ID: 900283870

View in Genome Browser
Species Human (GRCh38)
Location 1:1890376-1890398
Sequence GGCGGCCGGAGCCCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900283870_900283877 6 Left 900283870 1:1890376-1890398 CCCGCGCGGGGGCTCCGGCCGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 900283877 1:1890405-1890427 GCCCCGCCTGCAGGCCCGCCCGG 0: 1
1: 1
2: 1
3: 47
4: 521
900283870_900283887 27 Left 900283870 1:1890376-1890398 CCCGCGCGGGGGCTCCGGCCGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 900283887 1:1890426-1890448 GGCCTTTGTTCTCGCGCCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 34
900283870_900283886 26 Left 900283870 1:1890376-1890398 CCCGCGCGGGGGCTCCGGCCGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 900283886 1:1890425-1890447 CGGCCTTTGTTCTCGCGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 31
900283870_900283874 -3 Left 900283870 1:1890376-1890398 CCCGCGCGGGGGCTCCGGCCGCC 0: 1
1: 0
2: 2
3: 38
4: 328
Right 900283874 1:1890396-1890418 GCCGACACCGCCCCGCCTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900283870 Original CRISPR GGCGGCCGGAGCCCCCGCGC GGG (reversed) Intronic
900166669 1:1246756-1246778 GGCGCTCAGAGCCCCCGCGCGGG + Intergenic
900255033 1:1693435-1693457 GGGGGGCGGGGCCGCCGCGCGGG + Intronic
900263776 1:1746701-1746723 GGGGGGCGGGGCCGCCGCGCGGG + Intergenic
900269205 1:1778543-1778565 GGCGCCGGGACACCCCGCGCGGG + Intronic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900633428 1:3650834-3650856 TGCGGACCGAGCGCCCGCGCAGG - Intronic
900648123 1:3718139-3718161 GGCGGCCGGACCACCCACCCCGG - Intronic
901233669 1:7655856-7655878 GGAGGCCTGAGCCCCCATGCGGG + Intronic
902401916 1:16162564-16162586 TGCGGGCGGAGCCTCCGGGCAGG + Intergenic
902585727 1:17437936-17437958 GGCGGCCGAAGCCCGCACGAGGG - Intronic
902680733 1:18042182-18042204 GGAGGCAGGGGCCCCCGCGGGGG + Intergenic
903652267 1:24929535-24929557 GACGCCCGGAGCCCCAGGGCCGG + Intronic
903822405 1:26112237-26112259 CGCGGCCTGAGCCGCCGCGTCGG + Intronic
903829128 1:26164427-26164449 GGCGGCGCGACCCCCCTCGCAGG - Intergenic
904769045 1:32870843-32870865 GGCGGCCGGAGCGGCCGGGCCGG - Intronic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
905168548 1:36097546-36097568 GGCAGCAGGACCCCCCCCGCGGG + Exonic
905648303 1:39639752-39639774 GGCGCCCGGAGCTGCGGCGCAGG - Exonic
905684880 1:39901267-39901289 GGGGGCCGGGTCCCCTGCGCCGG + Exonic
905861576 1:41355509-41355531 GGCGGCCATAGCCCCAGCACTGG - Intergenic
906206709 1:43991086-43991108 GGAGGCAGGAGCCCCAGGGCCGG + Exonic
906962688 1:50427955-50427977 AGCGGCAGGAGCCCCCGAGGCGG + Intergenic
907421862 1:54353084-54353106 TGCAGCTGGAGCCCCCGTGCAGG - Intronic
908226843 1:62064601-62064623 GGTGGCATGAGCCACCGCGCCGG + Intronic
910449085 1:87328823-87328845 GGGGGCGGGGGCCCCCGGGCGGG + Exonic
912652173 1:111449208-111449230 GCCGGCCGGAGACTCCGCTCCGG + Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914694258 1:150061644-150061666 GGCAGCCAGAGCCCCTGGGCAGG - Intergenic
915128090 1:153679519-153679541 GACCGCCGGCGCCCCGGCGCTGG + Exonic
917565263 1:176206811-176206833 GGCGGCCTGGGCCACCCCGCCGG + Exonic
917904545 1:179575879-179575901 GGCGGCTGGAGCAGCAGCGCGGG + Exonic
920612378 1:207454394-207454416 CACGGCCGAAGCCCCCGCGGCGG - Exonic
