ID: 900291243

View in Genome Browser
Species Human (GRCh38)
Location 1:1924404-1924426
Sequence TCCTCAGCTCGCCCTCCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900291243_900291247 9 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291247 1:1924436-1924458 GCTGCTGCTGGCCCCGGCCCCGG 0: 1
1: 1
2: 16
3: 104
4: 703
900291243_900291248 10 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291248 1:1924437-1924459 CTGCTGCTGGCCCCGGCCCCGGG 0: 1
1: 0
2: 8
3: 64
4: 638
900291243_900291245 -3 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291245 1:1924424-1924446 GGAACTGCGGCAGCTGCTGCTGG 0: 1
1: 0
2: 6
3: 58
4: 481
900291243_900291252 21 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291252 1:1924448-1924470 CCCGGCCCCGGGTGCTGGAGAGG 0: 1
1: 0
2: 1
3: 25
4: 326
900291243_900291249 16 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291249 1:1924443-1924465 CTGGCCCCGGCCCCGGGTGCTGG 0: 1
1: 0
2: 9
3: 37
4: 411
900291243_900291257 30 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291257 1:1924457-1924479 GGGTGCTGGAGAGGCTGTCCAGG 0: 1
1: 0
2: 6
3: 61
4: 479
900291243_900291246 3 Left 900291243 1:1924404-1924426 CCTCTGGGAGGGCGAGCTGAGGA 0: 1
1: 0
2: 1
3: 21
4: 245
Right 900291246 1:1924430-1924452 GCGGCAGCTGCTGCTGGCCCCGG 0: 1
1: 2
2: 17
3: 142
4: 942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900291243 Original CRISPR TCCTCAGCTCGCCCTCCCAG AGG (reversed) Exonic
900291243 1:1924404-1924426 TCCTCAGCTCGCCCTCCCAGAGG - Exonic
901087895 1:6622803-6622825 TCCAGAGCTGGCCCTCACAGGGG - Exonic
901443808 1:9294829-9294851 TCCTCAGACCCCCCTCCCAGTGG + Intronic
901462367 1:9399453-9399475 TCCTCAGCTGCCTCTTCCAGGGG - Intergenic
901749471 1:11397147-11397169 ACCCAAGCCCGCCCTCCCAGGGG - Intergenic
902282541 1:15384873-15384895 TCCTCAGTTTCCCCTCTCAGCGG - Intronic
905212752 1:36385777-36385799 TGCTCGGCTCTCCCTCCCGGGGG + Exonic
908272832 1:62437257-62437279 TGGTCGGCTCGCCCTCCCCGCGG - Exonic
908527417 1:65001427-65001449 TCCTCTGCTCGCCTTCCCGGAGG + Intergenic
908845802 1:68323152-68323174 CCCTCAGTTCCTCCTCCCAGGGG + Intergenic
912055220 1:105588475-105588497 TGCCCACCTCGGCCTCCCAGAGG + Intergenic
912106889 1:106289687-106289709 TTCTCAGTTAGCCCTCCCAAAGG + Intergenic
912398546 1:109368640-109368662 TCCTCAGCGTGTCCTCCTAGTGG + Intronic
912468560 1:109890944-109890966 TCCCCAGCTCCCCCTTCCAGGGG + Intergenic
912972582 1:114297880-114297902 TCATCAGCTCTCCCTGGCAGGGG + Intergenic
915327341 1:155087095-155087117 TCCACTGCCCGCCCCCCCAGGGG - Exonic
915590273 1:156866641-156866663 CCCTCAGATCCCCCTCCCTGGGG + Intronic
916817394 1:168367215-168367237 TCCTCAGCCAGCCCACCCAGGGG - Intergenic
918778515 1:188667802-188667824 TACTCTGCTCCCCCTCCCTGAGG + Intergenic
921664192 1:217847792-217847814 TGCTCACCTCTGCCTCCCAGTGG - Intronic
922609349 1:226912944-226912966 TCCTGTTCTCTCCCTCCCAGGGG + Intronic
