ID: 900288890

View in Genome Browser
Species Human (GRCh38)
Location 1:1915499-1915521
Sequence GGGGAAGCCCAGGCCAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 375}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900288882_900288890 2 Left 900288882 1:1915474-1915496 CCTTCGGTGCCCATCTTCAGGGT 0: 1
1: 0
2: 2
3: 4
4: 77
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288879_900288890 12 Left 900288879 1:1915464-1915486 CCGCACTTAGCCTTCGGTGCCCA 0: 1
1: 0
2: 0
3: 1
4: 93
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288872_900288890 26 Left 900288872 1:1915450-1915472 CCCTTTCCTGGCCCCCGCACTTA 0: 1
1: 0
2: 0
3: 10
4: 128
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288878_900288890 13 Left 900288878 1:1915463-1915485 CCCGCACTTAGCCTTCGGTGCCC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288873_900288890 25 Left 900288873 1:1915451-1915473 CCTTTCCTGGCCCCCGCACTTAG 0: 1
1: 0
2: 0
3: 15
4: 141
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288874_900288890 20 Left 900288874 1:1915456-1915478 CCTGGCCCCCGCACTTAGCCTTC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288877_900288890 14 Left 900288877 1:1915462-1915484 CCCCGCACTTAGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 0
4: 41
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288876_900288890 15 Left 900288876 1:1915461-1915483 CCCCCGCACTTAGCCTTCGGTGC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288887_900288890 -8 Left 900288887 1:1915484-1915506 CCATCTTCAGGGTCAGGGGAAGC 0: 1
1: 0
2: 0
3: 27
4: 212
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375
900288886_900288890 -7 Left 900288886 1:1915483-1915505 CCCATCTTCAGGGTCAGGGGAAG 0: 1
1: 0
2: 1
3: 13
4: 199
Right 900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG 0: 1
1: 0
2: 5
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900288890 Original CRISPR GGGGAAGCCCAGGCCAAAGC GGG Intronic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
900915483 1:5635326-5635348 GAGAAAGCCCAGGCCATAGTGGG - Intergenic
900942658 1:5811000-5811022 TCAGAAGCCCAGGACAAAGCTGG - Intergenic
901869673 1:12130577-12130599 GGGGAATCACAGGCCAGAGAGGG + Intronic
901914037 1:12484205-12484227 TGGGAAGGCCTGGCCCAAGCAGG - Intronic
902286846 1:15412623-15412645 GTGGAAGCCCAGGAGAAGGCAGG - Intronic
902756651 1:18553351-18553373 GGGGAAGCAGAGGGCACAGCTGG - Intergenic
902799696 1:18821523-18821545 GAGGAAGGCCAGGCCACAGGTGG + Intergenic
903215252 1:21840077-21840099 AGGGAAGACCAAGCCAGAGCTGG - Intronic
903365063 1:22801188-22801210 GGTGAAGCCCCTGCCAAGGCTGG + Intronic
903469105 1:23573025-23573047 GAGAAAGCTCAGGCCACAGCTGG + Intergenic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
904087864 1:27922665-27922687 GGGGAAGTCCTGGGCAAACCAGG - Intergenic
904466730 1:30712485-30712507 AGGGCAGCCCAGGCCCAGGCTGG + Exonic
904586681 1:31584626-31584648 GGGGCAGGCCAGGGCAGAGCAGG + Intronic
905212367 1:36383431-36383453 AGAGAAGCCCAGGCCAATGCAGG + Intronic
905298807 1:36972134-36972156 GGCGGAGCCCATGCCAAAGATGG - Intronic
906414305 1:45608144-45608166 GGAGAAGGTCAGGGCAAAGCTGG + Exonic
907298677 1:53471591-53471613 GGTGAAGCCTAGGCCACAGCAGG - Intergenic
907319721 1:53594747-53594769 CTGGAGGCCCAGGCCAGAGCTGG + Exonic
907586123 1:55619607-55619629 GGAGAAGTGCAGGGCAAAGCAGG - Intergenic
911739264 1:101369436-101369458 TGGGAGGCCAAGGCCAAGGCGGG - Intergenic
914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG + Intergenic
915200014 1:154220527-154220549 GGGGAAGACCAAGCCAGACCCGG + Exonic
915469865 1:156119498-156119520 TGGGAGGCCAAGGCCAAGGCAGG - Intronic
915544145 1:156586387-156586409 AGGGAAGCTGAGGCCAAGGCAGG + Intronic
916052924 1:161048724-161048746 GAGGAAGCCCAGGTAGAAGCTGG - Exonic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920549429 1:206846164-206846186 GGAGGAGCCCAGGCCTCAGCTGG - Intergenic