921089479 1:211830154-211830176 GGCGGGCGCGGCCCGCGCGCCGG + Intronic
922250491 1:223845534-223845556 GGGGGCCGCAGCCCGCGCGGAGG - Intronic
922279965 1:224114267-224114289 GGCGCTCCCAGCCCCCGCGCTGG + Exonic
922505226 1:226122140-226122162 GGCGGGAGGGGCCCCGGCGCTGG + Intergenic
922696789 1:227734982-227735004 GGCGGCCGCAGACCCCGGGCGGG - Exonic
922804152 1:228377090-228377112 GGCGGCCAGCGCCCGCCCGCTGG - Exonic
922937702 1:229434227-229434249 CGCGGCCTGGGCCCCCGCCCGGG + Intergenic
923191779 1:231626913-231626935 GGCGGCGTGAGCCACCGCGCAGG + Exonic
923506303 1:234609255-234609277 GGCGGCCGAGGCCGCGGCGCCGG + Exonic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
924289698 1:242524655-242524677 GGCGAGCGGAGCGCCCGCTCGGG - Intronic
1063418273 10:5890419-5890441 CGGGCCCGGACCCCCCGCGCAGG - Intronic
1064712447 10:18140835-18140857 GGCGCTCGGAGCCGCCGCACAGG + Exonic
1065925949 10:30434000-30434022 GTAAGCCAGAGCCCCCGCGCTGG - Exonic
1067091224 10:43266689-43266711 CGCGCCCGGAGCCCGCGCCCCGG + Intronic
1067462186 10:46466012-46466034 GGCGGCTGGAGCCCTCTCGTGGG - Intergenic
1067625010 10:47918586-47918608 GGCGGCTGGAGCCCTCTCGTGGG + Intergenic
1070162571 10:73874684-73874706 GGCGGCGGGAGGCCCCTCCCCGG - Intergenic
1071858008 10:89645160-89645182 GGCGGCGGGAGCCCCGGCTGGGG - Exonic
1071977517 10:90969724-90969746 TGCTGCCAGAGCCCCCGGGCAGG + Intergenic
1073030223 10:100519815-100519837 GGCGGCCGGAGCCGCTCCTCTGG + Exonic
1073266387 10:102230736-102230758 GGCGGCCGGAGCCAGCCCGGGGG + Exonic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1076199561 10:128547350-128547372 GGAGGCAGGAGCCCCCCAGCAGG + Intergenic
1076707223 10:132308399-132308421 GGCGGCGGAAGCCCGCGCGCCGG - Intronic
1076821808 10:132943319-132943341 GGGGCGCGCAGCCCCCGCGCGGG + Intergenic
1077038007 11:504488-504510 GGCGGGCGGAGCCTCCAGGCCGG + Intronic
1077043746 11:535496-535518 CGCGGACGGAGCCCATGCGCGGG - Exonic
1077325490 11:1962152-1962174 GGCGGCCAGAGCCCTGGGGCTGG - Intronic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1078246218 11:9574535-9574557 GGCGGCCGGGGCCGCGGCGCCGG + Intronic
1079237154 11:18699022-18699044 GGCGGCCGGAGTCCCGCGGCGGG + Intronic
1080628610 11:34052510-34052532 GGGAGCCGGGGCCGCCGCGCCGG + Exonic
1081636770 11:44727038-44727060 GGCCGCCCGAGCCCCAGCCCCGG + Intronic
1083627177 11:64077783-64077805 GGCGGCCGGAGGCCCAGCCAGGG - Intronic
1083657010 11:64234624-64234646 GGCGGCCGGAGGAGCCGGGCGGG - Exonic
1083659750 11:64246616-64246638 GGCGGCCCCGGCCCCCGGGCCGG - Exonic
1083886520 11:65576009-65576031 GGCGGGCGGGGCTCCGGCGCGGG - Intergenic
1084177109 11:67428683-67428705 GGCGTGCGGAGCCGCCGCTCCGG - Intronic
1084588858 11:70078815-70078837 GGGGGCCGCACCCTCCGCGCAGG + Intronic
1084642640 11:70434878-70434900 GGCAGCAGGAGCCTCCGCGGTGG + Intronic
1084659402 11:70538187-70538209 GGCTGCAGGAGCCCCCGGGTGGG - Intronic
1084681748 11:70670434-70670456 GGCGGCCAAAGCGCCCGAGCTGG - Intronic
1087962266 11:104366539-104366561 CGCGGCCGGAGCGCCAGCGCGGG - Intergenic
1091226027 11:133956863-133956885 GGCTGCAGGAGCACCGGCGCGGG - Exonic
1202808470 11_KI270721v1_random:17331-17353 GGCGGCCAGAGCCCTGGGGCTGG - Intergenic
1092695929 12:11171361-11171383 GGAGGACGGAGCCGCCGCGGGGG - Intronic
1092868723 12:12787033-12787055 GGCGCCTGGAGCGCCTGCGCAGG + Exonic
