ID: 900287701 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:1909325-1909347 |
| Sequence | GCCGTGCGTCCTAGCGGCGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900287701_900287707 | 2 | Left | 900287701 | 1:1909325-1909347 | CCGCCGCCGCTAGGACGCACGGC | No data | ||
| Right | 900287707 | 1:1909350-1909372 | TGGCGAGCACCGGCTCCCACAGG | No data | ||||
| 900287701_900287706 | -8 | Left | 900287701 | 1:1909325-1909347 | CCGCCGCCGCTAGGACGCACGGC | No data | ||
| Right | 900287706 | 1:1909340-1909362 | CGCACGGCGGTGGCGAGCACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900287701 | Original CRISPR | GCCGTGCGTCCTAGCGGCGG CGG (reversed) | Intergenic | ||