920706128 1:208251927-208251949 GGGGAAACCAAGGCCAGAGGAGG - Intergenic
922706288 1:227792495-227792517 GGAGAGGCCCTGGCCCAAGCAGG + Intergenic
1063539433 10:6917550-6917572 GGCAATGCCAAGGCCAAAGCAGG + Intergenic
1064033050 10:11894956-11894978 GAGGAAGCCCAGCAGAAAGCGGG + Intergenic
1064553099 10:16521690-16521712 GGGGACGCCCGGGCCCACGCGGG - Exonic
1065168626 10:23006081-23006103 GGGGAAGTCCTGGGCAAATCTGG + Intronic
1065693488 10:28358341-28358363 GGGCAAGCCAAGGTCAAAGACGG - Intergenic
1066126715 10:32348815-32348837 GTGGAAGCCCAGGCCACTGTGGG + Intronic
1067161037 10:43825536-43825558 GGGGAGGCCCAGAGCAGAGCGGG + Intergenic
1067324932 10:45258630-45258652 AGTGAAGCCCACGACAAAGCAGG - Intergenic
1069661790 10:70127802-70127824 GGGGACACCCAGACCAGAGCAGG + Intronic
1070031774 10:72684032-72684054 GGGGAAGCTGAGGCAAAGGCAGG - Intergenic
1070247281 10:74744329-74744351 GGGGAAGCAAAGGCCAAGTCGGG - Intergenic
1070789492 10:79180929-79180951 GGGGAGGCACAGGCCATGGCGGG - Intronic
1071289996 10:84181805-84181827 GGGGCTGCCCAGGCTTAAGCTGG + Intronic
1071554817 10:86593784-86593806 TGGGAGGCCCAGGCCGAGGCGGG + Intergenic
1072272389 10:93789412-93789434 GGGGCAGCCCAGGCAAGAGGAGG + Intronic
1073044871 10:100630978-100631000 TGGGAAGCCATGGCCAAACCAGG - Intergenic
1073447884 10:103591987-103592009 GGGAGAGCCCAGGCCAGGGCAGG - Exonic
1074291296 10:112139780-112139802 AGGGAAGGCCAGGGAAAAGCAGG + Intergenic
1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG + Intronic
1074965601 10:118488198-118488220 GGGGAAGTACAGGGCAAAGGAGG + Intergenic
1075629723 10:123993834-123993856 GGGGAAGGTCAGGGCCAAGCAGG + Intergenic
1076114158 10:127883918-127883940 GAGGAATGCCAGGCCAGAGCTGG - Intronic
1076329113 10:129652177-129652199 GGGGAAGCACAGGGCAAGCCAGG - Intronic
1076761409 10:132607746-132607768 GGGAAACCCCAGGCCCACGCGGG - Intronic
1077112017 11:866105-866127 GGGGAGGCCGGGGCAAAAGCAGG + Intronic
1077308625 11:1878750-1878772 GAGGGAGCCCAGGCCAGAACAGG - Intronic
1077355496 11:2114917-2114939 GGGGAAGGCCTCGCCCAAGCTGG + Intergenic
1077671981 11:4165786-4165808 GGGGCAGCTCTGCCCAAAGCAGG + Intergenic
1078110037 11:8385001-8385023 GGGGAAGGCCAGGCCTGGGCTGG - Intergenic
1078135847 11:8650820-8650842 GGGAAAGCACTGGCAAAAGCAGG + Intronic
1078945073 11:16056612-16056634 GTGGAATCCCAGGCAAAGGCAGG - Intronic
1080418996 11:32093691-32093713 GGGGAAACCAAGGGCAGAGCAGG + Intronic
1081611586 11:44566205-44566227 GGGGAAGAGGAGGCCAAAGCAGG + Intronic
1081762113 11:45583966-45583988 GAAGAAGCCGAGTCCAAAGCAGG + Intergenic
1082821272 11:57546116-57546138 GGAACAGCCCAGGCCAAGGCAGG + Intronic
1083615574 11:64024523-64024545 GGGGAGGCCCAGGCAGCAGCTGG - Intronic
1083668716 11:64288824-64288846 GGGGAAGCAAAGGCCATGGCAGG - Intronic
1083674221 11:64316481-64316503 GGGGAAGCCCTGGCCACCCCAGG - Exonic
1083751519 11:64763533-64763555 GGTGAAGCCAAGGTCAAAGAGGG + Intergenic
1084475328 11:69385573-69385595 GGGGAAACTGAGGCCCAAGCCGG + Intergenic
1084524427 11:69686881-69686903 GGGACAGCCCAGGCCCAAGCAGG - Intergenic
1084591346 11:70092494-70092516 AAGGCAGACCAGGCCAAAGCTGG - Intronic
1085425939 11:76404676-76404698 GAGGAAGCCCAGGCCATGGCAGG + Exonic
1085620826 11:78036983-78037005 GAGGAAACCAAGGCCAAAGAAGG + Intronic
1085654317 11:78298756-78298778 AGGGAAAACCAGGGCAAAGCTGG + Intronic
1087207464 11:95412094-95412116 GGGCAAGCCCTGGCAAAAGCAGG - Intergenic
1089369534 11:117945356-117945378 GGGAAAGCCCCGGGCAAACCTGG + Intergenic
1090977002 11:131687422-131687444 TGGAAGGCCCAGGCCACAGCGGG - Intronic
1092141014 12:6183353-6183375 GGGTAAGCTCATGCAAAAGCTGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095957907 12:47817206-47817228 GAGGAGGCCCAGGCCAAGGCTGG - Intronic
1096077533 12:48814742-48814764 GGCGCTGCCCAGGCCAGAGCAGG - Intronic
1097597231 12:61648950-61648972 TGGGAGGTCAAGGCCAAAGCGGG + Intergenic
1097626671 12:62010280-62010302 TGGCAAACCCAGGCCAAGGCAGG - Intronic