1063255269 10:4320744-4320766 TCCTCTGCTCGCCCTAGCACTGG + Intergenic
1063367339 10:5499288-5499310 TCCTTAGCTGGGCCTCCGAGAGG + Exonic
1063575922 10:7261970-7261992 TCCTCAGTGTGCCCTCCCTGGGG + Intronic
1068480704 10:57585323-57585345 TCCTCTGGCCTCCCTCCCAGTGG - Intergenic
1069510877 10:69041660-69041682 CCCTCTGCTCACCCTCCCCGTGG + Intergenic
1070845698 10:79521314-79521336 TCCTCAGCTAAACTTCCCAGAGG + Intergenic
1074439150 10:113459738-113459760 TCCTCATTTAGGCCTCCCAGGGG - Intergenic
1075107090 10:119547393-119547415 TGCCCACCTCGGCCTCCCAGAGG + Intergenic
1075873291 10:125786750-125786772 TCTTCTGCTCACCCTCCCACGGG - Intronic
1076371789 10:129960032-129960054 TCCCCAGCTCGGGTTCCCAGCGG - Intronic
1076865656 10:133165070-133165092 TCCTGAGCCCGGCCACCCAGGGG - Intronic
1077393547 11:2310519-2310541 TCCCCATCTGCCCCTCCCAGTGG + Intronic
1078027292 11:7709131-7709153 CCCTCACATCTCCCTCCCAGGGG + Intergenic
1078354954 11:10626340-10626362 TCCCCAGCTCGCTCTCCACGGGG + Exonic
1080313824 11:30925877-30925899 TCCTCAGCTCCCTCCACCAGAGG + Intronic
1080873991 11:36260274-36260296 TCCCCAGCTCAGCCTCCCCGGGG + Intergenic
1083679724 11:64345587-64345609 GCATCAGCTCACCCTCCCATGGG - Intronic
1083690801 11:64407381-64407403 TCCTGAGCCGGCCCTTCCAGAGG - Intergenic
1084774735 11:71367973-71367995 TCCTCACTTCGCCCTGGCAGGGG - Intergenic
1084873993 11:72117227-72117249 CCCTCAGCTAGCCCACCCAGTGG - Intronic
1084879832 11:72163070-72163092 TCCTCAGCACGAACTTCCAGAGG + Intergenic
1085474897 11:76783483-76783505 TCCCCAGCCCGCCCTCCGAAGGG - Intronic
1087205867 11:95392952-95392974 TGCTCTGCTGGTCCTCCCAGAGG - Intergenic
1088455872 11:110032652-110032674 TCTTCAGCACTCACTCCCAGAGG - Intergenic
1088836140 11:113579226-113579248 ACCTCAGCTTGCCCTTCCCGTGG + Intergenic
1089468831 11:118704777-118704799 TCCTCAGCTCCTCATGCCAGGGG - Intergenic
1089752708 11:120662688-120662710 TGCTCCTCTCGCCTTCCCAGGGG + Intronic
1090080393 11:123608752-123608774 TCACCAACTCGCCCTTCCAGCGG + Exonic
1090987924 11:131788932-131788954 TCCTCACCCCTCCCTCCCTGCGG + Intronic
1091768994 12:3139369-3139391 TCCTCCCCTCACCCTGCCAGTGG + Intronic
1092014693 12:5149056-5149078 GCCTCAGTGAGCCCTCCCAGTGG - Intergenic
1092053667 12:5491440-5491462 ACCTCAGCCTGCTCTCCCAGTGG - Intronic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1093994879 12:25630713-25630735 TCCTCCGGTCGCCCTCCCAATGG - Intronic
1096214223 12:49790878-49790900 TCCCCAGCTCCCTCTCCAAGGGG + Intergenic
1096694315 12:53339023-53339045 CCCTCAGCCCAGCCTCCCAGGGG + Intronic
1096723497 12:53542179-53542201 TGCTCACCTCGGCCTCCCAAAGG - Intronic
1097869002 12:64584692-64584714 TCCTCACCTCCACCTCCCAAGGG - Intergenic
1100543466 12:95579640-95579662 CCCTCACCTCGGCCTCCCAAAGG + Intergenic
1102735555 12:115156123-115156145 TCATCAGCCACCCCTCCCAGTGG + Intergenic
1104685345 12:130781093-130781115 TCCTGGGCTCACCCTCCCGGGGG + Intergenic
