ID: 900284072

View in Genome Browser
Species Human (GRCh38)
Location 1:1890950-1890972
Sequence AGCAGCCGCCGCGGCGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900284072 Original CRISPR AGCAGCCGCCGCGGCGGGAC TGG (reversed) Exonic
900113778 1:1020191-1020213 AGCAGCGGCCGCAGCGGGCCCGG - Exonic
900244278 1:1630324-1630346 ACCAGCTGGCGCGGCGGGCCGGG - Exonic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
900341606 1:2192068-2192090 AGCAGGCGCCTGTGCGGGACAGG + Intronic
901000126 1:6144825-6144847 AGCAGCGGCTGCTGCGGGCCTGG + Intronic
901026226 1:6280044-6280066 AGCAGACGCCGCGGGGGCAGGGG + Intronic
904652131 1:32013764-32013786 CGCAGGCGCCGTGGCCGGACTGG + Intergenic
905714135 1:40133448-40133470 AGTAGCGGCCGCAGCGGGACTGG + Intergenic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
915325330 1:155078981-155079003 AGCAGCGGCAGCAGCGGCACGGG - Exonic
916792524 1:168136744-168136766 AGCGGCCGCCGCGGCAGCTCAGG + Intronic
918423579 1:184387083-184387105 AGCAGCGGCCGCGGCGGCCGCGG - Exonic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
922196557 1:223364430-223364452 AGCCGGCGCCGCGGCGTGGCCGG + Intergenic
922579938 1:226689409-226689431 AGCAGCCGCTGCTGCGGGCCAGG + Intronic
922648638 1:227318192-227318214 AGCAGCTGCGGCGGCGGCGCGGG + Exonic
922951028 1:229558618-229558640 AGCAGCCGCAGCGGCCAGGCAGG + Exonic
923056192 1:230426788-230426810 AGCAGCCGCCGCCGCGGGTGTGG - Intergenic
923684303 1:236143112-236143134 GGCAGCCGCGGGGGCGGGTCCGG + Intronic
1064443144 10:15371184-15371206 AGCGGCCGGGGCGGCGGGGCCGG - Intergenic
1065637540 10:27745986-27746008 AGCAGCCCCCGCGGCCGGGCGGG - Exonic
1066022865 10:31319893-31319915 GGCTGCGGCGGCGGCGGGACGGG + Intronic
1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG + Intergenic
1070800467 10:79242270-79242292 AGCAGCTCCCGGGGCGGGGCAGG + Intronic
1072003551 10:91220739-91220761 AGCACCCGCCGCGGCCTGGCCGG - Intronic
1075334456 10:121598316-121598338 AGCAGTCGCCGCGCCGGGCCAGG + Exonic
1076373892 10:129971318-129971340 GGCAGCCGTGGCGGCGGGCCTGG + Intergenic
1076850075 10:133088342-133088364 AGCAGGCGCCGCGGCCGGGCTGG + Intronic
1077080310 11:722049-722071 AGCAGGTGCCGGGGCGGGGCGGG - Intronic
1077103643 11:832862-832884 AGCGCCCGCCGCCGCGGGAGGGG + Exonic
1077200468 11:1304526-1304548 AGCAGCACCCGCGCCAGGACGGG + Intronic
1077236053 11:1482501-1482523 AGCAGCCGCCACTCCGGCACTGG + Intronic
1077249090 11:1552853-1552875 TGCAGCCCCCGAGGAGGGACTGG + Intergenic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080628611 11:34052515-34052537 AGAAGCCGGCGCGGCGGCCCCGG - Exonic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083431505 11:62615728-62615750 AGCAGCTGCAGCGGCAGGGCCGG - Exonic
1084021601 11:66421110-66421132 AGCCGCCGGTGCGTCGGGACGGG + Exonic
