ID: 900284046

View in Genome Browser
Species Human (GRCh38)
Location 1:1890839-1890861
Sequence GGCGGCGGTGTGGGCGCGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900284046_900284057 9 Left 900284046 1:1890839-1890861 CCTGACGCGCCCACACCGCCGCC 0: 1
1: 0
2: 3
3: 29
4: 259
Right 900284057 1:1890871-1890893 GCTCGGCAGGTCGTCGCGCTCGG 0: 1
1: 0
2: 1
3: 0
4: 57
900284046_900284059 30 Left 900284046 1:1890839-1890861 CCTGACGCGCCCACACCGCCGCC 0: 1
1: 0
2: 3
3: 29
4: 259
Right 900284059 1:1890892-1890914 GGGCCGCGCTGCGCGCTCCGCGG 0: 1
1: 0
2: 0
3: 17
4: 162
900284046_900284053 -4 Left 900284046 1:1890839-1890861 CCTGACGCGCCCACACCGCCGCC 0: 1
1: 0
2: 3
3: 29
4: 259
Right 900284053 1:1890858-1890880 CGCCTCGGCCGCCGCTCGGCAGG 0: 1
1: 0
2: 4
3: 30
4: 173
900284046_900284058 10 Left 900284046 1:1890839-1890861 CCTGACGCGCCCACACCGCCGCC 0: 1
1: 0
2: 3
3: 29
4: 259
Right 900284058 1:1890872-1890894 CTCGGCAGGTCGTCGCGCTCGGG 0: 1
1: 0
2: 0
3: 26
4: 34
900284046_900284051 -8 Left 900284046 1:1890839-1890861 CCTGACGCGCCCACACCGCCGCC 0: 1
1: 0
2: 3
3: 29
4: 259
Right 900284051 1:1890854-1890876 CCGCCGCCTCGGCCGCCGCTCGG 0: 1
1: 0
2: 13
3: 150
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900284046 Original CRISPR GGCGGCGGTGTGGGCGCGTC AGG (reversed) Exonic
900226543 1:1535872-1535894 GGTGGGGGTGTGACCGCGTCAGG + Intronic
900284046 1:1890839-1890861 GGCGGCGGTGTGGGCGCGTCAGG - Exonic
900414736 1:2529764-2529786 GGCGGCGGTGAGCGGGCGGCGGG + Intronic
900502331 1:3012598-3012620 GGCGGCGGGGTGGGGGCGGTGGG - Intergenic
901007701 1:6179847-6179869 GGCGGCGGGGGCGGCGCGGCCGG - Intronic
902289426 1:15426892-15426914 GGAGCTGGTGTGGGCGGGTCAGG + Intronic
902468175 1:16630802-16630824 GGTGGGGGTGGGGGCGTGTCTGG - Intergenic
902690578 1:18108092-18108114 GGCGGCGGTGGCGGGGCGGCGGG - Exonic
902995697 1:20223135-20223157 GGCAGTGGTGTGGGTGCATCTGG - Intergenic
903476017 1:23619640-23619662 GGTGGCGGCGTCGGCGCGGCGGG + Intronic
903639462 1:24848539-24848561 GGCGGCGGTTGGGTCGCGGCAGG + Intergenic
904033882 1:27549059-27549081 GCCGGCGCTGTGGGCGCTGCTGG + Exonic
904500151 1:30908587-30908609 GGCGGCGGCGCGGGCGCGGGCGG + Exonic
905174038 1:36125228-36125250 GGCGGCAGGAGGGGCGCGTCGGG + Intergenic
905414377 1:37794375-37794397 GGCGGCGGGGGCGGCGCGGCAGG - Exonic
905449010 1:38045443-38045465 GGGGGCGGTGGGGGCGCGGAGGG + Exonic
905786472 1:40761907-40761929 GGCGGGGGTGTGGGCGTGGGTGG - Intronic
906950730 1:50333057-50333079 AGCGCTGGTGTGGGCGCGGCCGG + Intergenic
906960927 1:50419121-50419143 GGCGGCGGCGTCGACGCGGCTGG + Exonic
907513808 1:54980823-54980845 GGCGGCGGAGAGGGCGCGGCTGG + Exonic
910277540 1:85465019-85465041 GGCGGCGGGGTGGCCGAGCCCGG + Exonic