1094218594 12:27970600-27970622 GGCTCCCGGATCCGCCGCGCCGG - Intronic
1095296779 12:40535926-40535948 GGCAGCGGGAGCACCCGAGCAGG + Intronic
1095440850 12:42237945-42237967 GGCGACCGGAGCGGCCGCCCGGG - Intronic
1095949385 12:47773574-47773596 GGCGGCGGCAGGCCCCACGCGGG + Intronic
1096983732 12:55743385-55743407 GGCGGCCGAGGGCCCCGCGGCGG + Exonic
1099202119 12:79690065-79690087 GGTGCCCAGAGCCCCCGCGGGGG + Exonic
1100444573 12:94649646-94649668 GGAGGCCGCAGCCCAAGCGCGGG - Intronic
1101253831 12:102958358-102958380 GGCGGCCGCAGCCGCCGCAGCGG + Exonic
1103764375 12:123270828-123270850 GGCTGCTGGGGCCCGCGCGCGGG - Intronic
1106248366 13:27966914-27966936 GGTGGCCGCAGCCCGCGGGCCGG - Intronic
1106517257 13:30465714-30465736 GGCGGCCGGATCCCCGCGGCCGG - Intronic
1107141081 13:36999234-36999256 GGCGGCCGCAGCCCTCGTACTGG - Exonic
1107467980 13:40666450-40666472 GCCGGCCAGAGCCGCCGGGCCGG + Exonic
1108408018 13:50124326-50124348 GCCGCCCGGAGTCCCCGCCCTGG - Intronic
1108408431 13:50125851-50125873 CGCGGCCCGAGCCCACGAGCTGG - Intronic
1112570347 13:100588491-100588513 CGCGCCCGTGGCCCCCGCGCGGG + Intronic
1112652656 13:101416136-101416158 TGCGGGCGGGGGCCCCGCGCGGG - Intronic
1112894533 13:104282934-104282956 GCAGGCGGGAGCCACCGCGCCGG - Intergenic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113841484 13:113363969-113363991 GGCGGCTGCGGTCCCCGCGCGGG - Intronic
1116152139 14:41154503-41154525 GCCGGCCGGAGCCGCCGGCCCGG - Intergenic
1117297435 14:54393038-54393060 GGCGGCCCGAGCCTCCCCGATGG - Intergenic
1118137490 14:63045550-63045572 GGCGGCCGGCGCCTGGGCGCGGG + Intronic
1119539359 14:75428370-75428392 GGCTGCGGGAGCCTCCCCGCGGG - Intronic
1120365318 14:83561398-83561420 GGCAGCCGCAGCCACCGTGCTGG - Intergenic
1120993283 14:90397162-90397184 CGCCGTCGCAGCCCCCGCGCTGG + Exonic
1121535722 14:94689618-94689640 GCTGGCCGGGGCCTCCGCGCTGG + Intergenic
1121546731 14:94768730-94768752 GGCGGCGGGACACCCCGCGCAGG + Intronic
1122557977 14:102591905-102591927 GGAGGCCGGGGCCCCCGGGGTGG - Intergenic
1122783820 14:104154889-104154911 GGTGGCAGGAGCCCCCAAGCCGG - Intronic
1123964083 15:25438500-25438522 GGCCGCCGCAGCCCAGGCGCGGG - Exonic
1124118496 15:26868173-26868195 GGCGGCGGGAGGCGCCGCCCGGG + Intronic
1124426969 15:29570709-29570731 GCCGGCCGGAGGCATCGCGCCGG + Exonic
1124453611 15:29821769-29821791 GGCGCCCGCAGCCCCCTCCCCGG + Intronic
1127674814 15:61228953-61228975 GGCCGCCGGACCCCGCGCCCCGG + Intronic
1128153552 15:65377873-65377895 CCCGGCCGGAGCCCCAGCCCCGG - Exonic
1128161062 15:65423012-65423034 AGCGGCCCTGGCCCCCGCGCCGG - Exonic
1129162057 15:73752672-73752694 GGCGTCCGGAGCGGCCGCGAGGG + Exonic
1129274032 15:74433783-74433805 GGCGGCCGCCGCCTCCGCCCAGG - Exonic
1129644736 15:77419830-77419852 GGCCGCCAGAGCCCCGGCGGCGG + Intronic
1129752803 15:78077625-78077647 GGGGGCCGGAGCCCGGGCGGAGG - Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132365143 15:101251615-101251637 GCCGCCCGCAGGCCCCGCGCCGG + Exonic
1132398263 15:101489630-101489652 GGCGGCCGGGGCCCGGGCGCAGG + Exonic
1132551298 16:554867-554889 TGCGGCCGCAGCCCCAGGGCCGG + Intergenic
1132583087 16:694213-694235 GGCGCCCCGCGCCCCCGCCCAGG + Exonic
1132726879 16:1342736-1342758 GGAAGCCGGATCGCCCGCGCTGG - Exonic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132928792 16:2447877-2447899 GGCGTCTGCAGCCCCCACGCTGG + Intronic