1098498817 12:71166619-71166641 GGGATGGCCGAGGCCAAAGCCGG - Intronic
1100858806 12:98783002-98783024 GGGGCAGCCCAGGCGATAGTTGG + Intronic
1102239374 12:111314392-111314414 TGGGAGGCCGAGGCCAAGGCGGG + Intronic
1103561229 12:121794150-121794172 GGGGAAGCTGAGGCCAGAGGCGG - Exonic
1103599151 12:122043336-122043358 GGGGAAGGTCAGGCCAGTGCCGG + Intronic
1105344205 13:19559475-19559497 GGGGAAGCCCTGGCCACCCCAGG + Intergenic
1105442190 13:20424724-20424746 GGCCTAGCCCAGGGCAAAGCCGG + Intronic
1105535828 13:21262099-21262121 GGGGAAGCCCTGGCCACCCCAGG - Intergenic
1107864346 13:44688799-44688821 GGGGAGGCACATGCCCAAGCTGG - Intergenic
1109853600 13:68101242-68101264 GGAGAAGTCCAGAGCAAAGCAGG + Intergenic
1110133726 13:72039725-72039747 TGGGAAGCCAAGGTCAAAGCTGG + Intergenic
1110141448 13:72135004-72135026 AGGGAAGCATAGGCCAAAGATGG + Intergenic
1110540430 13:76701177-76701199 GGGGGAACCCAGGCTAAAACAGG - Intergenic
1114664553 14:24370018-24370040 CGGGGAGCCCAGGCCAAAGCGGG - Exonic
1114793340 14:25683643-25683665 GGAGAAGACCAGGCCTAAGTGGG + Intergenic
1116992650 14:51292274-51292296 GGGGAAGCACAAGCAAAAGGAGG - Intergenic
1117054511 14:51898052-51898074 TGAGAAGCCCAGGCCATAGATGG - Intronic
1118062779 14:62158904-62158926 TGGGCAGCCCAGCCCAAATCTGG + Intergenic
1118404809 14:65412745-65412767 GGGGAAGCCTCGGCCAGCGCCGG - Intronic
1119307614 14:73620428-73620450 AGGGAACACGAGGCCAAAGCTGG - Intergenic
1119386635 14:74261438-74261460 GTGGAAGCCCAGGCCCAGCCAGG - Exonic
1121446473 14:93982126-93982148 CGGGAAGCCCAGGACCAAGTAGG - Intergenic
1121568039 14:94925406-94925428 TGGGAAACCCAGGCCAGGGCAGG + Intergenic
1121819658 14:96956108-96956130 GGTGTAGCCCAGCCCACAGCTGG - Intergenic
1122891018 14:104732291-104732313 TGGGAATCCCAGGCTGAAGCTGG + Intronic
1123118430 14:105905262-105905284 GGTGAAGCCCAGGCCAGATGAGG + Intergenic
1123123896 14:105930694-105930716 GGGGAAGACAATTCCAAAGCTGG - Intronic
1123711414 15:22990372-22990394 TGGGGAACCCAGGCCAAGGCTGG + Intronic
1124179047 15:27456183-27456205 GTGACAGCCCAGGCCCAAGCAGG - Intronic
1124558475 15:30748867-30748889 GGTGAAGCCCATGTCACAGCTGG + Intronic
1124672778 15:31656763-31656785 GGTGAAGCCCATGTCACAGCTGG - Intronic
1124683604 15:31758866-31758888 GTTGAAGCCCAGGCTAAATCAGG - Intronic
1126311921 15:47327103-47327125 GGGGATGCCAAGGCCTGAGCAGG - Intronic
1126650041 15:50910900-50910922 TGGGAGGCCAAGGCCAAGGCAGG - Intronic
1127396848 15:58550061-58550083 GGGGAAACCAAGGCCTAGGCAGG + Intronic
1127641432 15:60919321-60919343 GGAGAAGCCCAGGGCCCAGCAGG + Intronic
1127930187 15:63590788-63590810 GTGGAACACCAGGCCAAAGCTGG + Exonic
1128807799 15:70545669-70545691 GGGGATACCCAAGCCATAGCTGG + Intergenic
1129228545 15:74183809-74183831 GGGGAGGCCCAGGCCAAGGCTGG + Intronic
1131979232 15:97979534-97979556 GGGGAAACCCTGGGCAAACCAGG - Intergenic
1132083234 15:98885078-98885100 AGGGACTTCCAGGCCAAAGCTGG - Intronic
1132092247 15:98956161-98956183 TGGGGAGCCCCGGCCACAGCCGG + Intronic
1132153456 15:99478380-99478402 GAGGAAGCCCAGGCCACATGGGG - Intergenic
1132210824 15:100020922-100020944 GGAGAAGCCCAGGAGGAAGCAGG - Intronic
1132225864 15:100140967-100140989 GCGGCTGCCCAGGCCAAATCAGG + Intronic
1132569527 16:637998-638020 AGGGAAGCCCAGGTGAAATCTGG - Intronic
1132844466 16:1993424-1993446 GGGGCTGCCCAGGACAAAGCGGG + Exonic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132945838 16:2531121-2531143 CGGGACGCCCAGTCCAGAGCTGG + Exonic
1133106137 16:3510913-3510935 GGGAAAGCCCAGGCTGGAGCTGG + Intronic
1133139220 16:3732021-3732043 CAGGAAGCTCAGGCCAAAGTAGG + Intronic
1134599691 16:15523644-15523666 GGGGAAGCCGAGGCTGAAACAGG - Intronic
1136573908 16:31112117-31112139 GGGCAACCCGAAGCCAAAGCTGG - Exonic
1137295548 16:47089376-47089398 GAGGAAGCCGAGGCCCAAGGAGG - Intronic
1137444362 16:48522802-48522824 GGGGAAGCTCAGCCTAGAGCTGG - Intergenic