910981235 1:92961529-92961551 GGCGGGGGAGTGGGCGGGCCCGG - Intergenic
911633988 1:100213392-100213414 GGCGGCTGCGGGGGCGCGGCGGG - Intronic
915141452 1:153771029-153771051 GGCGGTGGGGGGGGCGCGGCGGG - Intronic
917797524 1:178542734-178542756 GGCGGGGGCGCGGGGGCGTCGGG - Intronic
918497642 1:185157439-185157461 GGCGACTCTGTGGGCGGGTCCGG + Intronic
919748624 1:201023468-201023490 GGCGGGGGCGCGGGCGCGGCTGG + Exonic
920365942 1:205448486-205448508 GGAGGCAGTGTGGGTGGGTCTGG - Intronic
920387490 1:205579206-205579228 GGCGCTGGTGTGGGCGTCTCAGG + Intronic
920528588 1:206685604-206685626 GGCGGAGGGGTGGCCGCGGCGGG + Intronic
922648640 1:227318201-227318223 GGCGGCGGCGCGGGCGGCTCTGG + Exonic
923119704 1:230978769-230978791 GGCGGCGCTGTGGCCGCCGCGGG - Exonic
923506467 1:234609796-234609818 CGCGGCGGTGGGGGCTCGGCCGG + Intergenic
1062843780 10:689674-689696 GGCGGCGGCGCGGGCGCGGGAGG + Intronic
1072190521 10:93073600-93073622 GGCGGCGGTGGGGGAGGGCCAGG - Intronic
1075430235 10:122374534-122374556 GGCGGCGGCCTCGGCGCGCCGGG - Intergenic
1075999824 10:126905681-126905703 GGCGGCGGCGCGGGCGCGGGCGG - Intronic
1077015333 11:396778-396800 GGGGGCGGTGAGGGCGTGCCTGG - Intronic
1077360342 11:2137990-2138012 GGGGGTGGGGTGGGGGCGTCGGG - Intronic
1081636829 11:44727158-44727180 CCCGGCGGTGGCGGCGCGTCCGG - Intronic
1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG + Intronic
1083572763 11:63768979-63769001 GGCGGCGGTGCGGGCCCGCGGGG - Intergenic
1084946640 11:72642279-72642301 GGCGGCGGCGGCGGCTCGTCCGG + Exonic
1085597166 11:77820672-77820694 GGCGGCGGTGATGGCTCCTCCGG - Exonic
1088823508 11:113475360-113475382 GGCGGCGCGGTGCGCGCGTGAGG + Exonic
1091259512 11:134223752-134223774 GGGGGCGGGGTGGGGGCGCCCGG - Intronic
1091273249 11:134332389-134332411 CGCGGCGGGGTGGGCGGCTCGGG - Intronic
1094108027 12:26833450-26833472 GGCGGGGGAGCGGGCGCGTGCGG + Intergenic
1095917608 12:47495974-47495996 GGCGGCGGAGGGGGCGGGTGGGG - Intergenic
1095949273 12:47773163-47773185 GGCGGCGCTGGGGGCGGGCCGGG + Intronic
1096100244 12:48966427-48966449 GGCGGCGTTGAGGGAGCGGCTGG - Exonic
1096491423 12:52015035-52015057 GGCGGAGGCGGGGGCGCGCCGGG + Exonic
1096775556 12:53961448-53961470 GCCGGGGCTGTGGGCGCGCCGGG - Intergenic
1096778503 12:53978461-53978483 GGGGGTGGGGTGGGCGCGGCGGG - Intergenic
1097196824 12:57247010-57247032 GGTGGCGGTGGGGGCGCCGCGGG + Intronic
1097647974 12:62259978-62260000 GGCGGTGGTGTGGGGGCGTGGGG - Intronic
1098312107 12:69158761-69158783 GGCGGCGGGGTGGGGGCGGCGGG - Intergenic
1098425842 12:70365734-70365756 GCTGGCGGCGTGGGCGCGGCTGG + Intergenic
1102457088 12:113077647-113077669 GGCGGCGGCGCCGGCGCGTCTGG - Exonic
1104049544 12:125186438-125186460 GGCGGCGGCGGCGGCGCGACCGG + Intergenic