1135409909 16:22225772-22225794 GGCGGCCAGTCCCCCCGAGCTGG + Exonic
1136567998 16:31081364-31081386 GGCGGTAGGAGCGCCCGCACTGG - Exonic
1136590528 16:31215406-31215428 GGCGGGCGGAGCCCCAGGGCGGG + Intronic
1137777199 16:51065924-51065946 ACAGGCCTGAGCCCCCGCGCCGG - Intergenic
1138179236 16:54931056-54931078 GCGGGCCGGAGCCCCGGAGCCGG + Exonic
1138514007 16:57526019-57526041 GGCGGCCTGAGCTGCCCCGCGGG + Exonic
1138605624 16:58086450-58086472 GGGGGCTGGAGCCCCAGCTCTGG + Intergenic
1138660801 16:58515896-58515918 GGCGGGCGGAGGACCCGCGGCGG + Exonic
1139418079 16:66830683-66830705 GGCGCTCGGAGCTCCCGCCCTGG - Intronic
1139594499 16:67950010-67950032 GGCGGCCTGAGCCCCCAAGGCGG - Intronic
1141418939 16:83899237-83899259 GGCGGCCGGCGCCCTGGAGCGGG + Exonic
1142130190 16:88428723-88428745 GGTGTCCGGAGGCCCCGGGCTGG - Exonic
1142271921 16:89094188-89094210 GGGGAGCGGGGCCCCCGCGCGGG + Intronic
1143007389 17:3845944-3845966 GGTGGCCGGAGCCCCAGCCGGGG - Intronic
1143150872 17:4807145-4807167 TGCAGCCGGAGCCCACGCCCCGG - Exonic
1143166772 17:4900769-4900791 TGAAGCCGGAGCCCCCGCGGGGG - Exonic
1143446817 17:7014758-7014780 AGCGGCTCGGGCCCCCGCGCAGG - Exonic
1144703435 17:17352798-17352820 GGCGGCAGGAGCCGCAGCCCAGG + Intergenic
1146052732 17:29566506-29566528 GGCCGCCGGATCACCAGCGCCGG - Exonic
1146054134 17:29572827-29572849 GGCTGCTGCAGCCCTCGCGCCGG + Exonic
1146322722 17:31859166-31859188 GGCCGCCGGGGCCCAGGCGCAGG - Exonic
1146438912 17:32876877-32876899 GCCCACCTGAGCCCCCGCGCTGG - Exonic
1147684038 17:42276369-42276391 GGCGGCCGGAGCCGTCACCCCGG - Exonic
1147740793 17:42670097-42670119 TGCGGCCGGCCCCGCCGCGCCGG + Exonic
1148048750 17:44759161-44759183 GGCAGCCGCAGCCCCCGGACCGG + Exonic
1148652537 17:49260315-49260337 GGCGGCCGGGGCAGCCGCGTGGG - Intergenic
1151780241 17:76240548-76240570 CGGGGCGGGAGCGCCCGCGCCGG + Intergenic
1151854310 17:76710552-76710574 GGCAGCCGGAGCCCCGGGGGTGG + Intronic
1152197214 17:78924927-78924949 GGCGACCCCAGCCCCCGCGCGGG - Intronic
1152410254 17:80119489-80119511 GGGGGCCAGAGCCCCGGCCCAGG - Intergenic
1152655554 17:81517740-81517762 GGCGGCCGGAGCTCCTGGGGTGG - Intronic
1152682125 17:81673979-81674001 GGCGGCCCCAGCCCTCGCGTTGG + Intergenic
1152730264 17:81966660-81966682 GGGGGCCGGAGCCCCCCCCCTGG + Intergenic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1153457522 18:5296252-5296274 GGCGCGCGGAGCCCGCGCGCGGG + Intronic
1153906069 18:9662430-9662452 GGTGGCATGAGCCACCGCGCCGG - Intergenic
1154501017 18:14998117-14998139 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
1155392167 18:25349789-25349811 GGCGGCTGGTGCGCCCGCCCGGG - Intronic
1156384616 18:36594055-36594077 GGCTGCCGCAGCCCCAGGGCTGG + Intronic
1157384035 18:47247414-47247436 GGCGGCCGCGGCCCCTGCCCCGG + Intronic
1158647962 18:59264447-59264469 GACCGCTGGAGCCCACGCGCAGG - Intergenic
1158954167 18:62523611-62523633 GGCGGCCCGAGTCCCCGGGGCGG - Exonic
1159798225 18:72868200-72868222 CGCGGCCGGCGCCCCGGGGCTGG + Intergenic
1160242421 18:77132967-77132989 GGCGCACGGGGCCCACGCGCAGG + Intronic
1160348244 18:78152182-78152204 GAAGGCCGGAGCCCCCGGGATGG - Intergenic
1160719163 19:589997-590019 GGCGGCGGCGGCCCCGGCGCGGG - Exonic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1161089549 19:2353107-2353129 GGGGGCTGGAGCCCCCATGCGGG + Exonic