1084310288 11:68312730-68312752 AGCAGCGGCCACGGCGGCCCGGG - Exonic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1084758304 11:71252538-71252560 AGGAGCCGCCGCCGCGGCTCAGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1087795662 11:102452811-102452833 CGCAGCCGGGGCGGCGGGGCCGG + Exonic
1089499286 11:118923114-118923136 AGCAGCTGCCGGGGCAGGAGTGG - Intronic
1089813675 11:121153035-121153057 AGCAGCCGCAGCTGTGGGGCAGG - Exonic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1096191338 12:49622230-49622252 AGCCGCCGCCGCGGCAGGAGAGG - Intronic
1096670907 12:53197766-53197788 AGCTGGCGCCGCAGCGGGTCCGG - Exonic
1101431076 12:104627854-104627876 AGCAGCAGCAGTGGCAGGACTGG + Intronic
1102278359 12:111599398-111599420 AGCGGCCGGCGCGGCGGAGCGGG - Exonic
1103534763 12:121626830-121626852 AGCCGCCGCCGCAGCGGGGACGG + Exonic
1103563398 12:121804074-121804096 AGCAGCAGCGGCGGCGGCAGCGG + Intergenic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1104773841 12:131381158-131381180 AGCAGCCTCCACCGCGGGACTGG + Intergenic
1104974487 12:132546336-132546358 TGCAGCCTCCGGGGCGGGATGGG + Intronic
1105253859 13:18726675-18726697 GGCTGGCCCCGCGGCGGGACGGG - Intergenic
1106208768 13:27621830-27621852 AGGAGCCGCAGCGGCGCGGCAGG - Exonic
1106340218 13:28820172-28820194 AGCCGCGGCCGCGGCGGAGCCGG + Intergenic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1108029261 13:46211900-46211922 CGCAGGCGCGGGGGCGGGACAGG - Intergenic
1110318736 13:74136160-74136182 AGTAGCCTCAGCGGCGGGAGCGG + Intergenic
1111354574 13:87080746-87080768 AGCAGCTGCCGCGGTGGGAGAGG - Intergenic
1113517330 13:110914149-110914171 AGCAAGCGCCCCGGCGGGACTGG - Intronic
1114031530 14:18584240-18584262 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1117842164 14:59870841-59870863 GGCAGCGGCCGCGGCGGGGCCGG - Exonic
1122162310 14:99793353-99793375 AGCAGCCGCCACAGCAGGGCCGG + Exonic
1122569324 14:102683917-102683939 AGCAGCAGCCGAGGTGGGGCTGG + Intronic
1122979063 14:105182942-105182964 AGCAGCAGCAGCCCCGGGACAGG + Intergenic
1123671561 15:22664510-22664532 AGCAGCCGCAGCGGCGCGAGGGG + Intergenic
1124109564 15:26773268-26773290 GGCGGCCGCCGAGGCGGGAGGGG - Intronic
1124323598 15:28737734-28737756 AGCAGCCGCAGCGGCGCGAGGGG + Intronic
1124527482 15:30470930-30470952 AGCAGCCGCAGCGGCGCGAGGGG + Intergenic
1124771171 15:32536753-32536775 AGCAGCCGCAGCGGCGCGAGGGG - Intergenic
1124929125 15:34101790-34101812 AGCAGCAGCAGCAGCAGGACGGG + Exonic
1125522959 15:40358337-40358359 AGCAGCAGCAGCGGCGGCAGCGG + Exonic
1125832290 15:42725535-42725557 AGCAGCAGCTGCAGCGGAACCGG + Exonic
1128067810 15:64775458-64775480 GGCAGCCTCCGCGTCGGGCCAGG + Exonic
1128322666 15:66703913-66703935 AGCAGCAGCTGCGGCGGCGCGGG - Exonic