1105040206 12:132955813-132955835 TCCTCCACACGGCCTCCCAGGGG + Intronic
1105516507 13:21095498-21095520 TCCTCTGCCACCCCTCCCAGGGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1107666307 13:42694242-42694264 TCCTCTGGCCGCCCTCCCAATGG + Intergenic
1109213652 13:59563472-59563494 TCCTCTGGTCACCCTCCCAATGG + Intergenic
1112050553 13:95641414-95641436 TGCTCTGCTCGCCGTCGCAGTGG + Exonic
1112266083 13:97925051-97925073 TACTCACCTCGACCTCCCAAAGG + Intergenic
1112792881 13:103022571-103022593 TCCTGAGCTTGGCTTCCCAGAGG - Intergenic
1116049108 14:39781605-39781627 TCCTCTGACTGCCCTCCCAGTGG + Intergenic
1116594976 14:46829581-46829603 TCCTCAGCTTTCCATCCCTGAGG - Intergenic
1116806757 14:49501344-49501366 TCCTCTGGCCGCCCTCCCAAAGG - Intergenic
1116885277 14:50214796-50214818 TCCTCAGGCCCCCCTCCCTGAGG + Intronic
1118345909 14:64940664-64940686 TCCTCAACTCCCCCTCCCCCTGG - Intronic
1119280965 14:73407205-73407227 TGCTCATCTCGGCCTCCCAAAGG - Intronic
1119762424 14:77161047-77161069 CTCTCAGCTCAACCTCCCAGAGG + Intronic
1119764749 14:77181447-77181469 ACCTCCCCTCGCCCTCCCTGAGG - Intronic
1120058512 14:79954041-79954063 TCCTCAGATGGCGCTCCCAGGGG + Intergenic
1125021080 15:34987766-34987788 CCCTCACCTCTCCCTCCCAGTGG + Intronic
1126032333 15:44511622-44511644 TCCCCGCCTCGGCCTCCCAGGGG - Intronic
1129097674 15:73225882-73225904 TCCTCCGGTTGCCCTCCCAAAGG + Intronic
1130119853 15:81038466-81038488 TTCCCAGGTCACCCTCCCAGAGG + Intronic
1130177817 15:81593270-81593292 TCCTCAGCTCCAGCTCTCAGTGG - Intergenic
1130312102 15:82764944-82764966 TCCTGACCTCACCGTCCCAGGGG + Intronic
1130622095 15:85474195-85474217 TTCTCAGCTCTTCCTCCAAGAGG + Intronic
1130994676 15:88897222-88897244 GCCTCAGGTCTCCCTCCCGGGGG - Intergenic
1132529434 16:438348-438370 TGCCCACCTCGGCCTCCCAGAGG + Intronic
1132789206 16:1675663-1675685 TCCTCTCCACGTCCTCCCAGTGG - Exonic
1132929847 16:2453504-2453526 TCCTCAGCTCTCCCTCGGGGCGG + Exonic
1134148635 16:11788143-11788165 TCAGCAGCACTCCCTCCCAGGGG + Intronic
1134695619 16:16221877-16221899 TCCCCAGCTCACCTGCCCAGGGG + Intronic
1135107300 16:19661487-19661509 TCCTCAGGTGGACATCCCAGTGG + Intronic
1135543718 16:23351872-23351894 TTCTGAGATCTCCCTCCCAGGGG - Intronic
1135952910 16:26931839-26931861 TCCTCAGCTCCCACTCACTGGGG - Intergenic
1136007521 16:27341164-27341186 TCCTCAAATCTACCTCCCAGAGG - Intronic
1136171318 16:28491558-28491580 CCCTCTTCTCGCTCTCCCAGGGG - Exonic
1136547962 16:30965985-30966007 GCCTCAGCTGGCCCCCCCGGTGG + Exonic
1137548007 16:49417301-49417323 TCCTGACCTGGCTCTCCCAGCGG - Intergenic
1137570594 16:49563787-49563809 TCCTGAGCTGGCCATACCAGTGG - Intronic
1139369271 16:66456209-66456231 TCATCAGCTATCCCACCCAGGGG - Intronic
1139957693 16:70700942-70700964 TCCTCAGCCTGCCCTCACATGGG - Intronic
1141421249 16:83917948-83917970 ACCTGAGCCCGTCCTCCCAGCGG - Exonic
