ID: 900290067

View in Genome Browser
Species Human (GRCh38)
Location 1:1920031-1920053
Sequence CCTGCGCTGCAGGCGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900290059_900290067 26 Left 900290059 1:1919982-1920004 CCAAGATGCTGGGCATCCCGAAC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 900290067 1:1920031-1920053 CCTGCGCTGCAGGCGCTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 160
900290062_900290067 10 Left 900290062 1:1919998-1920020 CCCGAACTTGGTGTTTGGACACT 0: 1
1: 0
2: 1
3: 11
4: 105
Right 900290067 1:1920031-1920053 CCTGCGCTGCAGGCGCTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 160
900290063_900290067 9 Left 900290063 1:1919999-1920021 CCGAACTTGGTGTTTGGACACTT 0: 1
1: 0
2: 1
3: 8
4: 106
Right 900290067 1:1920031-1920053 CCTGCGCTGCAGGCGCTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 160
900290058_900290067 29 Left 900290058 1:1919979-1920001 CCACCAAGATGCTGGGCATCCCG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 900290067 1:1920031-1920053 CCTGCGCTGCAGGCGCTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900290067 Original CRISPR CCTGCGCTGCAGGCGCTGTC TGG Intergenic
900290067 1:1920031-1920053 CCTGCGCTGCAGGCGCTGTCTGG + Intergenic
900329332 1:2126312-2126334 CCTGGGCTGCAGGGGCTGCCCGG + Intronic
900367669 1:2317876-2317898 CCTGCGCTGAGGGCGCGGGCCGG - Intergenic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
901039861 1:6357399-6357421 CCTGCCCTGCAGGCCCCGTGTGG - Intronic
902246515 1:15124474-15124496 CCTGCGCCCCAGGCGCGGCCCGG + Intergenic
902879622 1:19362734-19362756 CCTGTGCTGCCCGTGCTGTCTGG - Intronic
904587220 1:31587067-31587089 CCTGCGCCCCGGGCTCTGTCGGG - Exonic
905619251 1:39428035-39428057 CCTGTTCTGCAGGAGATGTCAGG - Exonic
906090083 1:43171825-43171847 GATGCGCTTCAGGCGCTGTTGGG - Intronic
907258337 1:53197035-53197057 GCTGCGCTGCAGGTACTGGCCGG - Exonic
909806185 1:79876089-79876111 CCTGAGCTGGAGGCCCTGCCTGG - Intergenic
1063139265 10:3242065-3242087 CCTGCTCTGCAAGCCATGTCTGG + Intergenic
1064154966 10:12896467-12896489 CCTGCTCTGCTGGCCCTGTCTGG - Intergenic
1065337491 10:24668503-24668525 CCTGAGCTGCATGAGCTGCCGGG + Intronic
1065740159 10:28790375-28790397 TCTGCTCGGCAGCCGCTGTCTGG - Intergenic
1066312046 10:34206580-34206602 TCTGCTCTGCAGGAGCAGTCAGG - Intronic
1067079660 10:43205855-43205877 CCTGGGCTCCAGGAGATGTCGGG - Intronic
1067435404 10:46273164-46273186 CCTGGGGTGCAGGGGCTGGCAGG - Intergenic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1067831760 10:49614600-49614622 CCTGCGCAGCAGCGGCCGTCGGG + Intronic
1069941939 10:71962606-71962628 CCTGTCCTGCAGGCCTTGTCTGG + Intergenic
1071023159 10:81082682-81082704 CCTGAGCTGGAGGCCCTGCCTGG + Intergenic