1137731636 16:50694277-50694299 GGGGAAACCAAGGCCATGGCAGG - Intronic
1138583417 16:57956066-57956088 AGGGAGGCCCTGGCCACAGCTGG + Intronic
1138598818 16:58043270-58043292 GGGGATGCCCAGGCCATAGCTGG - Exonic
1139492291 16:67292769-67292791 GGAGAAGCCCAGGAGACAGCAGG - Intronic
1141422414 16:83925636-83925658 GGGGAGGGTCAGGCCACAGCAGG - Exonic
1141541529 16:84726575-84726597 GGGCAAGCCCACACCACAGCAGG - Intronic
1141762599 16:86038642-86038664 AGGGAAGCCCAGGCCAATGCGGG - Intergenic
1141942785 16:87289487-87289509 GGGAAAGCCCAGGGCATGGCGGG + Intronic
1142161603 16:88560647-88560669 GGGGATGGCCAAGCCACAGCTGG + Intergenic
1142176553 16:88647992-88648014 GGGAACGCCCAGGGCAGAGCTGG - Intronic
1143114923 17:4576907-4576929 TGGGGAGGCCAGGCCAAGGCAGG - Intergenic
1143491948 17:7289935-7289957 GGGGAAGACCAAGCCCCAGCAGG + Intronic
1143709563 17:8725017-8725039 GGGGAACCTCAGGCCATTGCAGG + Intergenic
1143885643 17:10062938-10062960 GGGGCAGCCCAGGGGAAGGCAGG + Intronic
1144585247 17:16483642-16483664 GGGGAAACTGAGGCCAAAGAAGG + Intronic
1145252310 17:21303276-21303298 GAGGGATCCCAGGCCAAGGCGGG + Intronic
1145888657 17:28399566-28399588 CTGGAAGCCCAGCCCACAGCAGG - Exonic
1145928347 17:28664975-28664997 GTGGTAGCCCAGGCAAAAGATGG - Intronic
1147161683 17:38572537-38572559 GGGGACGTCCAGGCCATTGCAGG - Intronic
1147339144 17:39743510-39743532 GGAGAAGCACTGGCCAATGCTGG - Intronic
1147674000 17:42192619-42192641 GGGTATTCCCAGGCCAAGGCAGG + Exonic
1150281400 17:63931423-63931445 GGGGCAGCCCAGGCCAGAGGAGG - Intronic
1150639021 17:66937261-66937283 GGGGAAGAGAAGGCCACAGCTGG - Intergenic
1151274559 17:73024131-73024153 GGGCAGCCCCAGGCCAAAGAAGG - Intronic
1151559511 17:74862855-74862877 GGGGAAGCCCAGGGAGAAGCTGG - Exonic
1152128270 17:78460469-78460491 GGGGCGGCCCAGGCCCCAGCAGG + Intronic
1152236355 17:79141059-79141081 GGGGAAGCCCAGGGCCCAGCAGG + Intronic
1152867702 17:82734329-82734351 AGGGAAGCTCAGGCCACACCAGG + Intergenic
1153233135 18:2959920-2959942 TGGGAGGCCGAGGCCGAAGCCGG + Intronic
1154018653 18:10643489-10643511 GGGCAAGCTCAGACCAAAGAAGG + Intergenic
1154185575 18:12179933-12179955 GGGCAAGCTCAGACCAAAGAAGG - Intergenic
1156450281 18:37262792-37262814 GGGGAAGGCAAGGGCAAGGCAGG + Intronic
1157671966 18:49538328-49538350 GGGGAACACCAGGCCAAAAGAGG - Intergenic
1159535913 18:69714386-69714408 CAGGAGGCCCAGGACAAAGCAGG - Intronic
1159985538 18:74836529-74836551 GGCAAAGCCCAGGCCAGATCTGG - Intronic
1160346930 18:78139741-78139763 GGGGAGTACCAGGACAAAGCGGG - Intergenic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1161298799 19:3532936-3532958 GGGGAGGCCCAGGATGAAGCGGG + Intronic
1161353642 19:3807080-3807102 GGGGAAACCCAGGCCATTTCGGG + Intronic
1161601547 19:5187167-5187189 TGGGAGGCCAAGGCCAAGGCAGG - Intronic
1161798955 19:6404674-6404696 GGGGAAACCAAGGCCCAAGGAGG + Intergenic
1162117824 19:8442217-8442239 GGGGCACCACAGGCCAAAGTTGG - Intronic
1162474861 19:10893847-10893869 GAGGAAGCCAAGGCCAGGGCTGG + Intronic
1163639246 19:18452044-18452066 CTGGAAGCCCAGGTCACAGCAGG + Intronic
1163662821 19:18588899-18588921 GGGTGAGCCCAGGCCCAAGCGGG + Exonic
1163815203 19:19460847-19460869 GGGGAAGCACTGGCCCAGGCCGG - Intronic
1163845962 19:19638154-19638176 GAGGAGGCCCAGGCCAAGGTGGG - Exonic
1164474777 19:28567278-28567300 GGGGATGCCCTGGCTATAGCAGG + Intergenic
1165079775 19:33300688-33300710 GGGGAAGCCCAGCCTATAGCAGG + Exonic
1165347359 19:35257310-35257332 GGAGAAGCCCAGCCCACAGGGGG + Intronic
1165363711 19:35351592-35351614 CGGGAAGCCCAGCGCAAAGGCGG - Exonic
1165770865 19:38379424-38379446 GGGGAGGACCTGGCCAAAGTGGG + Intronic
1166293120 19:41876042-41876064 GGGGAAACCGAGGCCAGAGAGGG - Intergenic
1166771314 19:45284566-45284588 TGGGAAGCCAAAGCCAAAGCAGG - Intronic
1166978831 19:46621012-46621034 GGGGAATCCAGGGCCAGAGCAGG + Exonic
1167455047 19:49593458-49593480 GGGGAGGGCCAGCCCAAAGCGGG - Intronic
1168077383 19:53988731-53988753 GGGGAAGCCCAGGGCCAGGAGGG + Exonic