1161382140 19:3971040-3971062 TACGGCCGGCGCCGCCGCGCTGG + Exonic
1161764515 19:6199267-6199289 GGCGGCCGGAGACCCCCAGATGG - Intronic
1162630810 19:11925476-11925498 CGCGGCCGCAGTCGCCGCGCAGG - Intronic
1162935331 19:13978999-13979021 CGCCGCCGGAGCCGCCGCCCCGG - Intronic
1163123493 19:15232037-15232059 GGCGCCCGCAGCAGCCGCGCCGG + Exonic
1163243129 19:16076444-16076466 GGCGGGGGCGGCCCCCGCGCAGG + Intronic
1164675103 19:30095486-30095508 GGTGGCCGGAGCCCCACTGCAGG - Intergenic
1164713337 19:30374867-30374889 GGCGGCAGGCGCCCCAGCCCGGG - Intronic
1164977089 19:32581400-32581422 GGCGCCCAGAGCCTCCGCCCCGG - Intronic
1165832726 19:38737253-38737275 GGCGTGCGGCCCCCCCGCGCTGG + Exonic
1165879470 19:39032179-39032201 GGCCGCCCGGGTCCCCGCGCCGG - Exonic
1166290539 19:41860503-41860525 GGCGTCCGGAGTCCCGGGGCTGG + Intronic
1166798998 19:45444366-45444388 GGCGGCCTGGGAACCCGCGCCGG - Intronic
1167501334 19:49850602-49850624 GGCGGGCGGAGCCTGGGCGCCGG + Intergenic
1168163243 19:54527058-54527080 AGAGGCCGGATCTCCCGCGCGGG - Intergenic
1168318235 19:55493626-55493648 GGCGGCCGGCGCACCCGTGGGGG - Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
925376280 2:3388336-3388358 GGGGGCCGGGGAGCCCGCGCCGG - Exonic
925409070 2:3628406-3628428 GGCGGCCTGAGACCCTGCACTGG + Intronic
925984874 2:9207240-9207262 TGCGGCCGGAGCCGCCGCGCAGG - Intronic
927772772 2:25878250-25878272 GGCGGCCGGAGCCCGGACACGGG - Intronic
927881489 2:26692813-26692835 GGCGGCCGGGGCCGAGGCGCGGG + Exonic
928149085 2:28810516-28810538 GGAGGCCGCAGCCCCAGCCCCGG + Intronic
929857774 2:45650896-45650918 GGGGGGCGGGGACCCCGCGCGGG - Intergenic
929974313 2:46617032-46617054 GGCGGCCCAGGCCCACGCGCAGG + Exonic
930872756 2:56184633-56184655 GGCGGCCGGAGGCGCGGCGGCGG + Exonic
931694253 2:64859957-64859979 GGCGGCCGCAGCCCCGGGGCGGG + Intergenic
935112221 2:100104490-100104512 GGCGGCCCGAGCCTCGGCGGCGG - Exonic
938186117 2:129233434-129233456 GGCAGCGGGAGCCCCGCCGCAGG - Intergenic
938414631 2:131093813-131093835 GGCGCCCGCAGCCTCCGCACTGG - Intergenic
938500188 2:131828306-131828328 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
941021091 2:160408081-160408103 AGCAGCCGGCGCCCCCGCTCTGG + Intronic
941906164 2:170717050-170717072 GGCGGGCGGCGCCCCCGAGGCGG + Exonic
942116848 2:172736151-172736173 GGTGGCCGGGGTCCCCGAGCGGG + Intronic
942151074 2:173076175-173076197 GGCGGCCGGAGCGAGCGGGCGGG + Intronic
946250105 2:218406461-218406483 GGGGGGCCGAGCCCCGGCGCCGG - Intergenic
947860517 2:233354527-233354549 GGCGGCGGGCGCCCCTCCGCCGG + Exonic
948047037 2:234952452-234952474 GGCGGCCCGAGCGCACGCGGAGG - Intronic
948575548 2:238947258-238947280 GGCGGCTGCAGCCCCCTCTCAGG + Intergenic
1169244540 20:4015386-4015408 CGCGGCCGCCGCCCCCGGGCTGG - Intronic
1173823241 20:46031720-46031742 GGCGGCCAGAGCTCCCGGGGAGG - Intronic
1173865145 20:46308307-46308329 TGGGGCGGGAGCCCCGGCGCGGG + Exonic
1174177976 20:48657008-48657030 GGCTGCCGGACACCCCGCCCTGG + Intronic
1174358721 20:50015096-50015118 GGCCGCTGGAGCCCGCCCGCAGG - Intergenic
1175832619 20:61974523-61974545 GGCGGCGGGAGGCCCAGTGCTGG - Intronic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1175985547 20:62762628-62762650 GGAGTCCGGAGCCCCTGAGCCGG + Exonic