1129423981 15:75451663-75451685 AGAAGCGGCCGCGGCGGTAGAGG - Exonic
1130508694 15:84570617-84570639 AGGAGCCGCCGCGGCAGCTCAGG - Intergenic
1130979447 15:88803023-88803045 TGAGGCCGCCGCGGCGGGACAGG - Intergenic
1131466052 15:92655613-92655635 AGCAGCAGCAGCGGCAGGAGCGG + Exonic
1132497542 16:270938-270960 AGCAGCCTCCCCGCTGGGACTGG + Intronic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1132662041 16:1065944-1065966 TGCGGCCGCGGCGGCGGGTCCGG + Intergenic
1132934713 16:2474627-2474649 AGCAGACGCCGCGGGGCGCCCGG - Intergenic
1133188394 16:4116167-4116189 AGCTGCGGCCGCGGCGGGAGCGG - Exonic
1133464856 16:6019498-6019520 AGCAGCACCCGCGGTGGGGCGGG + Intronic
1134656078 16:15949514-15949536 AGCGGGCGCCGGGGCGGGGCGGG + Intergenic
1135330835 16:21558351-21558373 AGCAGCCACCACGACGGAACAGG + Intergenic
1135821770 16:25692055-25692077 AGCAGAAGCCGCGGCGGAGCCGG + Exonic
1135976117 16:27109853-27109875 TGCAGAGGCGGCGGCGGGACCGG + Intergenic
1135976151 16:27109957-27109979 TGCAGCGGGCGCGGCGGGGCGGG - Intergenic
1136242196 16:28951327-28951349 AGCCGCCGCCGCCGCCTGACCGG - Exonic
1136414744 16:30096229-30096251 TGCCGCCGCTGCGGCGGGAGGGG + Intronic
1136698980 16:32115660-32115682 AAAAGCCGCGGCGGCGGGGCGGG - Intergenic
1137013856 16:35352681-35352703 AGCGGCTGCCGGGGAGGGACTGG + Intergenic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1141797828 16:86286738-86286760 AGCAGCCGCCGCGGCGGTCTGGG + Intergenic
1142179780 16:88662792-88662814 GGCAGCCGTCGCGGGGGAACGGG + Intronic
1142372258 16:89689393-89689415 AGCAGCAGCCGCGTTGGGGCTGG + Intronic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1143201410 17:5116036-5116058 AGCTAGCGGCGCGGCGGGACGGG + Intronic
1143494972 17:7307646-7307668 AGCAGCGGCGGCGGCGGTAGAGG + Intronic
1144547999 17:16215482-16215504 AGCAGCCGCGGCGGCGGCGGCGG - Exonic
1144548000 17:16215485-16215507 AGCAGCAGCCGCGGCGGCGGCGG - Exonic
1144676326 17:17164527-17164549 AGCAGGCGCTGCAGCGGGACCGG + Intronic
1144776002 17:17784908-17784930 AGCAGCAGCCTGGGTGGGACTGG - Intronic
1145183660 17:20775458-20775480 AGCGGTGGCCGCGGCGGAACTGG - Intergenic
1145327270 17:21842670-21842692 AGAAGCCGCCGCGGCGGGGGGGG - Intergenic
1147612767 17:41811509-41811531 AGCAGCTGCCGCGGCGGGTAGGG + Exonic
1147996762 17:44363818-44363840 AGCGGGCGCCGCAGCGGGAGCGG - Exonic
1148090898 17:45022018-45022040 AGCAGCTGCCGCGGGAGCACGGG - Intergenic
1148178081 17:45584883-45584905 AGCGGCAGCGGCGGCGGGGCCGG + Intergenic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1148838627 17:50479921-50479943 AGCAGCCACCGTGTGGGGACTGG - Exonic
1149477864 17:56978184-56978206 AGCAGCAACCACCGCGGGACGGG - Exonic
1149582299 17:57759094-57759116 AGCAGCCGGGGCAGGGGGACAGG + Intergenic