926612248 2:14958220-14958242 GGAGAAGCCCAGGTGAGAGCAGG + Intergenic
927216012 2:20668098-20668120 GGGGAAGCCCAGGGAAAACTAGG + Intronic
927692711 2:25219608-25219630 GGGGAAGCACAGGCAGGAGCTGG - Intergenic
927813142 2:26191496-26191518 CGGGAAGCCAAGCCCAAAGACGG + Exonic
928083960 2:28334147-28334169 GGGAAAGCCCAGGACAGAACAGG + Intronic
928593230 2:32838145-32838167 GGGACAGCCCAGGCCAATGGGGG + Intergenic
928988235 2:37201996-37202018 GGGAAACCACAGGCCAAGGCAGG - Exonic
930102044 2:47610854-47610876 GAGGAAGCCCAGGCCACATGGGG - Intergenic
931721185 2:65068916-65068938 GGGCATGCCCAGGCCTCAGCTGG - Intronic
932302757 2:70678677-70678699 GGGGGAGCCCAGGACAGACCCGG - Intronic
934573343 2:95385360-95385382 GGAGAATGCCAGCCCAAAGCTGG + Exonic
935140903 2:100352028-100352050 GGGGAATCCCGGGCGAAAGAAGG + Intergenic
935397629 2:102624599-102624621 GGGGAACCCCAGGACAAAGAAGG - Intronic
935983975 2:108654546-108654568 GTGGAAGCCCAGGTCCAGGCAGG + Intronic
936136410 2:109898199-109898221 GTGGAAGCCCAGGTCCAGGCAGG + Intergenic
936208287 2:110473286-110473308 GTGGAAGCCCAGGTCCAGGCAGG - Intergenic
937069971 2:119055754-119055776 GAGGAAGCCCAGGCCACAGGTGG - Intergenic
937466753 2:122139650-122139672 GAGGCAGCCCAGCCCAAAACAGG - Intergenic
937855631 2:126670461-126670483 GGGGAAGCAGAGGCCAAAGGGGG - Intronic
939351310 2:141041517-141041539 GGGGGAGGCCAGGACAAAGGAGG - Intronic
942108922 2:172660702-172660724 GGGGCAGCCCTGGTCGAAGCAGG + Intergenic
942451172 2:176108620-176108642 GGGGAAGCAGAGGGCAAGGCAGG - Intronic
945673838 2:212832537-212832559 GGGGAAGCCCCGGCCATCCCTGG - Intergenic
947037500 2:225875921-225875943 GGGAAAGTCCATGCCAAACCTGG - Intergenic
947945483 2:234098169-234098191 GGGGAGGCACAGGCTAGAGCAGG - Intergenic
948677265 2:239604103-239604125 GGGGAAGCCCAGGGAGAAACCGG + Intergenic
948797782 2:240413458-240413480 GGGGAGGGCAAGGCCAGAGCCGG - Intergenic
948871077 2:240798508-240798530 GGTAAAGGCCAGGCCGAAGCTGG - Intronic
1169284360 20:4295512-4295534 GGGGAAGCCCAGGGCCAGGAAGG - Intergenic
1170244840 20:14209160-14209182 TGGGAAGCCCAGGCCAATTGTGG - Intronic
1170774815 20:19366009-19366031 AGGGAAGCCCCTGCCAAACCTGG - Intronic
1170821598 20:19759060-19759082 GTGGGAGCCCAGGCCAAGGGTGG - Intergenic
1171091505 20:22289849-22289871 GGGGAAGCACAGGCAAAGGTTGG - Intergenic
1172936500 20:38624261-38624283 GAGGAAGCCCAGGCCACATGTGG - Intronic
1173418616 20:42880613-42880635 GTGGAAACCCATGCCAAAGATGG + Intronic
1173848173 20:46201107-46201129 GGGGAAGCGGAGGCCGGAGCTGG - Intronic
1174254940 20:49247540-49247562 TGAGATGCCCAGGCCAGAGCAGG + Exonic
1174390857 20:50217557-50217579 GGGGAAGCCCAGGGCTCAGTAGG - Intergenic
1174722393 20:52827002-52827024 TGTGTAGCCCATGCCAAAGCAGG + Intergenic
1175164128 20:57031110-57031132 GGGGAAGCTGAGGCCCAAGGAGG - Intergenic
1175265345 20:57699777-57699799 GGGGGAACCCGGGGCAAAGCTGG + Intronic
1175323127 20:58103390-58103412 TGGCAAGCCCAGGCAGAAGCAGG - Intergenic
1175519562 20:59591389-59591411 GTGGAGGCCAAGGCCAGAGCTGG - Intronic
1175940584 20:62535873-62535895 GGGGAGGCCCAGGCCCAGGGCGG + Intergenic
1176221220 20:63970052-63970074 GGGGAACCACAGGCCAGCGCCGG - Intronic
1176376125 21:6087648-6087670 GGGGAGACCCAGGCCCAGGCAGG - Intergenic
1178029598 21:28509079-28509101 GGGCCAGCCTGGGCCAAAGCAGG - Intergenic
1178531961 21:33383206-33383228 GGGAAAGCCCAGGGTAAACCAGG - Intergenic
1178834840 21:36088085-36088107 GGGGAAGGCCAGGCCCAGCCAGG - Intergenic
1179747350 21:43450596-43450618 GGGGAGACCCAGGCCCAGGCAGG + Intergenic
1181530564 22:23514727-23514749 GGAGAAGCTGAGGCCCAAGCAGG + Intergenic
1181669483 22:24419500-24419522 GGGGAAGGACAGGCCATCGCAGG + Intronic
1181782489 22:25203164-25203186 GGGGAAACTGAGGCCAAAGTTGG + Intronic
1182299996 22:29331898-29331920 GGCGGGGGCCAGGCCAAAGCTGG + Exonic
1182429410 22:30291128-30291150 GGGCCAGGCCAGGCCATAGCGGG - Intronic