1105883516 13:24623626-24623648 GGAGGGGGTGTGGGGGCCTCAGG - Intergenic
1106247280 13:27960986-27961008 GGCGGGCCTGTGGGCGCGGCCGG + Intergenic
1106517102 13:30465224-30465246 GGCGGCAGTGCGGGCCCGGCCGG - Intronic
1111672466 13:91348068-91348090 GGCGGCGGCGTGGCCGGGGCGGG + Intergenic
1112402466 13:99087667-99087689 GGCCGCGGAGAGGGCGCGCCAGG + Intergenic
1112504969 13:99970090-99970112 GGCGGCGGCGGCGGCGCGGCCGG + Intronic
1112581133 13:100677155-100677177 GGCCCCGGTGTGGGTGCGTGAGG + Intergenic
1113956789 13:114103600-114103622 GGCGGCAGTGTGGACGCATCGGG - Intronic
1113956840 13:114103801-114103823 GGCGGCAGTGTGGACGCATCGGG - Intronic
1113956883 13:114103959-114103981 GGCGGCAGTGTGGACGCATCGGG - Intronic
1113956979 13:114104313-114104335 GGCGGCAGTGTGGACGCATCGGG - Intronic
1113985703 13:114314295-114314317 GGAGGCGGAGTGGGCACGTGCGG + Intergenic
1115851786 14:37595145-37595167 GGCGGCGGCGGCGGCGCGGCGGG + Intronic
1117803118 14:59465000-59465022 GGCGGCGGCCTTGGCGGGTCCGG - Exonic
1119325920 14:73759569-73759591 GGCGGTGGAGCGGGCGCGTGTGG - Intronic
1121850793 14:97219547-97219569 CGCGGCGGTCTGGGCGCTGCAGG + Intergenic
1122153064 14:99734976-99734998 GGCTGGGGTGAGGGCGCGGCAGG - Intergenic
1122581988 14:102777137-102777159 CGCGGCGGCGGGGGCGCGGCGGG + Intergenic
1122613218 14:102999877-102999899 GGCGGCGTCGTGGACGCATCGGG - Intronic
1123001900 14:105300369-105300391 GGAGGCGGTGACGGCGCGGCCGG - Intronic
1123671597 15:22664633-22664655 AGCGGCGCTGTGGCCGCCTCTGG + Intergenic
1123735599 15:23180061-23180083 GGCGGGGGTCTGGGCGGCTCGGG + Intergenic
1123898059 15:24848223-24848245 GGCGGCGGTGGGGGCGGGGGCGG + Intronic
1124286315 15:28403044-28403066 GGCGGGGGTCTGGGCGGCTCGGG + Intergenic
1124296388 15:28508592-28508614 GGCGGGGGTCTGGGCGGCTCGGG - Intergenic
1124323636 15:28737858-28737880 AGCGGCGCTGTGGCCGCCTCTGG + Intronic
1124453655 15:29821869-29821891 GGCGGCGGGGTGGGCAGGGCTGG - Intronic
1124527536 15:30471111-30471133 AGCGGCGCTGTGGCCGCCTCTGG + Intergenic
1124771123 15:32536591-32536613 AGCGGCGCTGTGGCCGCCTCTGG - Intergenic
1126113265 15:45187683-45187705 GGCGGCGCGGGGGGCGCGGCCGG + Intronic
1128109616 15:65068129-65068151 CCCGGCGGTGGGGGCGCGGCCGG - Intronic
1129334369 15:74843442-74843464 GGCGGCGGAGCGGGCGTGTGTGG + Intergenic
1129669199 15:77597777-77597799 GGCTGGGGTGGGGACGCGTCAGG + Intergenic
1130317645 15:82810008-82810030 GGCGGCGCTGTGGCCGCCTCTGG + Exonic
1131180150 15:90233889-90233911 GGCGGAGCTGTGCGCGCGGCGGG - Exonic
1132060794 15:98690833-98690855 TGGGGCGGTGTTGGCGGGTCAGG + Intronic
1132318533 15:100908575-100908597 AGCGGCGGTGTGGGGGGGACGGG - Intronic
1132533839 16:467509-467531 GGAGGAGGTGCGGGGGCGTCAGG + Intronic