1149599705 17:57885518-57885540 AGCAGCGGCAGCGGCGGGGGTGG - Exonic
1149963265 17:61135966-61135988 AGCAGCAGCAGCGGCAGGAGAGG - Intronic
1150255634 17:63741955-63741977 AGCCGCCGCCGCGCCGAGAGCGG + Intronic
1150562069 17:66302795-66302817 AGCTGCGGCCGCGGAGGGCCGGG - Intronic
1150692296 17:67377230-67377252 AGCAGCGGCCGCGGCGGGGAGGG - Intergenic
1151306798 17:73267770-73267792 AGCAGCAGCAGCGGCGGGTGAGG - Intergenic
1151370866 17:73645313-73645335 AGCAGCCTGCGCGCCGGGAGGGG + Intergenic
1151666717 17:75549502-75549524 AGCAGCCCCTGCGGAGGGCCAGG + Intronic
1151696693 17:75721585-75721607 AGCAGCAGCCGAGGCTGGCCGGG + Exonic
1152357896 17:79815440-79815462 AGCAGTCGCCCCTGCGGGCCTGG - Intergenic
1152758700 17:82097691-82097713 CGCAGGGGCCGCGCCGGGACCGG - Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155902690 18:31410914-31410936 CGCAGCAGCCACGGCGGGAACGG + Intronic
1158976512 18:62715785-62715807 AGCGGCGGCCGCGGCGGCTCTGG + Exonic
1159578272 18:70206001-70206023 AGCGGGCGCCGCGGCGGGCCCGG - Intergenic
1160024960 18:75209299-75209321 AGCAGCGGCCGGGGCGGCAGCGG - Exonic
1160254844 18:77239612-77239634 AGCAGCAGCCCCTGGGGGACGGG - Intergenic
1160352311 18:78194014-78194036 AGCAGAGGCCGCCGGGGGACAGG - Intergenic
1160748597 19:723062-723084 AGCAGCCTCCCAGGCGGGGCTGG + Intronic
1160782652 19:884664-884686 GGCAGCCGCCGCAGCGGGCGTGG + Intronic
1160960605 19:1719048-1719070 TGCCGCCGCCGCAGCGGGGCTGG + Intergenic
1161076860 19:2290033-2290055 GCCGGCCGCCGCGGCGGGCCAGG - Exonic
1161153550 19:2721319-2721341 AGCAGCGGCCGCGGCGCCGCAGG - Exonic
1162604213 19:11694586-11694608 CGCAGTCGCCGCGAAGGGACGGG + Intergenic
1162615748 19:11798928-11798950 CGCAGTCGCCGCGTAGGGACGGG - Intronic
1162630806 19:11925470-11925492 CGCAGTCGCCGCGCAGGGACGGG - Intronic
1162646258 19:12052579-12052601 CGCAGTCGCCGCGCAGGGACCGG + Intronic
1162705330 19:12551112-12551134 CGCAGTCGCCGCGCAGGGACGGG + Intronic
1162713180 19:12611203-12611225 CGCAGTCGCCGCGCAGGGACGGG - Intronic
1162752672 19:12838458-12838480 TGCAGCCGCCGCAGCGGGCAGGG - Intronic
1163123498 19:15232043-15232065 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163154469 19:15432486-15432508 CGCCACCGCCGCCGCGGGACGGG - Intronic
1163729560 19:18941240-18941262 GGCGGCGGCCGCGTCGGGACCGG - Intronic
1164595050 19:29526864-29526886 AGCCGGGGCCCCGGCGGGACTGG - Intronic
1164658557 19:29942399-29942421 AGCAGCGGCGGCGGCGGGCGCGG + Exonic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1164835581 19:31353139-31353161 AGAAGCGGCCGCGGCGGCGCGGG + Intergenic
1165129222 19:33621861-33621883 AGCCGCCACCACGGCGGGGCGGG + Intergenic
1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG + Intergenic
1166876558 19:45901450-45901472 AGCGTCCTCCGCGGCGGGCCCGG + Exonic