1182736444 22:32534625-32534647 GGGGAAGCTAAGTGCAAAGCTGG - Intronic
1183292662 22:37012376-37012398 GGGAAAGCCATGGCCAGAGCTGG + Intronic
1183475929 22:38035746-38035768 GGGGAAGCCCTGGCGGGAGCGGG + Intronic
1183568351 22:38632894-38632916 GTGGGAACCCAGGCCACAGCTGG + Intronic
1184200696 22:42967253-42967275 GAGGAAGCCCCAGCCAAAGAGGG - Intronic
1184878721 22:47291726-47291748 GGGGAAGCCAGGGCCTAAGCTGG + Intergenic
1184931009 22:47681419-47681441 GAGGAAGCCCAGCTCAGAGCAGG - Intergenic
1184935387 22:47716832-47716854 GGGCACGCCCAGGCCACAGGAGG - Intergenic
1185245654 22:49771526-49771548 GGGGAAGCGCTCGCCAAAGCCGG - Intergenic
950034240 3:9873369-9873391 TGGGAGGCCAAGGCCAAGGCAGG + Intronic
950250920 3:11464544-11464566 TGGAAAGCCCAGGCCTCAGCTGG - Intronic
950312306 3:11969282-11969304 TGGGAGGCCAAGGCCAAGGCGGG - Intergenic
950526709 3:13528709-13528731 GGAGAAGCCCAGGCCACAAGGGG - Intergenic
950672881 3:14537744-14537766 TGGGTAGCCCAGGGCACAGCAGG + Intronic
950813202 3:15670526-15670548 TTGGGAGCACAGGCCAAAGCTGG + Exonic
951476135 3:23108268-23108290 GAGGAAGCCCAAGCCACAGAAGG + Intergenic
951607186 3:24448901-24448923 AGAGAAGCCCATGCAAAAGCAGG + Intronic
954150928 3:48656649-48656671 GGGGAAGCACGGGCCAAGGCTGG - Intronic
955823298 3:62919470-62919492 GGGGTAGCTCAGGCAAAAGATGG + Intergenic
955950471 3:64238075-64238097 GGGGAGGACCAGACCAAAGCAGG + Intronic
956195687 3:66651520-66651542 GGGCTGGCCAAGGCCAAAGCCGG + Intergenic
956283549 3:67584797-67584819 GGGGAAGTGCCGGGCAAAGCAGG + Intronic
956663467 3:71620853-71620875 CGGGAAGCACTGGCCAAAGGAGG + Intergenic
959227771 3:103607696-103607718 GGAGAAGTGCTGGCCAAAGCGGG - Intergenic
961058830 3:123811283-123811305 GGGGAAGTACAGGCAAATGCAGG + Intronic
961234229 3:125350409-125350431 GGGGAGGCCGAGGCCAAGGCAGG - Intronic
961501184 3:127337200-127337222 GGGTAAGCCCAGGCCCAACTCGG - Intergenic
961562438 3:127740034-127740056 GGGGAAGCCCTGGCCTCAGCAGG + Intronic
962318538 3:134373576-134373598 GCAGGAGCCCAGGCCAAGGCTGG - Intronic
962710258 3:138080336-138080358 GGGGAAGCCCAGGCCTAGAGAGG - Intronic
967042010 3:185702627-185702649 GGGGAGGTGCAGGCCAAAGATGG - Intronic
968181676 3:196599528-196599550 GTGGAAGCCCAGGCAGAGGCGGG + Intergenic
968830745 4:2931993-2932015 GGGGAAGCCCAGGGGAGAGCAGG + Intronic
968935474 4:3607932-3607954 GGGCAGGCCCAGGGCAGAGCTGG + Intergenic
969281298 4:6172450-6172472 GAAGAAACCCAGGCCAGAGCTGG - Intronic
970094154 4:12443631-12443653 GGGGCAGCCCAGGTAAAAGGAGG - Intergenic
971893828 4:32563421-32563443 ATGGAAGTCCAGGCCACAGCAGG - Intergenic
973203627 4:47534162-47534184 GGGGAAGCCCAACCCAAGGAGGG - Intronic
976235351 4:82891015-82891037 GGTAGAGCCCAGGCCAAAACTGG - Intronic
976562143 4:86513973-86513995 TGGGAAGACCAGACCAAACCAGG + Intronic
979603003 4:122606651-122606673 GTGGAAGGCAAAGCCAAAGCAGG - Intergenic
980177539 4:129365086-129365108 GGGGAAGCCCAGGCTGATTCTGG - Intergenic
982380090 4:154740690-154740712 GGGGAAGCGGTGGCCAAAGTGGG + Intronic
983026043 4:162739490-162739512 GGGCAGGCCAAGGCCAGAGCCGG + Intergenic
983060287 4:163152795-163152817 GGGCAGGCCAAGGCCAGAGCCGG + Intronic
983064138 4:163190116-163190138 GGGCAGGCCAAGGCCAGAGCCGG - Intergenic
983922581 4:173362164-173362186 TGGGAAGCCTAGGCCAAAAGTGG + Intergenic
985954326 5:3252012-3252034 GGAGAGCCCCGGGCCAAAGCAGG - Intergenic
987710236 5:21495213-21495235 GGACAAGCCCAGGCAAAGGCAGG - Intergenic
988749377 5:34178960-34178982 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
990792210 5:59495039-59495061 GGGGAAGTCAAGGCCAAACTGGG - Intronic
991194777 5:63920127-63920149 GAGGAAGCCCAGGCCATTGCTGG + Intergenic
991737632 5:69642152-69642174 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
991760562 5:69914273-69914295 GGACAAGCCCAGGCAAAGGCAGG - Intergenic
991786770 5:70203828-70203850 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
991789208 5:70221878-70221900 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