1142184084 16:88686241-88686263 TCCCCAGCCCCCGCTCCCAGGGG + Intronic
1143120680 17:4604641-4604663 ACCTCTGCTGTCCCTCCCAGTGG - Intronic
1143338383 17:6190512-6190534 TCTTCCACTTGCCCTCCCAGAGG + Intergenic
1144579093 17:16447886-16447908 ACCTCAGCCCCCACTCCCAGTGG - Exonic
1146492658 17:33293269-33293291 TCCTCAGCTCGCTGGCCCCGCGG + Intronic
1147353104 17:39867861-39867883 TCCTCAGGTCCCCTTCCTAGGGG + Intergenic
1147999737 17:44380693-44380715 TCCTCATCTCATCTTCCCAGGGG + Intronic
1148723450 17:49771722-49771744 TCCTAGGCACCCCCTCCCAGAGG + Intronic
1150012365 17:61516738-61516760 TGCTCACCTTGGCCTCCCAGAGG - Intergenic
1150985335 17:70189790-70189812 ACCTCAACTCTCCCTCCCTGAGG - Intergenic
1151193544 17:72415773-72415795 TCTTCCTCTCACCCTCCCAGAGG - Intergenic
1154046466 18:10910336-10910358 CGCCCAGCTCGGCCTCCCAGAGG - Intronic
1154210971 18:12377796-12377818 TCTTCGCATCGCCCTCCCAGGGG - Intergenic
1155201635 18:23522873-23522895 TCCTGAGCACGCCCACCCAGTGG - Intronic
1155444793 18:25899814-25899836 CCCTCAGCTCCACCTCCCAGAGG + Intergenic
1156355662 18:36338316-36338338 TGCTCAGCTCAGCCTCCCTGGGG + Intronic
1157217859 18:45800725-45800747 CCCTCAGCTAGGCCACCCAGGGG + Intergenic
1157516430 18:48314936-48314958 CCCTCAGCTCCCCCTCCTGGGGG + Intronic
1157685392 18:49639018-49639040 TTCTCAGCTGGGCCCCCCAGTGG + Intergenic
1158555344 18:58470363-58470385 TCCTCCTCTCTCCCTCCCAGTGG - Intergenic
1158948535 18:62469322-62469344 TGCCCACCTCGCCCTCCCAAAGG + Intergenic
1160413642 18:78691710-78691732 TCCCCTGCTTCCCCTCCCAGAGG + Intergenic
1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG + Intergenic
1162086767 19:8254076-8254098 TGCCCACCTCGGCCTCCCAGAGG - Intronic
1162490899 19:10990971-10990993 TCCTGTGCTCGCCCTGCCCGGGG + Intronic
1162508859 19:11105101-11105123 TCCCCAGCCCGCCTTTCCAGGGG + Intronic
1162514082 19:11137921-11137943 TGCTCAGTTTTCCCTCCCAGGGG - Intronic
1163055507 19:14714667-14714689 TCCTCACCTCTCCCTCCCGATGG - Intronic
1167120837 19:47515391-47515413 TCCCCCACTCGCCCTCCCCGCGG + Intergenic
925853832 2:8110331-8110353 TGGCCAGGTCGCCCTCCCAGGGG + Intergenic
927822658 2:26282041-26282063 TCCTCAGCTGGTTCTCCCATTGG + Intronic
929078261 2:38096188-38096210 TTCTGAGCTCAGCCTCCCAGAGG + Intronic
930486580 2:52018234-52018256 TCCTCTGGTCACCCTCCCAATGG + Intergenic
932769373 2:74492077-74492099 TCCTCACCCCACCCTCCCTGGGG + Intronic
934149644 2:89134106-89134128 TCCTCAGCCAGCTCTCCCTGAGG + Intergenic
934196581 2:89841912-89841934 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
934217651 2:90047922-90047944 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
934686382 2:96325140-96325162 TCCGCTGCTCGGCCTCCCTGGGG - Intergenic
938105042 2:128524357-128524379 TCCTCAGCTTTCCGTCCCATTGG + Intergenic
938263061 2:129908938-129908960 CCCGCAGCTGGCCCTCCCCGAGG - Intergenic
939186476 2:138866870-138866892 TGCTCAGGTTGGCCTCCCAGAGG - Intergenic