1166959662 19:46489909-46489931 AACAGCCGCCGCCGCGTGCCAGG + Intronic
1167237172 19:48322060-48322082 AGCAGCCGCCGCCGCGGAGGGGG - Intronic
1167539465 19:50075839-50075861 AGCAGCAGCAGTGGGGGGACCGG - Intergenic
1167604945 19:50476626-50476648 AGCGGCTGCCGGGCCGGGACTGG + Exonic
1167630246 19:50622018-50622040 AGCAGCAGCAGTGGGGGGACCGG + Exonic
1168462046 19:56567541-56567563 GGCAGCGGCCGAGGCTGGACTGG + Exonic
925390051 2:3488365-3488387 AGCAGCAGCAGCAGCAGGACAGG + Intergenic
925929087 2:8693449-8693471 AGCAGCCGCAGCGGGGCGGCGGG + Intergenic
926784738 2:16508333-16508355 AGACGCCGCAGCGGCGGGGCAGG - Intergenic
927982120 2:27380693-27380715 AGCGGCGGCGGCGGCGGGAGCGG - Exonic
932412633 2:71556278-71556300 AGCAGCGGCAGCTGCGGGCCCGG + Intronic
935137717 2:100322059-100322081 GGCGGCGGCGGCGGCGGGACCGG + Exonic
936370524 2:111898742-111898764 AGCAGCAGCGGCAGCGGGGCCGG - Exonic
936389115 2:112055624-112055646 AGCAGCGGCGGCGGCGTGGCAGG - Exonic
938496666 2:131801553-131801575 CGCAGCCGCCAGGGAGGGACTGG + Exonic
941686849 2:168456332-168456354 AGCAGCGGCGGCGGCGGCACAGG + Exonic
944933680 2:204545681-204545703 AGCAGCCGCCTGGGCCGGGCAGG + Intergenic
946019843 2:216633554-216633576 AGCAGCGGCGGCGGCGGCAGCGG - Exonic
946395428 2:219441855-219441877 AGCAGCGGCGGCGGCGGCGCTGG - Intronic
948365413 2:237451634-237451656 TGCAGCGGCCACAGCGGGACTGG - Intergenic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
949019963 2:241735314-241735336 AGCAGCAGCCTCTGCGGGCCAGG - Exonic
1168855067 20:1002353-1002375 AGGAGCCGGCGCGGCGGGGGCGG + Intergenic
1170464624 20:16611430-16611452 GGCAGCAGCTGGGGCGGGACTGG - Intergenic
1172326818 20:34042229-34042251 GGCAGCTGCCTCGGCGGGAGCGG - Intronic
1172666766 20:36605754-36605776 AGCAGGCGCCGCGAAGGGAGGGG - Intronic
1175517240 20:59577447-59577469 AGGCGCCGGCGGGGCGGGACCGG - Intergenic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1175877727 20:62238434-62238456 AGCGGCCGACGCGGCGGCGCCGG + Intronic
1176029797 20:63006475-63006497 AGCAGCGGCGGCGGCGGCGCGGG - Exonic
1176548464 21:8211884-8211906 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176556358 21:8256092-8256114 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176567395 21:8394919-8394941 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176575297 21:8439134-8439156 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176869193 21:14072860-14072882 AGCAGCCCCTGCGCCGGGCCCGG - Intergenic
1178493807 21:33070787-33070809 AGCAGCAGGCGCGGCGCGGCGGG - Exonic
1179225093 21:39445853-39445875 AGCAGGAGCCGCGGCGGGGAGGG + Intronic
1179692160 21:43087653-43087675 AGCAGCCGCAGCCGGGAGACAGG - Intergenic
1179922955 21:44516983-44517005 AGCAGCCGCTGAGGTGGGACAGG - Intronic