1132779417 16:1614459-1614481 GGCGGCGGCGTGGGGGCGGCAGG + Intronic
1132895759 16:2228652-2228674 GGCTGCGGTGTGGGAGGGTCCGG + Intronic
1133513528 16:6483789-6483811 GGTGGCGGCGTGTGCGCCTCCGG + Intronic
1139534414 16:67562687-67562709 GGCGGCGGAGCGGGCGCCGCGGG + Exonic
1140067877 16:71626058-71626080 GGGGGCGGCCTGAGCGCGTCTGG - Intergenic
1140927575 16:79599181-79599203 GGAGGCGGCGGGGGCGCGGCGGG - Exonic
1141132331 16:81444892-81444914 GGCGCCGGGGTGGGGGCGGCGGG - Intergenic
1141996749 16:87640911-87640933 GGCCACTGTGTGGGCGGGTCTGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143493082 17:7294898-7294920 GGTGGCGGTTGGGGCGCGACCGG - Intergenic
1143508225 17:7381167-7381189 GCCGTCGCTGGGGGCGCGTCCGG + Intronic
1144021160 17:11241047-11241069 GGCGGCGGCGTGGTCCCGTCCGG - Intergenic
1144629836 17:16865408-16865430 GGAGGCGGTGTGGCCTCTTCAGG - Intergenic
1145012765 17:19378968-19378990 GGCAGCGGTGTGGGCGGGTTCGG - Exonic
1146789885 17:35745269-35745291 GGCGAAGGTGTGGGGGCCTCCGG + Exonic
1147994634 17:44354058-44354080 GGCGGCGGCGGCGGCGCGGCAGG + Exonic
1148432084 17:47650456-47650478 CGCGGCGGGATGGGCGCGGCGGG - Intronic
1148754943 17:49968610-49968632 GGCGGCGGTCTCGGCGTGCCAGG + Intergenic
1148945445 17:51259329-51259351 GGGGGCGGGGTGGGCACGTGCGG - Intronic
1150747243 17:67825788-67825810 GGCGGCGGTGGCGGCGGGGCCGG - Exonic
1151393090 17:73801116-73801138 GGCAGCGGTGGGGGCGTCTCGGG + Intergenic
1151938885 17:77280990-77281012 GGCGGAGGTGCGGGCGCTCCGGG - Intronic
1152321019 17:79608942-79608964 GCCGGCGGGGTGGGGGCGTGGGG - Intergenic
1152349682 17:79777909-79777931 GGCGGGGGTGGGGGCGCGGGCGG - Intergenic
1152363610 17:79843395-79843417 GGCGGCGGTGTGGCCCCGAGGGG - Intergenic
1152617913 17:81346243-81346265 GGCGGGGTTGGGGGCGGGTCGGG - Intergenic
1153051992 18:908431-908453 GGCGGCGGTGGGTGCCCGTGGGG + Intronic
1153285151 18:3449992-3450014 GGCGGCGGTGCGGACGCGGGGGG - Intronic
1155075197 18:22348562-22348584 GGCGGGGTGGTGGGCGCGTCTGG + Intergenic
1157279076 18:46334122-46334144 GGCGGCGGTGGGGCGGCGGCTGG - Intronic
1157386396 18:47262470-47262492 GGCGGCGGTCTGCGCGCGTGTGG - Intergenic
1160453346 18:78979753-78979775 GGCGGCGGGGGGGGCGCGGGCGG + Intergenic
1160496516 18:79379170-79379192 CTCGGTGATGTGGGCGCGTCTGG + Intergenic
1160747610 19:719400-719422 TGTGGCGGTGTGGGCGGCTCGGG - Intronic
1160930582 19:1567985-1568007 GGCGGCGGCGTGGGGGCGGCGGG - Exonic
1160967704 19:1753840-1753862 GGCGGCGGTGGGGGCGCCGGGGG + Exonic
1161341763 19:3746881-3746903 TGCCGCGGTGTGGGTGGGTCGGG + Intronic
1161443293 19:4304635-4304657 GGCGGCGGCGAGGGCTCGGCGGG + Exonic
1161849465 19:6731120-6731142 CGGGGCGGAGTGGGGGCGTCAGG + Intronic