941028097 2:160480833-160480855 CCGTCACCTCGGCCTCCCAGTGG - Intronic
947713665 2:232329557-232329579 TCCTGTGCTGGCTCTCCCAGAGG - Intronic
947733107 2:232441795-232441817 TCCTGTGCTGGCTCTCCCAGAGG - Intergenic
949042939 2:241857814-241857836 CCCTCATCTTGTCCTCCCAGTGG + Intronic
1169245513 20:4021508-4021530 TGCCCAGCTCAGCCTCCCAGAGG + Intergenic
1169263368 20:4153408-4153430 TCCTCAGCCTGGCATCCCAGGGG - Intronic
1169867477 20:10217567-10217589 TCCCCAGCCCTCCCTCCCTGCGG + Intergenic
1170736944 20:19021031-19021053 TCCTCAGCTCCCACACCCAGAGG - Intergenic
1171333016 20:24357927-24357949 TCCTCAGCTCCCCTTCCCTGAGG + Intergenic
1173993261 20:47319046-47319068 TCCTCAGCGGCCTCTCCCAGGGG + Intronic
1174321949 20:49749021-49749043 TGCTCACCTCAGCCTCCCAGAGG + Intergenic
1174369954 20:50079819-50079841 TCCTCAGTCAGCCCTCCCAAGGG - Intergenic
1174383155 20:50170616-50170638 TACCCACCTCGGCCTCCCAGTGG + Intergenic
1175483979 20:59331605-59331627 TCCCCAGTTCTACCTCCCAGAGG + Intergenic
1175814974 20:61878573-61878595 TCTTCAGCAGCCCCTCCCAGTGG + Intronic
1177034063 21:16019854-16019876 TGCTCATCTTGGCCTCCCAGTGG + Intergenic
1177923643 21:27186314-27186336 TGCTCACCTCGGCCTCCCAAAGG - Intergenic
1178992554 21:37367444-37367466 TCCTCGGCTCGCGGTTCCAGCGG - Intronic
1179779915 21:43692977-43692999 GCCTCAACTCACCCTCCCAAGGG - Intronic
1179989591 21:44940176-44940198 TCCCCAGCTCACCTTCCCCGCGG - Exonic
1179999340 21:44987993-44988015 TCCTCAGGTGGCCCCCCCCGGGG + Intergenic
1181265834 22:21630026-21630048 TCCACCGCTCGCGCTCCCAGGGG + Exonic
1181283957 22:21739092-21739114 GCCTCAGCATGCCCTCCCACTGG + Intergenic
1182241119 22:28917171-28917193 TCCTCACCTGGCACTCCCACAGG + Intronic
1183710163 22:39498638-39498660 TCCTCCCCACCCCCTCCCAGGGG - Intergenic
1184502515 22:44882653-44882675 TTCTCAGCTCGCCCTCCCACAGG + Exonic
1185337274 22:50276280-50276302 TCCACAGCGCCCCCTCCCTGCGG - Intronic
949786911 3:7751936-7751958 TCCTCCTCTCACCCTCCAAGAGG - Intergenic
950500347 3:13359679-13359701 CTCTCAGCTCACCCTCCCCGGGG + Intronic
951582345 3:24179188-24179210 ACCTCAACTCCCCCTCCAAGGGG + Intronic
953242160 3:41159242-41159264 TCTTCAGCCTGCCCTCCCAGAGG + Intergenic
954852619 3:53616432-53616454 TTCTCTGCTCTCCCTCACAGAGG + Intronic
955352073 3:58200990-58201012 TCCTCACCTCCGCCTTCCAGCGG + Exonic
955461698 3:59190094-59190116 TCCTCTGGCCACCCTCCCAGTGG + Intergenic
955685535 3:61545043-61545065 TTCTCAGCTCGGCTTCACAGAGG - Intergenic
957016477 3:75069894-75069916 TCCTCTGGCTGCCCTCCCAGTGG + Intergenic
960016075 3:112889548-112889570 TCCTCTGGCCGCCCTCCCAGTGG + Intergenic
960161731 3:114357067-114357089 TGTACAGCTCGCCCTCCCATAGG - Intronic
961007644 3:123415474-123415496 TTCTGAGCTTGTCCTCCCAGGGG + Intronic
961517269 3:127445778-127445800 GCCTCAGCACTGCCTCCCAGGGG + Intergenic
962743174 3:138378070-138378092 ACTTCAGCTCCCCTTCCCAGAGG - Intronic
