ID: 900287707

View in Genome Browser
Species Human (GRCh38)
Location 1:1909350-1909372
Sequence TGGCGAGCACCGGCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900287695_900287707 12 Left 900287695 1:1909315-1909337 CCGCCTTTCCCCGCCGCCGCTAG No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287692_900287707 15 Left 900287692 1:1909312-1909334 CCCCCGCCTTTCCCCGCCGCCGC No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287705_900287707 -4 Left 900287705 1:1909331-1909353 CCGCTAGGACGCACGGCGGTGGC No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287691_900287707 22 Left 900287691 1:1909305-1909327 CCGGGCTCCCCCGCCTTTCCCCG No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287697_900287707 9 Left 900287697 1:1909318-1909340 CCTTTCCCCGCCGCCGCTAGGAC No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287693_900287707 14 Left 900287693 1:1909313-1909335 CCCCGCCTTTCCCCGCCGCCGCT No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287694_900287707 13 Left 900287694 1:1909314-1909336 CCCGCCTTTCCCCGCCGCCGCTA No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287701_900287707 2 Left 900287701 1:1909325-1909347 CCGCCGCCGCTAGGACGCACGGC No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287699_900287707 3 Left 900287699 1:1909324-1909346 CCCGCCGCCGCTAGGACGCACGG No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287698_900287707 4 Left 900287698 1:1909323-1909345 CCCCGCCGCCGCTAGGACGCACG No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data
900287703_900287707 -1 Left 900287703 1:1909328-1909350 CCGCCGCTAGGACGCACGGCGGT No data
Right 900287707 1:1909350-1909372 TGGCGAGCACCGGCTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900287707 Original CRISPR TGGCGAGCACCGGCTCCCAC AGG Intergenic