1161973401 19:7596180-7596202 GGCGGCGGGCCGGGCGCGGCAGG + Intronic
1162481391 19:10928894-10928916 GCCGGGAGTGTGGGCGCGGCTGG + Exonic
1162744182 19:12789818-12789840 GGCGGCGGTCGGGGCTGGTCGGG + Intronic
1162745180 19:12793885-12793907 GGAGGGGGCGTGGGCGCGGCGGG - Intronic
1162818184 19:13208512-13208534 GGCGGCGGGGAGGGGGCGGCGGG + Intronic
1163266698 19:16226393-16226415 GGTGGCGGTGTGGGCGTGAGGGG - Intronic
1163314971 19:16535540-16535562 GCCGGCGGGATGGGCGCGGCGGG + Exonic
1163547239 19:17947815-17947837 GGCGGGGGTGGGGGCGGGGCCGG - Intergenic
1164189578 19:22901834-22901856 GGCGGCGCAGTGGGGGCGGCTGG - Intergenic
1164835068 19:31350721-31350743 GGCGGCGGTGAGGGCGCGGGTGG + Intergenic
1164958428 19:32406043-32406065 GGCCGCGGCGTCGGGGCGTCGGG + Intronic
1165345960 19:35249000-35249022 CGCGGCCGTCTGGGCGCGTCTGG - Exonic
1165443719 19:35845411-35845433 CTCGGCGCTGTGGGCGCGGCAGG + Exonic
1165509434 19:36257558-36257580 GGCGGCGGTGGCGGCGCTTGCGG - Intergenic
1165824200 19:38696392-38696414 GGCGGCGTGGTGGGCGCATAGGG + Intronic
1166042906 19:40214017-40214039 GGCGTGGGTGTGGGCGCGGGCGG - Exonic
1166294667 19:41883150-41883172 GGCGGCGGGGCGGGGGCCTCCGG + Intronic
1167072331 19:47228219-47228241 GGCGGCGGTGACGGCGGGTGGGG + Exonic
1168076330 19:53982559-53982581 GGCGGCGCCGTGGGGGCGTTCGG + Exonic
1168286926 19:55339918-55339940 GGCGGCGGCGCGGGCGCCTGAGG + Exonic
926084207 2:10010726-10010748 GGCGTGGGTGTGGGCGAGTCTGG + Intergenic
926084550 2:10012429-10012451 GGCGTGTGTGTGGGCGGGTCAGG + Intergenic
926084991 2:10014660-10014682 GGCGTGCGTGTGGGCGAGTCAGG + Intergenic
926085222 2:10015776-10015798 GGCGTGTGTGTGGGCGGGTCAGG + Intergenic
926423313 2:12718767-12718789 GGCGGCAGTGGGGGCGTTTCGGG + Intronic
929604698 2:43226652-43226674 TGCGGCGGGGCGGGCGCGCCGGG + Intergenic
935971627 2:108534746-108534768 GGTGGCGGCGTGGCTGCGTCCGG + Intronic
936038401 2:109129991-109130013 GGCGGCGGGGGCGGCGCGGCAGG + Exonic
938038137 2:128053514-128053536 GGCGGCGGCGGGGGCGGGTAGGG - Intergenic
943185192 2:184598379-184598401 GGCGGCGGGGTGGGCGGGGGAGG + Exonic
947566719 2:231198815-231198837 GGCGGCGGAGCGGGCGCGTCGGG - Intronic
947792467 2:232876116-232876138 GGCGGCGGTACGGGCGGGGCGGG + Exonic
947800950 2:232928244-232928266 GGCGGCGGGGCGGGGGCGCCCGG + Intronic
1168804450 20:664214-664236 GGCGGCGGGGCGGGGGCGGCGGG - Exonic
1168806712 20:675939-675961 GGCGGCGGTGGGGGCAGGCCCGG + Exonic
1169383299 20:5127158-5127180 AGCGTCGGGGTGGGCGCGGCCGG + Intronic
1169473785 20:5911678-5911700 GGCGGGTGAGTGGGCGCGGCGGG + Exonic
1171810654 20:29742800-29742822 GGCGGCGGTGTTGGAGCCGCGGG - Intergenic
1172848418 20:37944170-37944192 GGCGGCGGGGCGGGCGCGGCGGG - Exonic