1176135721 20:63521199-63521221 AGCGGGTGGAGCCGCCGCGCTGG - Intronic
1178610300 21:34073775-34073797 GGCAGCGGGGGCGCCCGCGCGGG - Intronic
1178992439 21:37366966-37366988 GGCGCCCGCACCCCCCGCTCGGG - Intronic
1180064529 21:45405704-45405726 AGCGGCCGGAGTCCCCGCGCGGG + Intronic
1180614992 22:17121013-17121035 CGCGGAAGGAGCCCCCGCGGAGG + Exonic
1181646121 22:24232553-24232575 GGAGGCCGGGGCCCCAGGGCGGG + Intronic
1182576432 22:31276454-31276476 GGCGGCGGCAGCCCCGGCGGCGG + Intronic
1183219973 22:36506330-36506352 CGCTGTCGGTGCCCCCGCGCCGG - Exonic
1183374556 22:37455598-37455620 GGCGCCAGGAGCCCCTACGCAGG - Intergenic
1183546257 22:38455974-38455996 GGCAGCCGGGGCTCCCGGGCTGG - Intergenic
1183571477 22:38656574-38656596 GGCGCTGGGAACCCCCGCGCCGG + Intronic
1184164720 22:42720606-42720628 GGTGGCCGGGACCGCCGCGCGGG + Intronic
1184465845 22:44668650-44668672 GGCTGCGGGCGCCCCCGCGCGGG + Intronic
1184620414 22:45672219-45672241 GGCGGCCGGGACTCCCGCGGCGG + Intronic
1184663669 22:45976787-45976809 GGCGGCCGGAGGGGACGCGCGGG + Exonic
1184663693 22:45976860-45976882 GGCCGCCCGAGCCGCAGCGCGGG - Exonic
1184863151 22:47188324-47188346 AGAGGCCGGAGCCCCTGCCCAGG - Intergenic
1185255193 22:49827739-49827761 GCCGGCCGGGCCCCCCGAGCCGG - Intergenic
1185397583 22:50600742-50600764 GGCGGGCCGAGCGCCGGCGCGGG + Exonic
950097862 3:10340428-10340450 AGCGGCTGGAGCCCCTGGGCAGG - Intronic
951898358 3:27632797-27632819 GGCGGGGGCGGCCCCCGCGCAGG + Intergenic
951907938 3:27722061-27722083 GGCCGCGGGGGCCCCTGCGCTGG + Exonic
952334425 3:32392235-32392257 TGCTGCCGCAGCCCCCGCGCTGG + Intronic
952354283 3:32570450-32570472 GGAGGCCGGAGCCGCAGCGCGGG + Intronic
952905859 3:38138717-38138739 CGGGGCCGCAGACCCCGCGCCGG - Exonic
953385292 3:42502698-42502720 CGCGGCGGGCGGCCCCGCGCGGG - Exonic
954613075 3:51956366-51956388 GGCGGCCCTGGCCCCAGCGCTGG + Exonic
961446122 3:126982654-126982676 GGCGCCCGGGCTCCCCGCGCAGG + Intergenic
962129818 3:132660519-132660541 GGCGGCCGGAGTCCCAGCCATGG + Exonic
962222373 3:133574235-133574257 TGGGCCCGCAGCCCCCGCGCTGG - Exonic
966181871 3:177196487-177196509 CCCGGCCGGCGCCCCCGCCCCGG + Intronic
966684825 3:182682724-182682746 GGCGGCCGCCCCCCGCGCGCCGG + Intergenic
966919860 3:184604362-184604384 AGAAACCGGAGCCCCCGCGCCGG + Intronic
967055449 3:185825467-185825489 GGCGCCCGGAGCCCCAGCCCGGG - Intergenic
967648244 3:191952741-191952763 GGCGGCAGCAGGCCCCCCGCAGG - Intergenic
968010441 3:195270864-195270886 CGCGGCGGGAGCCCCGGCGCGGG + Exonic
968025985 3:195442888-195442910 GGCCGCGGGAGCGGCCGCGCTGG + Exonic
968433962 4:575720-575742 CGCGGCCGGGGCCCCGGGGCCGG - Intergenic
968583466 4:1405433-1405455 GGCGGCCCGCGCCCCCGGTCGGG - Intronic
968584039 4:1407697-1407719 GGCGTCCGGAGTCCCAGTGCGGG + Intergenic
968903905 4:3443156-3443178 GGCAGCCGGGGCACCCGAGCTGG + Intronic
969279521 4:6160776-6160798 GGGAGCTGAAGCCCCCGCGCAGG - Intronic
969559727 4:7939466-7939488 GACGACCGGGACCCCCGCGCGGG + Exonic
971757564 4:30721996-30722018 GGCGGCGAGAGCCGGCGCGCCGG + Exonic
977607413 4:98996178-98996200 GGCGGCCCCCGCCCCAGCGCGGG - Intronic
978514595 4:109557502-109557524 GGCGGCCGGCACCCCCGGCCCGG + Intergenic
980130662 4:128812628-128812650 GGCGGCCGCAGTCCCGGCGCCGG + Intronic
981615527 4:146639904-146639926 GGCTGCCAGAGCCTCGGCGCGGG - Exonic