968653719 4:1769903-1769925 GGCTCAGCTGGGCCTCCCAGAGG + Intergenic
969494665 4:7519788-7519810 TCCTTGGCCCGGCCTCCCAGAGG + Intronic
969521977 4:7683638-7683660 TCCTCAGCCCTCACTCCCATGGG - Intronic
971959775 4:33471050-33471072 TCCTCAGCTGGCACTGCCATGGG - Intergenic
976308345 4:83583741-83583763 ACCTCACCTCGGCCTCCCAAAGG - Intronic
976821019 4:89207111-89207133 TCTTCCACTCACCCTCCCAGTGG + Intergenic
977330380 4:95629888-95629910 TCCTCTGCACGCCCTTCTAGAGG + Intergenic
978402897 4:108349710-108349732 CCCTCACCTCAGCCTCCCAGAGG - Intergenic
981108056 4:140903908-140903930 TCCTCAACTCTCCCTGTCAGAGG + Intronic
981271530 4:142851360-142851382 TAATCTGGTCGCCCTCCCAGGGG - Intergenic
985498413 5:224645-224667 TACTCAGCTCACCCTCTCAGGGG + Intronic
985857682 5:2442887-2442909 TCCTCCCCTGGCCATCCCAGGGG - Intergenic
985980300 5:3456997-3457019 TCCCCAGCAAGCCCTCCGAGGGG + Intergenic
986746857 5:10752791-10752813 TCCTCAGCTGGCCCTGGGAGAGG - Intronic
990626090 5:57613003-57613025 TGCTCAGCTTCCCCTTCCAGCGG - Intergenic
990846321 5:60144098-60144120 TCCTCCACTCATCCTCCCAGCGG + Intronic
991734487 5:69619375-69619397 TGCCCAGCTCGGCCTCCCAAAGG - Intergenic
991780491 5:70127346-70127368 TGCCCAGCTCGGCCTCCCAAAGG + Intergenic
991810921 5:70474516-70474538 TGCCCAGCTCGGCCTCCCAAAGG - Intergenic
991859779 5:71002765-71002787 TGCCCAGCTCGGCCTCCCAAAGG + Intronic
991872939 5:71127663-71127685 TGCCCAGCTCGGCCTCCCAAAGG + Intergenic
994909697 5:105886549-105886571 TCCTCAGCACTACCTCCCATAGG - Intergenic
996010674 5:118478744-118478766 TCCTCTGGTTGCCCTCCCAATGG - Intergenic
998004603 5:138648747-138648769 TATTCTTCTCGCCCTCCCAGAGG - Intronic
998224680 5:140317583-140317605 TTCTCAGTTCTCCTTCCCAGAGG + Intergenic
998432601 5:142079235-142079257 ACTTCAGCTCGGCCTCCCAAGGG - Intergenic
999264013 5:150254934-150254956 TCCTCTGATCCCCTTCCCAGTGG + Intronic
1002319063 5:178364381-178364403 CCCTCAGCTCACCCTCCTGGGGG - Intronic
1002797330 6:484757-484779 TGCTCAGCTCTTCCTTCCAGCGG - Intergenic
1003063073 6:2877278-2877300 TCCTCAGGCCACCCTCCCAAAGG - Intergenic
1004342591 6:14820522-14820544 TGCCCACCTCGGCCTCCCAGAGG + Intergenic
1005072417 6:21874222-21874244 TCCTCTGGTCACCCTCCCAATGG - Intergenic
1005910170 6:30302638-30302660 TACTCTTCTCTCCCTCCCAGAGG + Intergenic
1009942295 6:70303409-70303431 TCCACACCTCTGCCTCCCAGTGG - Intergenic
1010993871 6:82511124-82511146 TCTTCATCTCTCCTTCCCAGAGG - Intergenic
1013113171 6:107080243-107080265 CCCTCACCTCAGCCTCCCAGTGG - Intronic
1013578512 6:111508943-111508965 TCCTCAACTCCCCCTAGCAGAGG - Intergenic
1018762372 6:166903554-166903576 ACCCCAGCTTGCCCTCCAAGGGG + Intronic
1019367909 7:644726-644748 ACCCCAGCTCTCCCTCCCAGAGG + Intronic
1019414545 7:921230-921252 TCCTCACCTGGCCTTCCCTGTGG + Intronic
1021241056 7:18201548-18201570 TGCTCAGCTAGTCCTCCCTGAGG - Intronic
1021313261 7:19117469-19117491 TCCCCCGCGCGCCCTCCCCGCGG - Exonic