1174003220 20:47389961-47389983 GGGGGTGGTGTGGGCGTGGCAGG - Intergenic
1174357829 20:50010114-50010136 GGCGGCGGCGAGGGGGCGGCGGG + Intergenic
1174494613 20:50930920-50930942 GGCAGCGGGGAGGGCGCGCCCGG + Exonic
1175399662 20:58693128-58693150 GGCGGCGGCGGGGGTGCGGCGGG - Intronic
1175521288 20:59604175-59604197 GGTGCCGGGGTGGGCGCGTCGGG + Intronic
1175856307 20:62122644-62122666 GGCGGCGGCCGGGGTGCGTCGGG - Exonic
1175927409 20:62477713-62477735 GGCGGCGATGTGGGGCCGTCGGG + Intergenic
1176194469 20:63830976-63830998 GCCGGCGGCGGGGGCGCGCCCGG + Intronic
1176234829 20:64049362-64049384 GGCGGCGAGGCGGGCGCGGCGGG + Exonic
1176574255 21:8435155-8435177 GACGGTGGTGCGGGCGTGTCGGG + Intergenic
1178555772 21:33588736-33588758 GGCGGAGGCGGGGCCGCGTCGGG - Intronic
1178728105 21:35073152-35073174 GGAGGCAGTGTGAGAGCGTCGGG + Intronic
1179054239 21:37916549-37916571 GGCGGCGGGGTGGGCGTCTCTGG - Intergenic
1180136939 21:45868042-45868064 GGAGGCGCAGTGGGCCCGTCCGG + Intronic
1180233166 21:46440133-46440155 GGCCGGGGTCTGGGCGCCTCAGG - Exonic
1180699658 22:17774392-17774414 CGCGGGGGCGCGGGCGCGTCCGG + Intronic
1181695991 22:24593024-24593046 GGCGGCCATGGGGGCGCGGCTGG - Exonic
1182351054 22:29700204-29700226 GGTGGGGGTGGGGGGGCGTCGGG - Intergenic
1183744817 22:39686218-39686240 GGCGGCGGCGTGGGGGCGGCCGG - Exonic
1184207654 22:43015154-43015176 GGGGGCGGTGCGGTCGCGGCTGG - Intergenic
1184680850 22:46071499-46071521 GGCGGCGGTGCCCGCGCGCCCGG - Intronic
1184837973 22:47035313-47035335 GGTGGGGGTGTGGGTGCCTCTGG + Intronic
1203260358 22_KI270733v1_random:169292-169314 GACGGTGGTGCGGGCGTGTCGGG + Intergenic
950729894 3:14947941-14947963 GGCGGCGGAGGGGGCGGGCCTGG + Intronic
950902920 3:16513416-16513438 GGCGGCGGGGGGGGCGCGACAGG - Intronic
950902995 3:16513700-16513722 GGCGGCGGCGGGGGCGCGTCGGG - Exonic
951485289 3:23203250-23203272 GGCGGCGCTGAGGGTGAGTCCGG + Intronic
953246685 3:41199755-41199777 GGCGGCGGGCTGGGCGCAGCCGG + Intronic
954034927 3:47846334-47846356 GGCGGCGGCGAGGGCCGGTCTGG + Exonic
954076834 3:48187914-48187936 GGCGGCGGTGCGGGGGCTCCGGG + Exonic
961755083 3:129122346-129122368 ATCCGCGGTGTGGGCGCGCCGGG - Intronic
963228749 3:142888961-142888983 AGCGGCGGTGTGAGCGCGGTGGG - Exonic
966182288 3:177197847-177197869 CGCGGCGGTGGGGGCGGGGCGGG - Intergenic
966915798 3:184583609-184583631 GGCGGCGGCGCGGGCTCCTCAGG + Intronic
969053739 4:4389042-4389064 GGAGGGGGTGTGGGGGCCTCGGG - Intronic
969114022 4:4860215-4860237 CGCGGCGAAGAGGGCGCGTCCGG - Exonic
969477066 4:7427823-7427845 GGCGGTGGTGTGGGATCGTTGGG - Intronic
969715855 4:8867796-8867818 GGGGGCGGCGCGGGCGCGGCGGG + Exonic
981710893 4:147708029-147708051 CGGGGCGGTGTGGGGGAGTCAGG + Intergenic