1071298183 10:84237602-84237624 CGTCCGCTCCAGGCGCAGTCTGG + Exonic
1072294209 10:93993910-93993932 CCCGCGCAGCCGCCGCTGTCCGG + Intergenic
1075674942 10:124289819-124289841 CCTGCGCTGCTGACCCTGCCTGG - Intergenic
1075924851 10:126243073-126243095 GCTGCTCTGCACGCGCTGACAGG - Intronic
1076279131 10:129230358-129230380 CCATCGCTGCAGCCGCGGTCCGG + Intergenic
1076322409 10:129593220-129593242 CCTGCGCAGTGGGCGCTGTTGGG + Intronic
1076795685 10:132797123-132797145 CCTGCGCTGCTGGCCCGGTGTGG - Intergenic
1077289866 11:1784013-1784035 CCTGTGCTGCAGGCTCTTGCTGG + Intergenic
1078022307 11:7666024-7666046 TCTGGGCTGCAGCAGCTGTCTGG + Intronic
1078411146 11:11119960-11119982 CCTTCTCTTCAGGCTCTGTCAGG - Intergenic
1084000366 11:66292455-66292477 GCTGCATTGCAGGCGCTGCCCGG - Intronic
1085444061 11:76589134-76589156 CCTGCCCTGCAGCCACTGCCAGG - Intergenic
1086697622 11:89863929-89863951 GCTCCGCTGCAGGCGCTGCAGGG + Intergenic
1086708537 11:89980559-89980581 GCTCCGCTGCAGGCGCTGCAGGG - Intergenic
1089046355 11:115504470-115504492 CATGCGCTGGAGGCGGAGTCCGG + Intronic
1091201928 11:133787763-133787785 CCCGGGCTGCAGGAGCTGTGCGG - Intergenic
1091797126 12:3303834-3303856 ACTGCCTTGCAGCCGCTGTCGGG + Intergenic
1092154757 12:6274850-6274872 CCTGCTCTGCAGCCCCTCTCAGG + Intergenic
1096675042 12:53221694-53221716 TCGCCGCTGCTGGCGCTGTCCGG - Intronic
1096775566 12:53961491-53961513 CCAGAGCTGCCGGCGCTGTCGGG - Intergenic
1099115918 12:78623913-78623935 CCTGCTCTGCAGGAGCAGTCAGG - Intergenic
1100407333 12:94283121-94283143 CCAGGGCTGCAGGCTCTGTGAGG - Intronic
1102394758 12:112576031-112576053 ACTACGCACCAGGCGCTGTCTGG + Intronic
1107355015 13:39557422-39557444 GCTGTGCAGCAGGCTCTGTCTGG - Intronic
1108773919 13:53739988-53740010 CCTGCTCTGGAGGAGCAGTCAGG + Intergenic
1108818490 13:54317985-54318007 CCAGCCCAGCAGGCGCTGGCTGG - Intergenic
1111859372 13:93682426-93682448 GCTGCCCTGAAGGTGCTGTCAGG + Intronic
1113149131 13:107242378-107242400 AGTGCCCAGCAGGCGCTGTCAGG + Intronic
1113752183 13:112784113-112784135 CCCGCTCTGCAGGGGCAGTCAGG - Intronic
1114664236 14:24368817-24368839 CCGGGGCTGGGGGCGCTGTCAGG + Intronic
1117377624 14:55129960-55129982 GCCGGGCTGCAGCCGCTGTCTGG + Intronic
1119438232 14:74611743-74611765 CCTTGGCTGCAGCCGCTGCCGGG + Exonic
1121183455 14:91947110-91947132 GCTGCGATTCAGGCGGTGTCAGG - Intronic
1130317683 15:82810144-82810166 GCGGCGCTGCAGGAGCTGTGCGG + Exonic
1131035843 15:89221601-89221623 CCTCCGCTGGAGGCGTGGTCCGG + Exonic
1132626301 16:893179-893201 TCTGGGCTGCAGGCGCTGTGAGG + Intronic
1132744909 16:1432543-1432565 CCGGGGCAGCAGGCGCTGGCTGG - Intergenic
1132758788 16:1499013-1499035 GCTGCGGTGCACGCGCTCTCTGG + Intronic
1133065279 16:3201983-3202005 CCTCCTCTGCAGGAGCAGTCAGG + Intergenic