991813959 5:70496984-70497006 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
991817090 5:70518268-70518290 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
991839793 5:70789323-70789345 GGACAAGCCCAGGCAAAGGCAGG - Intergenic
991879216 5:71204213-71204235 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
991881656 5:71222242-71222264 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
992098472 5:73382780-73382802 CAGGAAGCCCAGGGCAAAGTAGG - Intergenic
994460182 5:100062222-100062244 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
994484330 5:100375647-100375669 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
994705049 5:103193854-103193876 GGGCAAGGACAGGCCAAAGTAGG - Intronic
994841334 5:104928941-104928963 GGGCTGGCCCAGGCCAGAGCCGG + Intergenic
1000512447 5:162200151-162200173 GGGAAAGCCAAGGCCAGAGGAGG - Intergenic
1000902535 5:166927357-166927379 GGGCTAGCCGAGGCCAGAGCCGG - Intergenic
1001215472 5:169852012-169852034 GGGGAAGCTGGTGCCAAAGCTGG + Intronic
1001250595 5:170143957-170143979 AGGTAAGCCCAGACCAAGGCTGG + Intergenic
1001317587 5:170655360-170655382 GTGGAAGCCAAGGCCAAGGAAGG + Intronic
1001603834 5:172946182-172946204 AGGGGAGTCCAGGACAAAGCTGG - Intronic
1002533581 5:179863866-179863888 GGAGACCCCCAAGCCAAAGCAGG - Exonic
1003498306 6:6683453-6683475 GGGGAAACCCAGGCTGAGGCAGG - Intergenic
1004045404 6:12018297-12018319 GGGATGGCCCAGGCCAGAGCCGG - Intronic
1004262108 6:14117637-14117659 GGGGGCGCCCCGGCCTAAGCGGG + Exonic
1004499728 6:16198500-16198522 GGGATAGCCGAGGCCAGAGCCGG - Intergenic
1004606558 6:17200560-17200582 GGGCTGGCCGAGGCCAAAGCCGG + Intergenic
1004689145 6:17976598-17976620 GGGCTAGCCGAGGCCAGAGCCGG - Intronic
1004899482 6:20181233-20181255 GAGGAAGCCCAGGCCACCTCTGG + Intronic
1004926127 6:20416729-20416751 GGGGAAACCCAGGCCGTAACTGG + Intronic
1005547451 6:26885306-26885328 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
1005798266 6:29391119-29391141 GGGGATCCCCAGGCCACAGATGG + Intronic
1007370354 6:41422714-41422736 GGGAAAGCCAAGGCCAAACCTGG - Intergenic
1007679010 6:43621621-43621643 GGAGAAGCCCAGGCCAACATGGG - Exonic
1009018213 6:57926373-57926395 GGACAAGCCCAGGCAAAGGCAGG + Intergenic
1009470230 6:64023726-64023748 GGGCAGGCCAAGGCCAGAGCCGG + Intronic
1009482390 6:64175656-64175678 GGGGAAGCCCAGGGAATAGTAGG + Intronic
1009871440 6:69457323-69457345 GGGAAATCCAAGGCCAAGGCAGG - Intergenic
1010389923 6:75325173-75325195 TGGGAGGCCGAGGCCAAGGCAGG + Intronic
1011194947 6:84771953-84771975 GGGGGAGCCCTGGGCAAAGCAGG - Intergenic
1014738943 6:125125803-125125825 GGGCTGGCCCAGGCCAGAGCTGG + Intronic
1015127890 6:129774690-129774712 TGGGTTGCCCAGGCCAGAGCTGG + Intergenic
1015518803 6:134111565-134111587 TGGGAAGCTGAGGCCAAGGCAGG - Intergenic
1015572306 6:134633955-134633977 GGGCTAGCCGAGGCCAGAGCCGG - Intergenic
1018298208 6:162372043-162372065 CTGGAAGCCCAGGAGAAAGCTGG + Intronic
1019142893 6:169959483-169959505 GGGGAAGCCGAGGGCAGGGCTGG - Intergenic
1019210112 6:170397973-170397995 GGGCAACCCCAAGCCAAAGAGGG - Intronic
1019703759 7:2487855-2487877 GGAGGAGCCCAGCCCAGAGCTGG + Intergenic
1019707898 7:2505108-2505130 GGGCAGGCCCAGGCCCCAGCTGG - Intergenic
1019777265 7:2919252-2919274 AGAGAAGCCCAGGCCAAAGAAGG - Intronic
1020139240 7:5603706-5603728 GGGGATGCCCAGCACAGAGCAGG - Intronic
1021122725 7:16815252-16815274 GGGCAAGCCCAGGCCAAGTCAGG + Intronic
1021540203 7:21748831-21748853 GGGGAGGCCTTGGCCAAATCTGG - Intronic
1022529989 7:31061071-31061093 GGGGCAGCCCAGTCCTAACCGGG + Intronic
1022721066 7:32942567-32942589 GGCGACGCCCACACCAAAGCGGG + Intergenic
1023071588 7:36440178-36440200 GGGGAAGCCCAGGGCAAGTGAGG + Intronic
1023221108 7:37920893-37920915 GGGCAAGCCCAAGCCCAAGGGGG - Exonic
1023541748 7:41273525-41273547 GGCAAAGCCAAGGCCAGAGCAGG + Intergenic
1024250968 7:47505433-47505455 GGGGAAGCCCTCTCCAGAGCAGG + Intronic