983398496 4:167233917-167233939 GGCGGCCGCGGCCCCCGCCTCGG + Intronic
983904646 4:173169852-173169874 GGCGCCCGGCCGCCCCGCGCCGG + Intronic
984778906 4:183506030-183506052 GGCGGGGAGGGCCCCCGCGCCGG + Intronic
985537509 5:473406-473428 GGCGCGCGGAGCCCGGGCGCTGG + Intronic
985703236 5:1386134-1386156 GGCGGCCTCACTCCCCGCGCCGG - Intergenic
985781932 5:1876178-1876200 TGCGGCGGGAGCCCCCGGCCTGG - Intergenic
985797209 5:1972141-1972163 GGCCCCCGGAGCCCCCGAGCAGG - Intergenic
987836614 5:23170614-23170636 GGCGGCCGGAAGCCCCTAGCTGG - Intergenic
990381956 5:55227450-55227472 GGCGGGCCGGGGCCCCGCGCTGG - Intergenic
992627286 5:78647894-78647916 GGCGGCTTGAGCCCACGGGCTGG - Intronic
993116215 5:83722426-83722448 GTCGGCCAGAGCCCCCGTCCCGG - Intergenic
993116225 5:83722476-83722498 GGCGGCCGCACCCCGCGCGCTGG - Intergenic
996404214 5:123090308-123090330 TGCGGCCGCTGCCGCCGCGCTGG + Exonic
997129657 5:131264096-131264118 GGCGGCAGGAGCCGCGGAGCCGG + Exonic
998517706 5:142770709-142770731 GGCGGCCCGGGCCCCGGCGGAGG + Exonic
999300353 5:150486549-150486571 GTCGGCCGGGCCCCGCGCGCGGG + Intronic
1002524240 5:179806676-179806698 GGCGGCAGGGGCCCCGGCCCCGG + Intronic
1002541298 5:179907941-179907963 GGCGGGCGGCGCCCCCTGGCGGG + Intergenic
1002771157 6:292041-292063 CGCGGCCCGAGCCGCCCCGCCGG - Intronic
1003241332 6:4348045-4348067 GGCGGCCGGTGCCACTGCCCAGG + Intergenic
1005766304 6:29015193-29015215 GCCGGCCGGCGCCACCGCTCCGG + Intergenic
1006706319 6:36024436-36024458 GACGGACGCAGCCCCCGCCCTGG + Intronic
1007363213 6:41373195-41373217 GTCCGCCCCAGCCCCCGCGCCGG + Intergenic
1007424090 6:41735579-41735601 GACAGCCGGAGCCCGGGCGCCGG - Intronic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1010584245 6:77638622-77638644 CCCGGCCGGAGCCACCGCGCCGG - Intergenic
1010703165 6:79077288-79077310 GGCCCCCGCAGACCCCGCGCCGG + Intronic
1011603554 6:89081270-89081292 GGCGGCCGGAGCCCCGCGACCGG + Exonic
1011643074 6:89433230-89433252 GGCGGCTGGAGGCACGGCGCTGG + Intronic
1013117808 6:107115543-107115565 CGCGGCCGCCGCCCCCGCCCCGG - Intergenic
1016010791 6:139135629-139135651 CGCGGCCGCAGCCCCCGCGGCGG - Exonic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1018046308 6:159969259-159969281 GCCGGCCGGAGCCCCCACCTGGG + Exonic
1019049963 6:169175129-169175151 GGCGGAAGGAGCCGCCGGGCAGG - Intergenic
1019114854 6:169751769-169751791 GGTGGCCGGCGGTCCCGCGCTGG + Intronic
1019343828 7:520276-520298 AGCGGCCGGAGCGCCGGGGCGGG - Intronic
1019421918 7:954588-954610 GGCGGCCTCAGCCCGCGCGCCGG + Intronic
1019474413 7:1236929-1236951 GGCGGCCGGACCCAGCCCGCCGG + Exonic
1020100028 7:5389299-5389321 GGAGCCCGGAGCCCCCGCGGTGG + Exonic
1022018696 7:26377205-26377227 GGCGGCTGCAGCCTCCGCACTGG - Intergenic
1022094566 7:27130607-27130629 GGTAGCCGGGGCCCCCGCCCGGG + Exonic
1023016317 7:35971509-35971531 GGCGGCCCTGGCCCCCGGGCCGG - Intergenic
1024579851 7:50793033-50793055 GGGCGCCGGAGCCCCCGGCCCGG + Intronic
1026850320 7:73719567-73719589 GGCGGCGGGCGGCCGCGCGCTGG + Intronic
1027025897 7:74851445-74851467 GGCGGCCGAGAGCCCCGCGCGGG + Exonic
1027061860 7:75092665-75092687 GGCGGCCGGGAGCCCCGCGCGGG - Exonic
1028762277 7:94509739-94509761 GGCATCCGGACCCCCCTCGCAGG + Intronic
1030614865 7:111728795-111728817 GGGGGCCGGGGCCTCCGCGTCGG - Intronic