1135134694 16:19878942-19878964 CCAGTGCTGCAGGCGATGTGGGG + Intronic
1135284048 16:21178229-21178251 CCTGAGCTGCAGGCCCTGGAAGG - Intronic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1138125805 16:54437592-54437614 GCTGCGCTGCAGAGGCTGTGGGG + Intergenic
1139576704 16:67846774-67846796 CCCGCGCTGCGGGCCGTGTCTGG + Exonic
1141203178 16:81913074-81913096 CCTGGGCTGCCTGGGCTGTCTGG - Intronic
1141448525 16:84080496-84080518 CCTGAGCTGCTGGCCCTGTGGGG - Intronic
1142510553 17:389977-389999 CCTGCAGTGCAGGTGCTGGCAGG - Intergenic
1150791703 17:68205039-68205061 CCTCCGTCGCTGGCGCTGTCCGG + Intergenic
1152270168 17:79319855-79319877 CCTGGGCTGCTGGTCCTGTCTGG + Intronic
1152270193 17:79319983-79320005 CCTGGGCTGCTGGTCCTGTCTGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153856348 18:9151701-9151723 ACTGAGCTGCAGCCGCTTTCAGG - Intronic
1153950847 18:10056575-10056597 CCTGAGCAGCAGGCGCTGTTAGG - Intergenic
1157142770 18:45127473-45127495 CCTGAGCAGCAGCAGCTGTCAGG + Intergenic
1157417729 18:47520178-47520200 CCTGCTTTGTAGGCACTGTCTGG + Intergenic
1160249218 18:77186387-77186409 CCCGCTGTGCACGCGCTGTCAGG + Intergenic
1160270143 18:77376235-77376257 CCTGGGCTGCAAGCGCTGCTCGG + Intergenic
1160947807 19:1651822-1651844 CGCGCGCTGCAGGCGCTGGTCGG - Intronic
1160973065 19:1778491-1778513 CCTGGGCTTCAGGCACTGGCCGG + Exonic
1162019848 19:7863388-7863410 CCGGCGCTGCAGGCGTGGACCGG - Intronic
1163058880 19:14743726-14743748 CCTGGGCTGCACGTGGTGTCTGG - Exonic
1163521745 19:17795649-17795671 CCGGTGCTGCAGGCCCTGCCAGG + Intronic
1166354721 19:42220249-42220271 CCTGCGCTGCAGGCTCTGATTGG + Exonic
1166685189 19:44792481-44792503 CCTGCTCTGCAGCTGCTGCCTGG + Exonic
1166747209 19:45147006-45147028 CCTGCCCGGCCTGCGCTGTCTGG - Exonic
926118074 2:10225759-10225781 CCTCCGCCCCAGGAGCTGTCAGG + Intergenic
926270941 2:11365528-11365550 GCTCAGCTGCAGGCCCTGTCTGG + Intergenic
926914300 2:17878368-17878390 CCGGAGCGGCAGGCGCTGTCCGG - Intronic
927190296 2:20512555-20512577 CCTGGGCTGCATGCTCTGCCTGG + Intergenic
927427306 2:22995579-22995601 CCTGGGCTGCAGGAGGTGCCAGG - Intergenic
930891168 2:56389626-56389648 CCTGCTCTGTAGGAGCAGTCAGG - Intergenic
931718582 2:65049339-65049361 CCTGAGCTCCAGGCTGTGTCAGG + Intergenic
932139814 2:69265336-69265358 CCTGCTCAGCAGGAGCAGTCAGG - Intergenic
933719857 2:85390989-85391011 GCTGAGCTGCAGGGGCTTTCAGG + Exonic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
940775158 2:157876570-157876592 CCGGCGCGCCTGGCGCTGTCTGG + Intergenic
942043475 2:172085834-172085856 GCTGAGCTGTAGGCGCCGTCGGG - Exonic
942227811 2:173832110-173832132 CCAGCTCTCCAGGCGCTGACAGG - Intergenic
947736053 2:232456140-232456162 CCTGCGCTGCAGCCGGTTCCTGG + Exonic