1024471688 7:49773531-49773553 GGGGCAGCGCGGGCCAAGGCGGG + Intergenic
1025927290 7:65970229-65970251 GGACAAGCCCAGGCAAAGGCAGG + Intronic
1026046738 7:66910946-66910968 GAGGAAGTCCAGCCCACAGCTGG - Intergenic
1026180019 7:68030721-68030743 GGGGAAGCCCAGACCACATGAGG - Intergenic
1026893558 7:73997166-73997188 GGGAGAGCCCAGGCCAGAGTTGG + Intergenic
1029279130 7:99425417-99425439 AGGACAGCCCAGGCCAAGGCAGG - Exonic
1029422229 7:100477625-100477647 GGGGGCGCCCAGGCCGAGGCTGG + Exonic
1031521502 7:122771678-122771700 GGGGGATCCCAAGCCAAAGAGGG + Intronic
1031662148 7:124438604-124438626 GGGGAAACCCATGCCAGAGTTGG - Intergenic
1032541090 7:132703817-132703839 GGACAGGTCCAGGCCAAAGCAGG - Intronic
1035590051 8:805762-805784 TGGGAGGCCGAGGCCAAGGCCGG - Intergenic
1037616163 8:20520567-20520589 GGGGAAGCACAGGCTGATGCTGG - Intergenic
1038423985 8:27452833-27452855 CAGGAAGCCCAAGCCAGAGCTGG + Intronic
1039340779 8:36647507-36647529 GGAGAAGCCCAGGAAGAAGCAGG + Intergenic
1040275400 8:46011268-46011290 GGGGAAGGCCATGGCAAATCAGG - Intergenic
1040583467 8:48716396-48716418 GGGCAGGCCTAGGCCAGAGCCGG - Intronic
1040840756 8:51781890-51781912 GGAGCAGCCTTGGCCAAAGCTGG - Intronic
1040847401 8:51858251-51858273 GGGGGAGTCCCGGCCAAAGCAGG - Intronic
1042020689 8:64369822-64369844 GGAGCGGCCCAGGCCCAAGCAGG - Intergenic
1042599170 8:70481057-70481079 GGAGCAGCCCTGGCCACAGCTGG - Intergenic
1044821705 8:96159828-96159850 TGGAAAGCCCTGGGCAAAGCCGG - Intronic
1047594724 8:126366569-126366591 GGGAAAGGCCAGAGCAAAGCAGG - Intergenic
1049291470 8:141805187-141805209 GTGGAAGCCCAGGCACAGGCTGG - Intergenic
1049684094 8:143932335-143932357 GGGGACGGCCAGGGCACAGCTGG + Intronic
1051880200 9:21832239-21832261 GGGGAAGCCCAAGGCAGGGCTGG - Intronic
1053283916 9:36838543-36838565 GGGGAAGGCCAGGACCATGCAGG - Exonic
1054454707 9:65423924-65423946 GGGCAGGCCCAGGGCAGAGCTGG - Intergenic
1055008528 9:71537045-71537067 TGGGAAGTCTAAGCCAAAGCTGG + Intergenic
1056577503 9:87867741-87867763 TGGGAAGCCCAAGCCACAGAGGG - Intergenic
1056631981 9:88301483-88301505 GGGGAGGCCCTGGACACAGCTGG - Intergenic
1057025716 9:91732828-91732850 GGGAAATCCCAGGCTCAAGCAGG + Intronic
1057190715 9:93085840-93085862 GAGGAAGCCCAGGCCACATGAGG - Intergenic
1057551452 9:96053820-96053842 CAGGAACCCCAGGCCACAGCAGG + Intergenic
1057559580 9:96116754-96116776 GGGCAAGCCCAGGCCCCAGCTGG + Intergenic
1059290871 9:113222321-113222343 AGGGAAACCCACGCCAAAGTTGG - Intronic
1059365322 9:113782259-113782281 GGGCAAGCTCTGGCCAGAGCAGG - Intergenic
1060829431 9:126704422-126704444 GGGGAAACTCATGCCAAAGGGGG - Intergenic
1061249790 9:129420099-129420121 GGAGAAGCTGAGGCCCAAGCAGG - Intergenic
1061620286 9:131807367-131807389 CGGGAACCCCAGGGCAAGGCTGG - Intergenic
1061773965 9:132948379-132948401 TTGGAAGGCCAGGGCAAAGCTGG - Intronic
1061925208 9:133802885-133802907 GGGGAAACGGAGGCCAGAGCTGG - Intronic
1062274521 9:135724381-135724403 AGGGAAGCACAGGCCAACGGGGG + Intronic
1062325923 9:136012461-136012483 GCAGGAGCCCAGGCCAAGGCCGG + Intronic
1062337541 9:136078886-136078908 GGGGAAGCCAAGGCAAACTCAGG + Intronic
1062437991 9:136555316-136555338 GGGGCGGCCCAGGGCACAGCTGG - Intergenic
1187377053 X:18764475-18764497 GAGGAAGCCCAGGCCTATGGAGG + Intronic
1187459857 X:19477461-19477483 TGGGAGGCCAAGGCCAAGGCAGG + Intronic
1188347709 X:29087790-29087812 TGGGAGGCCAAGGCCAAGGCAGG + Intronic
1188445260 X:30248205-30248227 TGGGAGTCCCAGGCCAGAGCTGG + Intronic
1188653664 X:32664096-32664118 AGGTAAGGCAAGGCCAAAGCAGG + Intronic
1194117500 X:89921169-89921191 TGGGAGGCCGAGGCCAAGGCGGG + Intergenic
1194867441 X:99086212-99086234 TGGGAAGCCCAAGCCAAACAGGG + Intergenic
1198636852 X:138711121-138711143 GGAGAAGCCCGGGCAAACGCAGG - Exonic
1200047088 X:153408920-153408942 GGGGAAGGCCAGGCCAAAGGGGG - Intergenic
1200089050 X:153625877-153625899 GGAAAAGACCAGGCCAAAGGGGG + Intergenic