1180455642 22:15511297-15511319 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1180831011 22:18906145-18906167 TGCAGCCACCACGGAGGGACGGG + Intronic
1181572031 22:23772944-23772966 AGCCGCCGCCGCTGCTGGCCCGG + Exonic
1181714149 22:24712245-24712267 CGCAGCGGCTGGGGCGGGACGGG - Intergenic
1181725130 22:24806225-24806247 TGCTGCAGCCGCGGCGGGGCGGG - Intronic
1181811307 22:25405237-25405259 AGCAGCGGCCACGGCGGCCCGGG + Intronic
1183301078 22:37059500-37059522 TGCAGGCGCAGGGGCGGGACAGG - Intronic
1183485600 22:38086270-38086292 AGCAGCCGCCGCAGCAGCATGGG - Exonic
1184095522 22:42314330-42314352 AGCTGCCGCTGCCGGGGGACAGG + Intronic
1184784372 22:46664624-46664646 AGCGGCTGCCCCAGCGGGACAGG + Intronic
1184794978 22:46726916-46726938 AGCAGCCGCAGCGGAGGCAAGGG - Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1203253348 22_KI270733v1_random:128189-128211 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203261402 22_KI270733v1_random:173267-173289 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203281098 22_KI270734v1_random:131416-131438 TGCAGCCACCACGGAGGGACGGG + Intergenic
950153830 3:10707991-10708013 AGCCGCAGCCGCAGCGGGGCCGG - Intronic
951258688 3:20481690-20481712 AGCAGCTGCCACTGAGGGACTGG + Intergenic
951962964 3:28349137-28349159 GTGAGCCTCCGCGGCGGGACGGG + Exonic
952377802 3:32781575-32781597 AGCGGCCGGCGCGGCGGCGCCGG + Intergenic
954069349 3:48131452-48131474 AGCAGCCGCAGCAGCAGGCCCGG - Intergenic
954138963 3:48595280-48595302 TGCAGCGGCGGCGGCGGGAGCGG - Intergenic
956678025 3:71753677-71753699 GGCAGCGGCGGCGGCGGGCCCGG + Intronic
959358997 3:105366924-105366946 AGCAGCGGCAGCGGCGGCAGCGG - Exonic
964482778 3:157159571-157159593 AGCGGCGGCGGCGGCGGGAGGGG - Intronic
965165661 3:165192842-165192864 AGCAGCCACCGCGGCGGCAGCGG - Intronic
966362772 3:179148361-179148383 AGCGGCCGCAGCGGCGGCACCGG - Intronic
967904085 3:194486738-194486760 AGGAGGCGCCGCGGCGGGGCCGG + Intronic
971457935 4:26861325-26861347 GCCGGCCGCCGCGGCGGGAGAGG - Exonic
974978618 4:68923981-68924003 AGCAGCCTCCCCTGCTGGACTGG - Intergenic
976390041 4:84497800-84497822 AGCAGCCGCGGCGGCGGCAGAGG + Exonic
978503444 4:109433490-109433512 AGCAGCCGCGGGGCCGGCACTGG + Intergenic
980130062 4:128809965-128809987 CGCCGTCGCCGCCGCGGGACCGG - Intronic
981034239 4:140153239-140153261 AACAGCAGCCTCGGCGGGGCCGG - Exonic
981067227 4:140498080-140498102 CGAAGCCCCCGCGGCGGGAAAGG + Intronic
982157417 4:152535854-152535876 TGCAGCCGCCGCTGCCGGCCGGG + Exonic
982198474 4:152937550-152937572 AGCAGCTGCAGCCGCCGGACGGG + Intronic
982953169 4:161726508-161726530 ATGAGCCGCCGCGCCTGGACAGG + Intronic
984463109 4:180059736-180059758 AGCAGCGGCGGCGGCGGCAGCGG + Intergenic
985788140 5:1910679-1910701 ACCAGCTGCCGGGGCGGGCCTGG - Intergenic