948386104 2:237582034-237582056 CCTCCGCAGCAGGCCCTGGCGGG + Intronic
1171184129 20:23112691-23112713 CCTGTGCTGGAGGAGCTGTCTGG - Intergenic
1172474507 20:35226807-35226829 CCCGCGCTGGAGCCGCTGGCGGG + Exonic
1175926778 20:62475196-62475218 CCCGCGCTGCCGCCGCTGCCGGG + Exonic
1176222781 20:63978044-63978066 CCCGGGCTGCAGGCCCTGTGGGG - Intronic
1178967320 21:37133657-37133679 CCTGCTCTGCTGGAGCTTTCAGG + Intronic
1179438512 21:41377936-41377958 TCTGTGCTGGAGGCACTGTCAGG + Exonic
1181088941 22:20458884-20458906 CCTGGACTGCAGGCTCTGTAAGG + Intronic
1181305924 22:21917265-21917287 CCTGGGCAGCAGGCACTGCCGGG + Intergenic
1181625727 22:24121003-24121025 CCTGGGCTGCTTGCTCTGTCTGG - Intronic
1182018704 22:27062896-27062918 CCTGAGCTGCAGGTGGTGCCTGG + Intergenic
1183808860 22:40237314-40237336 TCTGCCCTGAAGGTGCTGTCTGG + Intronic
1183978201 22:41525269-41525291 CAGGAGCTGCAGGCGCTGGCTGG - Exonic
1184147888 22:42622282-42622304 CCTCCGCTCCAGCCGCTGCCTGG + Intronic
1184417485 22:44360735-44360757 CCTGCCCTGCAGGCCATCTCAGG + Intergenic
1185306573 22:50120975-50120997 CTTGCCCTGCTGGCTCTGTCAGG - Intronic
1185330568 22:50250455-50250477 GAGGAGCTGCAGGCGCTGTCCGG - Exonic
950581410 3:13864599-13864621 GCTGGGGTGCAGGCTCTGTCTGG - Intronic
954750659 3:52811640-52811662 CCTGCCCCGCAGGTGCTGGCAGG + Intergenic
954763885 3:52897236-52897258 CCTGCGCGGCAGCCGCGGCCCGG - Intronic
954948374 3:54446750-54446772 CGTGCACTGCCAGCGCTGTCAGG - Intronic
955333295 3:58065181-58065203 CCTGCGCTGCCGAGGCTCTCGGG - Intronic
957646632 3:82939210-82939232 CCTGGCCTGCAGGCGCCCTCAGG + Intergenic
960669172 3:120140272-120140294 CCCGGGCTGCGGGCGCTCTCAGG + Intergenic
961234801 3:125357160-125357182 CCTGCCCCGCTGGCGCAGTCAGG - Intronic
962606410 3:137036048-137036070 CCTGCGCCTCAGCTGCTGTCAGG + Intergenic
965610506 3:170538730-170538752 CCTGCCCTCCAGGAGCTCTCAGG + Intronic
966121607 3:176527933-176527955 CCTGCCCTGCTGAGGCTGTCTGG + Intergenic
968084718 3:195869173-195869195 CCAGACCTGCAGGCGCTGTCTGG - Intronic
968225170 3:196968698-196968720 CCAGCGCTGAAGGCGCAGCCCGG - Exonic
968629943 4:1645116-1645138 GCTGCGCTCCAGGCACTGCCAGG - Intronic
969342856 4:6553230-6553252 CCTGCCCTGCAAGCTCTGACTGG + Intronic
972413027 4:38811695-38811717 CCTGCTCTGCAGGAGCAGTCAGG + Intronic
986674252 5:10169268-10169290 CCTGAGCTGCAGGCACTGTGGGG - Intergenic
997621241 5:135297575-135297597 CCTGGGGTGCAGGCGCTGGTGGG + Intronic
998481587 5:142467551-142467573 CCTGGGCTGCAGACCCTGTTAGG + Intergenic
1002100094 5:176853329-176853351 CCTGGTCTGCAGGAGCTGGCGGG + Intronic
1002440833 5:179263519-179263541 CCTGTCCTGCAGGCTCTCTCTGG + Intronic
1003802013 6:9680810-9680832 CCTGCTGTGCATGCACTGTCAGG + Intronic