982042369 4:151409036-151409058 GGCGGCGGCGGGGGCGGGGCCGG + Intergenic
982224578 4:153153779-153153801 GGCCCCGGAGGGGGCGCGTCTGG + Intronic
984999806 4:185471714-185471736 GGCGGCGGAGCGGGTGCGTGCGG - Exonic
986330618 5:6713923-6713945 GGCGGGGGCGGGGCCGCGTCGGG + Intergenic
987132483 5:14872054-14872076 GGCGGCGCTGAGGGCGCGGCGGG + Intergenic
991975410 5:72179584-72179606 GCCAGGGGTGGGGGCGCGTCAGG + Intronic
992473192 5:77077526-77077548 GGCGGCGGGCAGGGCGCGGCAGG + Exonic
992771315 5:80050940-80050962 GGCAGAGGTGTGGTCGAGTCGGG + Intronic
998544389 5:143014200-143014222 GGCGGTGCTGTGGGCGTGTTGGG + Intronic
998573054 5:143282468-143282490 GGCGGGGGTGGGGGCGCTGCTGG + Intronic
999152926 5:149438461-149438483 GGAGGCGGAGTGGGCACGTGTGG + Intergenic
999322619 5:150624757-150624779 GGCGGCGAGGAGGGGGCGTCGGG + Intronic
1000052634 5:157575755-157575777 CCCGGCGGTGGAGGCGCGTCTGG + Exonic
1000205183 5:159051433-159051455 GGCGGCGGGGTGGGGGGGTGGGG - Intronic
1001070310 5:168579570-168579592 GGCGGCGGTGGCGGCGGCTCCGG - Exonic
1002439764 5:179258253-179258275 GGGGGCGGTCTGGGGGGGTCAGG - Intronic
1003139301 6:3457220-3457242 GGCGGCGGCGGCCGCGCGTCCGG - Intergenic
1004396231 6:15248446-15248468 GGCGGGGGCGTGGGCGTGCCGGG + Intronic
1005327893 6:24720289-24720311 GGCGGCGGCGGGGGCGCTGCTGG + Exonic
1005856103 6:29864214-29864236 GGAGGCGGAGAGAGCGCGTCAGG + Intergenic
1006725380 6:36196456-36196478 GGTGGCGGTGCGGGCGCGGCGGG - Intergenic
1007111136 6:39314048-39314070 GGCGTCGGCCTGGGCGCGGCGGG - Intronic
1007447943 6:41921411-41921433 GGCGGCGCTGATGGCGCTTCTGG + Exonic
1015496646 6:133889877-133889899 GGCGGGAGTGCGGGCGCGCCTGG - Intronic
1016386756 6:143537069-143537091 GCCGGCGGGGCGGGCGCCTCGGG - Intronic
1016590242 6:145735585-145735607 GGCGGTGGTGTGGGAGCCCCGGG + Exonic
1017754440 6:157517746-157517768 GGCGGCCGTGAGGGCGAGGCAGG - Intronic
1019366486 7:636024-636046 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366493 7:636048-636070 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366514 7:636120-636142 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366528 7:636168-636190 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366542 7:636216-636238 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366570 7:636312-636334 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366577 7:636336-636358 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366584 7:636360-636382 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019366598 7:636408-636430 GGAGGACGTGTGGGCGCGGCCGG - Intronic
1019593362 7:1846739-1846761 GGGAGCGGTGGGGGGGCGTCTGG - Intronic
1020212295 7:6165978-6166000 GGCGCCGGTGTGGGCGGGGTGGG - Intronic