1031966764 7:128032509-128032531 TGCGGCGGGAGAGCCCGCGCCGG + Intronic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1034339185 7:150341197-150341219 GCCCGCGGCAGCCCCCGCGCCGG - Exonic
1034618012 7:152435823-152435845 GGCGGCGGGAGCCCCCCAGGAGG - Exonic
1034732625 7:153400974-153400996 GGCTGCCGGAGCCACGGAGCTGG - Intergenic
1035663529 8:1364201-1364223 GGCGGACGGTGCCCCCGGGCTGG + Intergenic
1036434799 8:8723416-8723438 GGCGGCTGGGGCTCCCTCGCGGG - Intergenic
1036786651 8:11692579-11692601 GGAGGGCGTGGCCCCCGCGCTGG + Intronic
1036811115 8:11868156-11868178 GGCGGCGGGAGGGCCCGGGCGGG - Exonic
1037826843 8:22164978-22165000 GGCGGCCCGAGCCCCCTCCCCGG + Exonic
1038041448 8:23727129-23727151 GGCGGGCGGCGGCCCCGGGCGGG + Intergenic
1038326760 8:26577729-26577751 GGCGGCGCGAGCGCCCGCGCTGG - Intronic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1038760986 8:30384349-30384371 GGCGGCCGGATGGCGCGCGCCGG - Intergenic
1039273254 8:35906550-35906572 GGCGGCAGGAGCCACAGAGCCGG - Intergenic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1040638796 8:49306564-49306586 GGCTGCCGGAGTGCCCGCGCTGG + Intergenic
1045583219 8:103500803-103500825 GGCTGCCCCAGCCGCCGCGCCGG + Intronic
1047313060 8:123708472-123708494 GGAGGCTGCAGCCCCCGCTCTGG + Intronic
1049109832 8:140635736-140635758 GGCGGCGGGAGCGCGCTCGCGGG + Intergenic
1049671475 8:143872013-143872035 GGCAGCCGGAGCCTGCGTGCTGG + Exonic
1053142402 9:35690035-35690057 GGCGGCCGCACCCCCCGGCCGGG - Exonic
1053550920 9:39078720-39078742 GGCGTCCGGCTCCCCGGCGCGGG - Exonic
1053815029 9:41898799-41898821 GGCGTCCGGCTCCCCGGCGCGGG - Exonic
1054615567 9:67288642-67288664 GGCGTCCGGCTCCCCGGCGCGGG + Intergenic
1055654920 9:78442172-78442194 GCCGGCCGGCGCCACCGCCCCGG + Intergenic
1056104325 9:83332037-83332059 GGTGGGCGGAGCCCCCCAGCTGG + Intronic
1056746758 9:89310432-89310454 GGCGCCCGCCGCCACCGCGCCGG + Intergenic
1057225292 9:93289660-93289682 AGGGGCCGGAGCCCGGGCGCAGG + Intronic
1057432191 9:95004797-95004819 GGCGGCCGGAGCCCGGGAGCGGG + Intronic
1057444252 9:95102935-95102957 TACAGCCGGAGCCCCCGTGCTGG - Intronic
1057488563 9:95505899-95505921 GGCGGCCGCGGCCGCCGCGCTGG - Intronic
1057547239 9:96027547-96027569 GGAGGCTGCAGCCCCTGCGCCGG + Intergenic
1057619122 9:96619455-96619477 GCCGCCCCGAGCGCCCGCGCGGG - Exonic
1061365795 9:130172111-130172133 GGGGGCCGGAGCGCCAGGGCTGG + Intergenic
1061484640 9:130914164-130914186 GGAGGCAGGAGCCCTCGCCCAGG - Intronic
1061629122 9:131860526-131860548 GCCGGCAGTAGCCCCCACGCTGG - Exonic
1061693628 9:132355055-132355077 GCCGGCCGCAGGCCCCGCCCCGG + Intergenic
1061720184 9:132546594-132546616 GGCTGCCGAGACCCCCGCGCTGG + Intronic
1062332729 9:136051626-136051648 GGAGGGCGGAGCCACCGCGCCGG + Intronic
1062398860 9:136363715-136363737 GGCGGACGGAGCCGGCGAGCGGG - Exonic
1062430042 9:136522889-136522911 GGCGGCAGGTGCCCCCGTTCTGG + Exonic
1062499520 9:136846271-136846293 GGGCTCCGGGGCCCCCGCGCTGG + Exonic
1062500364 9:136849522-136849544 TGCAGCCGGAGCCCCGGAGCGGG - Exonic
1186669965 X:11758210-11758232 GGCGGGCGGAGCGCGCGCGGTGG - Exonic
1190246926 X:48696885-48696907 GGCGTCCGAGGCCCCGGCGCCGG + Intronic
1197753314 X:129980145-129980167 GGCAGCCGCAGACCCCGCACTGG - Intergenic
1200119605 X:153784084-153784106 GGCGGCCGTAGCCTCAGCGCGGG + Exonic
1200748387 Y:6922789-6922811 GGCTGCCGGAGTGCCCGGGCTGG - Intronic