986006653 5:3673940-3673962 AGCAGCCGGAGCGGAGTGACTGG - Intergenic
986152485 5:5140278-5140300 GGCAGCCGCGGCGGCGGGGGCGG - Intergenic
988482073 5:31639315-31639337 GGCAGGCGCGGCGGCGGCACCGG + Intergenic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
996442989 5:123512602-123512624 GGCAGCCGCCGGGCCGGGGCTGG - Intronic
997975411 5:138439070-138439092 AGCAGCCGCCGCGGGGGCAGCGG - Exonic
997980597 5:138465536-138465558 AGCTTCCGCCGCCGCAGGACCGG + Exonic
998236428 5:140402139-140402161 AGCAGCGGCGGCGGCGGCAGCGG + Exonic
999295851 5:150459045-150459067 AGGACCCGCCTCGGCGGGGCAGG + Intergenic
1001506370 5:172283707-172283729 AGCGGCGGCGGCGGCGGGCCCGG - Exonic
1003623869 6:7726157-7726179 AGCGGCCGCGGCGGCGGCGCCGG - Intergenic
1005636438 6:27757617-27757639 AGCAGAGGCCGCCGCGGGGCCGG + Intergenic
1006181256 6:32154649-32154671 AGCAGCAGCAGCGGCAGGAAAGG - Exonic
1006860739 6:37170226-37170248 GGCAGCGGCGGCGGCGGGACCGG + Exonic
1010083049 6:71886574-71886596 AGCAGCCTCCACGGCGGCAGCGG + Intergenic
1011194006 6:84763997-84764019 TGCAGCCGCGGCGGCGGCGCGGG - Exonic
1012895476 6:104941393-104941415 AGCAACCGCAGCGGCGAGCCTGG - Intergenic
1012929512 6:105302489-105302511 AGCAGCAGCCGCGGAAGGAGCGG - Intronic
1016010743 6:139135489-139135511 AGCGGCGGGCGCGGCGGGAGCGG + Exonic
1018677574 6:166236134-166236156 ACCAGCCGCCGCAGCGGAGCTGG + Intergenic
1019313584 7:374540-374562 GGTAGCCGCCGCGGTGGGAGTGG - Intergenic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1021668612 7:23013487-23013509 AGCATCCGCCGCGGCAGGGAGGG + Intronic
1025992513 7:66506345-66506367 TGCATCCGCCGAGGCGGGGCGGG - Intergenic
1026840435 7:73667778-73667800 AGGAGCCGCGGCGCCGGGGCTGG - Intergenic
1026906036 7:74063313-74063335 GGCAGCGGCGGCGGCGGGTCCGG - Exonic
1027224486 7:76235303-76235325 AGCAGGCCGCGGGGCGGGACTGG + Intronic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1028173558 7:87628241-87628263 AGCAGCCCACGCGTCGGGGCGGG + Intronic
1029701385 7:102248793-102248815 AGCCGCCGCCGCGCCGGGGGAGG + Exonic
1032020695 7:128405914-128405936 AGCAGCAGCAGCGGCGGCAGCGG - Intronic
1033186570 7:139231834-139231856 AGCAGCCGCCGCGGCCGCCGAGG + Exonic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1034931485 7:155167185-155167207 AGCAGCCTCCGGGGCAGGGCAGG - Intergenic
1035384240 7:158459651-158459673 GGCAGCCACAGCGGCTGGACAGG - Intronic
1035404202 7:158587638-158587660 AGCAGCAGCAGCAGCGGGAGCGG + Exonic
1037885434 8:22593760-22593782 AGCAGCCGGGGTGGCGGTACCGG - Exonic
1038055594 8:23854695-23854717 AGCAGCAGCAGCGGAGGCACCGG - Exonic
1038972065 8:32647226-32647248 AGCAGCAGCGGCGGCAGGAGAGG - Intronic
1039050051 8:33484761-33484783 TGCAGGCGGCGCGGCGGGGCTGG - Exonic
1039467867 8:37796961-37796983 AGCAGGCGACGCGGAGGGGCCGG + Intronic
