ID: 900294022

View in Genome Browser
Species Human (GRCh38)
Location 1:1939612-1939634
Sequence CGCTCCTGCCCCAGGAGTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900294022_900294030 22 Left 900294022 1:1939612-1939634 CCCGAACTCCTGGGGCAGGAGCG 0: 1
1: 1
2: 1
3: 22
4: 231
Right 900294030 1:1939657-1939679 CGTCCTGATGGCCTCATAGATGG 0: 1
1: 0
2: 1
3: 6
4: 68
900294022_900294027 -9 Left 900294022 1:1939612-1939634 CCCGAACTCCTGGGGCAGGAGCG 0: 1
1: 1
2: 1
3: 22
4: 231
Right 900294027 1:1939626-1939648 GCAGGAGCGAGTGGTTGTGGAGG 0: 1
1: 0
2: 2
3: 34
4: 350
900294022_900294028 10 Left 900294022 1:1939612-1939634 CCCGAACTCCTGGGGCAGGAGCG 0: 1
1: 1
2: 1
3: 22
4: 231
Right 900294028 1:1939645-1939667 GAGGCTGATTTCCGTCCTGATGG 0: 1
1: 0
2: 1
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900294022 Original CRISPR CGCTCCTGCCCCAGGAGTTC GGG (reversed) Exonic
900105951 1:981118-981140 CGCCCCTGCCCCACGAGACCTGG + Intronic
900294022 1:1939612-1939634 CGCTCCTGCCCCAGGAGTTCGGG - Exonic
900708728 1:4097346-4097368 AGCTTCTGCCCCTGGAGTTGGGG + Intergenic
901018993 1:6246441-6246463 GGCTTCTGGCCCAGGAGTCCGGG + Intergenic
901956075 1:12786866-12786888 AGGTCCTGCCCCAGGAAGTCAGG - Intergenic
901979455 1:13022935-13022957 AGGTCCTGCCCCAGGAAGTCAGG - Intronic
902002628 1:13206003-13206025 AGGTCCTGCCCCAGGAAGTCAGG + Intergenic
902021861 1:13351766-13351788 AGGTCCTGCCCCAGGAAGTCAGG + Intergenic
903555008 1:24187098-24187120 CGTGCCTGTCCCAGGAGCTCCGG + Intronic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
904442219 1:30539314-30539336 CCCCCCGGCCCCTGGAGTTCAGG + Intergenic
904534025 1:31187399-31187421 CACTCCAGCCCCAGGAGTCTGGG - Intronic
904994426 1:34620089-34620111 TGCTCCTGACACAGCAGTTCTGG - Intergenic
905733666 1:40312405-40312427 CCCTCCTTCCCTGGGAGTTCTGG + Intronic
906322991 1:44828146-44828168 AGATCCTGCCCCAGGAGCTGGGG - Exonic
912787461 1:112618877-112618899 CCGCCCTGCCCCAGGAGGTCTGG + Intronic
915457438 1:156050286-156050308 CTCACCTGCCTCATGAGTTCAGG + Exonic
918042823 1:180923598-180923620 AGTTCTTGCCCCAGGAGCTCAGG - Intronic
919047366 1:192470285-192470307 AACTCCTGCCCCAGGAGTAGGGG - Intergenic
921065658 1:211620639-211620661 TGCTCCTGCCCCTGGGGCTCAGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921259798 1:213375968-213375990 CTCTCCTTCCCCAGTAATTCTGG - Intergenic
921491367 1:215780011-215780033 AGCTACTACCCAAGGAGTTCCGG - Exonic
923564622 1:235067649-235067671 CTCTCTTGCCCCAGGGCTTCTGG - Intergenic
923942578 1:238844384-238844406 CACTCCTCCCCCAGGGGCTCAGG + Intergenic
1063227915 10:4033730-4033752 CGCTCCTGCCCCAGGACCTCAGG + Intergenic
1064112677 10:12552201-12552223 CTCTCCAGCCCCAGATGTTCTGG + Intronic
1067056299 10:43053917-43053939 CGCTCCATCCCCAGGCCTTCAGG - Intergenic
1068885547 10:62093077-62093099 CACTCCTTACCCAGGAGTGCTGG + Exonic
