ID: 900287701

View in Genome Browser
Species Human (GRCh38)
Location 1:1909325-1909347
Sequence GCCGTGCGTCCTAGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900287701_900287707 2 Left 900287701 1:1909325-1909347 CCGCCGCCGCTAGGACGCACGGC No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287701_900287706 -8 Left 900287701 1:1909325-1909347 CCGCCGCCGCTAGGACGCACGGC No data
Right 900287706 1:1909340-1909362 CGCACGGCGGTGGCGAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900287701 Original CRISPR GCCGTGCGTCCTAGCGGCGG CGG (reversed) Intergenic