1040807430 8:51409276-51409298 ACCAGCCGGGGCGGCGGGAGGGG + Exonic
1041690146 8:60679619-60679641 AGCAGCGGCGGCGGCGGCTCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044832306 8:96262008-96262030 CGCCGCCACCGCGGCAGGACGGG + Exonic
1045564355 8:103298768-103298790 GGCGGCGGCGGCGGCGGGACTGG - Intronic
1047757349 8:127928751-127928773 TGCAGCCACCGCAGCAGGACAGG - Intergenic
1049194596 8:141308389-141308411 AGCACCCGCCGCCGCGGGACGGG + Intergenic
1049409113 8:142464641-142464663 AGCAGCCGCCCCAGCACGACGGG + Exonic
1049665441 8:143840799-143840821 AGCCGGCGCCGAGGCGGGCCCGG - Exonic
1049674365 8:143883213-143883235 AGCAGCCGCTGCAGCGGCTCCGG - Intergenic
1049675910 8:143888937-143888959 AGCAGACGCCGGGGAGGGAGAGG + Intergenic
1049694641 8:143977307-143977329 AGCAGCGGCCGAGGGGGGCCGGG - Exonic
1049707654 8:144050327-144050349 AGCTGACGCCGCTGCTGGACTGG + Intergenic
1052991792 9:34522944-34522966 CGCTCCCGCCGCGGCGCGACCGG + Exonic
1057488630 9:95506090-95506112 AGCGGCAGCGGCGGCGGGCCCGG + Intronic
1059375227 9:113876160-113876182 AGCGGCTGCCGCGGCGCGGCCGG + Intergenic
1060629567 9:125143444-125143466 AGCAGCTCCCGCGGCGGAGCAGG - Exonic
1061202118 9:129143866-129143888 AGCAGCCCCCACTGTGGGACAGG - Intronic
1061208310 9:129176904-129176926 AGCAGCCGCCGCCGCTCAACGGG - Exonic
1061807254 9:133143379-133143401 AGCAGCCTCAGGGGCGGGCCTGG + Intronic
1062314573 9:135960497-135960519 AGCAGCCGGCTCTGCGGGAAAGG + Intronic
1062436122 9:136547305-136547327 AGCAGCTACAGGGGCGGGACAGG - Intergenic
1062472489 9:136712582-136712604 AGCGGCGGCCGCTGCGGGCCGGG + Exonic
1062574711 9:137200757-137200779 AGCCGCCGCCGCGGCCAGCCTGG + Exonic
1062718695 9:138023661-138023683 AGGAGCCGGCGCGGCGGCACCGG + Exonic
1203469748 Un_GL000220v1:111336-111358 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203477569 Un_GL000220v1:155308-155330 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1186350119 X:8731941-8731963 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1186452926 X:9688135-9688157 AGCCGCCGCCGCCGCCGCACTGG - Exonic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1189534714 X:41923872-41923894 TGCAGCTGCCGAGGCGGGGCTGG + Intergenic
1192261093 X:69506187-69506209 GGCAGCGGCCGCAGTGGGACCGG + Intronic
1196808029 X:119605917-119605939 GGCAGCGGCGGCGGCGGGAGGGG + Intergenic
1196918129 X:120560591-120560613 AGCAGCAGCAGCTGAGGGACTGG + Exonic
1197754456 X:129984174-129984196 AGCAGCGGCGGCGGCGGCAGCGG - Intronic
1198530645 X:137547594-137547616 AGCAGCCTCTGCCGCGGGTCAGG - Intergenic
1200138504 X:153886162-153886184 AGCAGCGGCTGTGGCGGGGCGGG + Intronic
1201764465 Y:17565203-17565225 ATCAGCCCCTGCGCCGGGACCGG - Intergenic
1201837088 Y:18340787-18340809 ATCAGCCCCTGCGCCGGGACCGG + Intergenic