1022125320 7:27350469-27350491 TCATCAGCTTGCCCAGCCAGTGG + Intergenic
1022417564 7:30191059-30191081 TCTTCAGCCAGCCCTCCCACAGG - Intergenic
1023115351 7:36856635-36856657 TTCTTAGCTTCCCCTCCCAGAGG + Intronic
1023243947 7:38179979-38180001 TCCTCACCTCACCCTCCCCTAGG - Intronic
1024745441 7:52400376-52400398 TCCTCTGGCCGCCCTCCCAATGG + Intergenic
1029641790 7:101825500-101825522 TCCGGAGCTGGCCGTCCCAGAGG + Intronic
1030188354 7:106786026-106786048 TCCTCAGCTTGGTGTCCCAGAGG + Intergenic
1031879151 7:127176902-127176924 TCCTCTGGTCACCCTCCCAATGG - Intronic
1033028529 7:137801729-137801751 TCCCCAGCTCTCACCCCCAGTGG - Intronic
1034622051 7:152463981-152464003 TCCTCGGCTCGGCCTCCCATTGG - Intergenic
1035307424 7:157942230-157942252 TCCTCGGCACGCCTTTCCAGAGG + Intronic
1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG + Exonic
1036517165 8:9455057-9455079 TGCTCACCTCGGCCTCCCAAAGG - Intergenic
1039494310 8:37969231-37969253 CCCCCAGCTCAGCCTCCCAGAGG - Intergenic
1039910273 8:41820892-41820914 TCCTCCCCTCGCCCTCCCACTGG - Intronic
1040711610 8:50195533-50195555 TCCTCTGGTCACCCTCCCAATGG + Intronic
1042225691 8:66512867-66512889 TACGCAGCTCGGCCTCCCATTGG - Intronic
1045781119 8:105864683-105864705 TCGCCTGCTCGGCCTCCCAGAGG - Intergenic
1047973901 8:130110888-130110910 TGCTCAGCTCGTGCTCCCACAGG - Intronic
1049298431 8:141856017-141856039 TCCCCAGCCCACCCTCCCATGGG - Intergenic
1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG + Intronic
1052731545 9:32291654-32291676 TCCTCTGGTCTCCCTCCCAATGG + Intergenic
1053387957 9:37709879-37709901 TCAACTGCTCGCCCTTCCAGGGG - Intronic
1055724174 9:79209990-79210012 TCCTCAGCTTATCCTCCCTGAGG + Intergenic
1056780324 9:89544310-89544332 TCATCAACTCGCTCTCCCAAGGG - Intergenic
1057038660 9:91831846-91831868 ACTTCAGCTTGCCCTGCCAGAGG + Intronic
1057259546 9:93576325-93576347 TCCCCAGCCCGCCTTCCCGGCGG + Intergenic
1058453003 9:105114338-105114360 TCCCTAGCTCTCCCGCCCAGAGG - Intergenic
1060667121 9:125438707-125438729 TCCCCAGCGCTCCCTCCTAGGGG + Exonic
1062081255 9:134624892-134624914 TCACCAGCTGGCCCTGCCAGTGG + Intergenic
1062578392 9:137218964-137218986 TGCTCAGCTGGCCCTCGGAGGGG - Intergenic
1186877484 X:13830491-13830513 TCCTCAACACTCCCTCCCTGTGG - Intronic
1187219285 X:17308165-17308187 TCCTCTGGCCGCCCTCCCAATGG + Intergenic
1187934128 X:24319443-24319465 TGCCCACCTCGGCCTCCCAGAGG - Intergenic
1191080567 X:56505669-56505691 TCCTCTGGCCGCCCTCCCAATGG - Intergenic
1192784418 X:74322926-74322948 GCCTCACCTCTCCCTCCCATAGG - Intergenic
1192804214 X:74495382-74495404 GCCTCACCTCTCCCTCCCACAGG + Intronic
1194188655 X:90807742-90807764 TCCTCAGATGGAACTCCCAGAGG - Intergenic
1198638424 X:138726684-138726706 TCCTCAGCTTGCCCTACTATGGG + Intronic
1200141932 X:153906800-153906822 TCCACGGGTCCCCCTCCCAGTGG - Exonic
1200535239 Y:4389637-4389659 TCCTCAGATGGAACTCCCAGAGG - Intergenic