronic
1018254591 6:161905326-161905348 AATTTCAGAAAATTCCTCCTGGG - Intronic
1018595754 6:165478884-165478906 GGATTCAAAAATTTTCTGATGGG - Intronic
1020405341 7:7826697-7826719 GCTTTCAGAAAATTACTTAAAGG - Intronic
1021526010 7:21588790-21588812 GGTTTTGGAATATTTCTAATGGG + Intronic
1024759429 7:52576849-52576871 GGTTTCAGAATTTTCCTCAGAGG + Intergenic
1026086489 7:67267305-67267327 GGATTCAGAGATTTTCTGATGGG - Intergenic
1026690655 7:72547552-72547574 GGATTCAGAGATTTTCTGATGGG + Intergenic
1026957021 7:74383672-74383694 GGTTTCCAAAACATTCTCATGGG + Intronic
1027329140 7:77073018-77073040 AGTTTCAGTAAATTACTTATTGG - Intergenic
1027628041 7:80567796-80567818 TGTTTCAGAAAATATCCCAAAGG + Intronic
1027708782 7:81570656-81570678 TATTTCAGAAAATATTTCATGGG + Intergenic
1028338849 7:89693215-89693237 TTTATCAGAAAATTTCCCATGGG + Intergenic
1028445002 7:90912023-90912045 TATTTAAGACAATTTCTCATTGG + Intronic
1029157896 7:98530244-98530266 GGATTCAGAGATTTTCTGATTGG + Intergenic
1029786627 7:102798349-102798371 AGTTTCAGTAAATTACTTATTGG + Intronic
1030825833 7:114156491-114156513 GGATTCAAAGATTTTCTCATTGG - Intronic
1032293675 7:130614791-130614813 GGTTTTAGAAAATATTTCATAGG + Intronic
1032350963 7:131163305-131163327 TATTTAAGAAACTTTCTCATAGG - Intronic
1032473502 7:132195675-132195697 GGTTTCATAAATTTTCACATGGG + Intronic
1032674309 7:134114370-134114392 GGATTCAGAGATTTTCTGATTGG - Intergenic
1032718907 7:134534788-134534810 GGTTTCCCAAAATTTCAGATGGG - Intronic
1033391194 7:140929123-140929145 GGTTTCTGAGCATTTCTCAGTGG - Intergenic
1033560527 7:142526463-142526485 GGTTTCAGAAGCTTTCGCCTGGG - Intergenic
1037477586 8:19272279-19272301 GGTTTCAGAAGGTTTCTCCCAGG - Intergenic
1037613151 8:20493522-20493544 GGTTTCAGAAAAGCTCTCCTGGG + Intergenic
1037739743 8:21598773-21598795 GGTGTCAGAAAAGTTACCATAGG + Intergenic
1038053467 8:23835661-23835683 GTTTTCAGAAAATTTGTTCTGGG - Intergenic
1038202507 8:25427122-25427144 GGTTTCAGAGAATTAATCCTTGG + Intergenic
1038285425 8:26202390-26202412 GGTTACAGAAAATTTCTTCATGG + Intergenic
1038465159 8:27755370-27755392 GGTTACAGAACATATCTCAAAGG + Intronic
1039034064 8:33340528-33340550 AGTTTAAGAGAATTTCTTATGGG - Intergenic
1039368725 8:36962195-36962217 CTTTTCAGAAAATTTATTATTGG + Intergenic
1041342715 8:56863065-56863087 GGTTTCACAAAAATACTCAGAGG - Intergenic
1041550985 8:59101399-59101421 GGTTTTAGAACATTTGCCATAGG - Intronic
1041833355 8:62181952-62181974 AGTATCAGAAATTGTCTCATTGG + Intergenic
1041980787 8:63856740-63856762 GCTTAGAGAAAATTTTTCATTGG - Intergenic
1045850419 8:106689686-106689708 GGGTTAAGTTAATTTCTCATAGG + Intronic
1046438577 8:114228898-114228920 GGTTTTATAAAATTTCTCCCTGG + Intergenic
1047376657 8:124304706-124304728 GATTTCACAAAATTATTCATGGG + Intergenic
1047776450 8:128074848-128074870 GGTTTCTAAAAATAACTCATGGG - Intergenic
1047879195 8:129174066-129174088 GGCTTCTGAAAATTTCTGATTGG + Intergenic
1048039820 8:130716275-130716297 AATGTCAGAAAATTTCTCAAAGG + Intergenic
1048425720 8:134321592-134321614 GGTGTCAGAAATTTTCTCTAAGG + Intergenic
1048720548 8:137319390-137319412 GGTTTCAGAAAAGGACTCACAGG - Intergenic
1050567999 9:6906747-6906769 GGTTTTTAAAAATTTCTCTTTGG + Intronic
1051957929 9:22719482-22719504 TGTTTTAGAAAATGTTTCATGGG + Intergenic
1053650027 9:40158636-40158658 TGTTTCAAAAAGTTTCTCAATGG - Intergenic
1054861401 9:69957546-69957568 GGTTTCAAAATATGTCTCTTTGG - Intergenic
1054930276 9:70628437-70628459 GGTTTCAGGAAAATCCTCAAAGG + Intronic
1055938825 9:81629196-81629218 GGTTTAAAAAAATTTATAATAGG - Intronic
1056460130 9:86801300-86801322 GGATTCAAAACATTCCTCATGGG - Intergenic
1056726456 9:89123371-89123393 GGTTCCAGATAGTTTCTAATTGG - Intronic
1057224251 9:93279963-93279985 GGTTACATAAATTTTCTCCTAGG - Intronic
1057737407 9:97677186-97677208 GTATTCAGAAAATTTTTCTTTGG - Intronic
1058435503 9:104958795-104958817 TCTTTCAGAAAAATTCTAATTGG + Intergenic
1060061936 9:120468401-120468423 AGTTTCAGAAACTTTCGCCTTGG - Intronic
1060678775 9:125542685-125542707 GTTTTCACATAATTTCCCATGGG - Intronic
1185726721 X:2427520-2427542 GGATTCAGAATATGTCTCACAGG + Intronic
1186436586 X:9548000-9548022 GGTTTCAGAAATTTTTACGTTGG + Intronic
1190983078 X:55474751-55474773 GTTTTTAGAAAAATTCTTATTGG - Intergenic
1190985621 X:55498432-55498454 GTTTTTAGAAAAATTCTTATTGG + Intergenic
1193530204 X:82646865-82646887 GGTATCAGAAAATTTTTGGTAGG + Intergenic
1194018797 X:88660464-88660486 GGGCTCAGAAAATTACACATAGG - Intergenic
1194481756 X:94435440-94435462 AGATTCAAAAATTTTCTCATTGG + Intergenic
1194732497 X:97472435-97472457 GGTTTCCGAAAATCACTTATAGG + Intronic
1194955721 X:100177941-100177963 GGTTTCTGCAGCTTTCTCATGGG + Intergenic
1196257572 X:113539642-113539664 GGATTCAAAAATTTTCTGATTGG + Intergenic
1198597487 X:138252640-138252662 GGCTTCAGAAAATTATTCTTTGG - Intergenic
1199984439 X:152940460-152940482 GGATTCAGAGATTTTCTGATTGG + Intronic
1200927117 Y:8664544-8664566 GGTATCTGAAAACTTCTCTTCGG - Intergenic
1201851169 Y:18482094-18482116 GGTTTAAGTAAATGTCTCTTAGG + Intergenic
1201882150 Y:18838284-18838306 GGTTTAAGTAAATGTCTCTTAGG - Intergenic