1004350000 6:14882647-14882669 CCTGGGGAGCAGGAGCTGTCAGG + Intergenic
1005039225 6:21587103-21587125 ACTGCACTCCAGGCGCGGTCTGG + Intergenic
1006719728 6:36142471-36142493 CCTGGGCTGCAGGCCCTCTGTGG + Intronic
1017103253 6:150866255-150866277 CCTGCGCTGCGGGCCCGGTCGGG - Intronic
1017598049 6:156050564-156050586 CCTGCATTCCAGGCGCTCTCAGG - Intergenic
1018914654 6:168125639-168125661 CCTGAGAGGCAAGCGCTGTCTGG - Intergenic
1024061461 7:45702024-45702046 CCTGCCCTGCATGCCCTGCCTGG + Intronic
1028216484 7:88139733-88139755 CCTGAGCTGGAGGCTGTGTCAGG + Intronic
1034549383 7:151810596-151810618 CATGGGCTGCAGGCGCTGCCAGG - Intronic
1040898019 8:52389114-52389136 CTGGCGCTTCAGGCGCTGCCCGG + Intronic
1040945085 8:52875686-52875708 CTGGCGGTGCAGGCGCTGACAGG + Intergenic
1040981543 8:53250910-53250932 CCGGCGCTGCCGTTGCTGTCGGG + Exonic
1041281114 8:56211647-56211669 CCTGGGCCGCAGGGGCGGTCGGG - Intergenic
1042118442 8:65458037-65458059 CCTGCTTTGCAGGCCTTGTCTGG - Intergenic
1045231325 8:100309875-100309897 CCTGCGCTGCCGCCGCTCTGAGG - Intronic
1049351531 8:142167263-142167285 CCTGTGCTGCAGTCGGTGTGGGG + Intergenic
1049474326 8:142789721-142789743 CCTGGGCTGGAGGAGCTGCCTGG + Intergenic
1049690754 8:143957837-143957859 CCTGCCCTGCTGGGGCTCTCTGG + Intronic
1051170018 9:14312984-14313006 ACTGCGCTGCAGGCGGTGGGCGG - Intronic
1053239992 9:36487600-36487622 CCGGCGCGGCAGGCGCTGGCTGG + Intergenic
1054191608 9:61988950-61988972 CCTGCCCTGCAGACCCTGCCTGG + Intergenic
1054646763 9:67598762-67598784 CCTGCCCTGCAGACCCTGCCTGG - Intergenic
1054820465 9:69516249-69516271 CCCGGGCTGCAGGCGCCGGCGGG - Exonic
1056308816 9:85319535-85319557 TCTGCTCTGCAGTGGCTGTCTGG - Intergenic
1057208116 9:93185129-93185151 CCGGCGCTGCAGGGGCTGCGGGG - Exonic
1057562717 9:96140710-96140732 CATCCGCTGCAGGCGCTGGGTGG - Intergenic
1058923399 9:109639795-109639817 CCTGCCCTGCAGGAGCTCACGGG - Intergenic
1061424055 9:130488360-130488382 CCTGCCCTGCAGCTGCTGTCTGG - Intronic
1061545889 9:131304066-131304088 CCTGCCCTGGGGGTGCTGTCTGG + Intronic
1062383742 9:136299988-136300010 CCTGCCCTGCAGGGCCTGCCTGG + Intronic
1062717980 9:138020743-138020765 GCTGGGCTGAGGGCGCTGTCAGG - Intronic
1189268047 X:39731338-39731360 CCTGCTCTGCGGGCGGTGACAGG + Intergenic
1192260627 X:69504300-69504322 CCTGAGGCGCAGGCGCAGTCGGG + Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1196455841 X:115891074-115891096 CCTGGGCTGCAAGGCCTGTCAGG + Intergenic
1200102809 X:153696476-153696498 CCAGCCCTGCAGCCTCTGTCTGG - Exonic
1200267819 X:154655257-154655279 CCAGCCCTGCAGCCTCTGTCTGG - Intergenic
1200977783 Y:9230837-9230859 CCTGGGCTGCAGTGGCTGTGGGG + Intergenic
1202133028 Y:21632071-21632093 CCTGGGCTGCAGTGGCTGTGGGG - Intergenic