1021969378 7:25951413-25951435 GGCGGGGGCGGGGGCGCGGCCGG + Intergenic
1021983669 7:26079116-26079138 GCGGGCGGTGTGGGCGCGTCGGG - Intergenic
1022101891 7:27173897-27173919 GGCGGCGGCGGCGGCCCGTCAGG + Exonic
1023382681 7:39623874-39623896 GGCGGCGGCGGGGGTGTGTCCGG + Intronic
1026847369 7:73705594-73705616 GGGGGCGGTGTGGGCTCACCTGG + Intronic
1029123244 7:98281895-98281917 GGCGGCGGCGGGGGCGCGGCGGG - Exonic
1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG + Intronic
1033253184 7:139777799-139777821 GGCGGCGGCGGCGGCGCGCCCGG - Intronic
1033306668 7:140230599-140230621 AGCGGCGGTGTGGACGCGCGAGG - Intergenic
1033657332 7:143382418-143382440 GGGGGCGGTATGGGGGCCTCAGG - Exonic
1034338812 7:150339753-150339775 GCCGGCTGTGTGGGTGTGTCTGG - Intronic
1034413390 7:150952868-150952890 GGCGGAGGTGTGGGTGAGGCAGG + Intronic
1034446220 7:151115507-151115529 GGCGGCGGTGCGGGGGCGGCCGG - Intronic
1035257854 7:157643497-157643519 GGCGGAGGTGTGGGGGCTGCAGG + Intronic
1035579549 8:731417-731439 GGCGGCGGTGCGGGCTCTTGGGG + Intronic
1045701707 8:104873793-104873815 GGGGGCGGTGGGGGGGCGGCGGG + Intronic
1048214288 8:132480971-132480993 GGCGGCGGCGGCGGCGCGTGTGG - Intergenic
1049620818 8:143597673-143597695 GTCGCCGGTGGGGGCGGGTCCGG + Exonic
1049803853 8:144530212-144530234 AGCGGCGGGGAGGGCGCCTCTGG - Exonic
1053003272 9:34589522-34589544 TGCGGCGGAGTGCGCGCGGCCGG - Intronic
1054745711 9:68852334-68852356 GGGGGCGGTGTGGGGGAGGCGGG - Intronic
1056659783 9:88535279-88535301 GGCCAAGGTGTGGGCGCATCTGG + Exonic
1060410327 9:123395806-123395828 GGAGGCGGGGTAGGGGCGTCCGG - Intronic
1060583365 9:124771028-124771050 GGCGGCGGAGGGAGCGCGGCGGG + Exonic
1060849197 9:126860687-126860709 GGCGGCGGAGGGGGCGCCGCGGG + Intronic
1061483631 9:130909249-130909271 GGCGGCGGAGGGGGCGCCTTGGG - Intronic
1061584042 9:131554964-131554986 GCGGGCGGCGTGGGCGCGGCTGG - Intergenic
1061816336 9:133199665-133199687 AGCGGCGGTGTGGGAACCTCCGG + Intergenic
1061853270 9:133428564-133428586 GGCGGGGGTGGGGGCGGGACGGG - Intronic
1061987180 9:134136419-134136441 GGCGGAGGTGGGGGCGCGAGTGG - Intronic
1203468706 Un_GL000220v1:107357-107379 GACGGTGGTGCGGGCGTGTCGGG + Intergenic
1203476527 Un_GL000220v1:151329-151351 GACGGTGGTGCGGGCGTGTCGGG + Intergenic
1203361293 Un_KI270442v1:220744-220766 GGCGGCGATGTGGGAGCCGCGGG - Intergenic
1186350078 X:8731768-8731790 GGCCGCGGCGTGGGCGCACCGGG - Intronic
1186466213 X:9786305-9786327 GGGGGCGGGGCGGGCGCGTTCGG - Intergenic
1190114828 X:47619625-47619647 GGCGGCGGTGGGGGCGGCTGCGG + Exonic
1190119779 X:47650480-47650502 GGGGGCGGTGGGGCCGCGTATGG - Exonic
1190285295 X:48957452-48957474 GGCGGAGGTGTGGGCGTGGGCGG - Exonic
1192624604 X:72714301-72714323 GGAGGCGGGGCGGGCGCGACTGG + Intronic