ID: 900293776

View in Genome Browser
Species Human (GRCh38)
Location 1:1938304-1938326
Sequence GTGTGTGAGTGCATGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5377
Summary {0: 1, 1: 9, 2: 83, 3: 575, 4: 4709}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900293776 Original CRISPR GTGTGTGAGTGCATGTATGT GGG (reversed) Intronic
Too many off-targets to display for this crispr