1069991000 10:72316027-72316049 TGCTCATGCCCCAGCATTTCAGG + Intergenic
1070759749 10:79016675-79016697 CTCTCCTGCCTCTGGACTTCTGG - Intergenic
1070834942 10:79442311-79442333 TGCTCCTGCACCAGGAACTCTGG + Intronic
1073217346 10:101843730-101843752 CTCTCCTGCTCCAGGACCTCCGG - Intronic
1075782370 10:125025864-125025886 CACTGCTGCCCCAGCAGATCTGG + Intronic
1076193526 10:128499213-128499235 GGCCCCTGCCCCAGGAATGCTGG - Intergenic
1076361070 10:129889286-129889308 CGCTCCTGTGCCACGAGCTCTGG - Intronic
1076731519 10:132441344-132441366 CGCTCCTGCCCCATGCCTTTGGG + Intergenic
1076830325 10:132991279-132991301 CCCTCCTGCCCCTGGATTCCTGG + Intergenic
1076885125 10:133258715-133258737 CGGTCCTGGCTCAGGAGTCCGGG - Intergenic
1077273230 11:1691574-1691596 TGGTCCTGCCCCAGGGGTGCGGG - Intergenic
1077334970 11:1999204-1999226 CGCTCCTGCTCCAGGCATTGTGG + Intergenic
1077963145 11:7096858-7096880 AGTTCCTGGCCCAGGAGTTGGGG - Intergenic
1079243382 11:18736506-18736528 GGCTCCTGCCCCAGGGGCTGAGG - Intronic
1080226907 11:29972277-29972299 CCCTCCTGCCCCCCAAGTTCAGG + Intergenic
1080860946 11:36149768-36149790 TGCACCTGCCCCAGCACTTCTGG - Intronic
1081567044 11:44266470-44266492 CCCTCCTGCCCCATGAATCCTGG + Intronic
1082808368 11:57463887-57463909 CGCTCCAGCCCCAGCAGGCCTGG + Intronic
1083174309 11:60939630-60939652 TGCTCCTCCACCAGGAGTCCTGG - Exonic
1083265852 11:61546559-61546581 CGCCCCTGCCCCAGGCGGTGGGG - Intronic
1083325730 11:61872085-61872107 CTCTCCTGCCCCAGAAGTCAGGG + Intergenic
1083651813 11:64208555-64208577 CGCTGCTGCTCCAGGAGGCCAGG - Intronic
1087328712 11:96753665-96753687 TACTCCTGCCCCTGGAATTCTGG - Intergenic
1088091634 11:106046760-106046782 CTCTCCTTTCCCAGGTGTTCTGG - Intergenic
1088177232 11:107067113-107067135 AGTGCCTGCCTCAGGAGTTCTGG - Intergenic
1089063367 11:115644050-115644072 GCCTCCTGCCCCAGGAACTCAGG + Intergenic
1089448439 11:118572569-118572591 GGCTCGGACCCCAGGAGTTCGGG - Intronic
1089856173 11:121546883-121546905 AGATTCTGCCTCAGGAGTTCTGG + Intronic
1090105716 11:123852071-123852093 CGCTCCTCCCCCAGGAATTGAGG + Intergenic
1090442243 11:126734074-126734096 AGCTTCTGCCTCAGTAGTTCTGG - Intronic
1091103188 11:132894820-132894842 CACTCCTACCCCAGGTTTTCAGG + Intronic
1202817953 11_KI270721v1_random:54386-54408 CGCTCCTGCTCCAGGCATTGTGG + Intergenic
1091391445 12:128700-128722 TGCCCCTGCCCCAGGAGGCCAGG + Intronic
1092325476 12:7527274-7527296 CGCTCCTGTACAAGGTGTTCTGG + Intergenic
1101470818 12:104995532-104995554 GGCTCCTACCCCAGGAGGTCTGG + Intronic
1102426435 12:112847869-112847891 CCCTCCTGCCACAGCAGCTCTGG - Intronic
1104744358 12:131201780-131201802 CGGTCTTGCCTGAGGAGTTCTGG + Intergenic
1104790021 12:131475443-131475465 CGGTCTTGCCTGAGGAGTTCTGG - Intergenic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1105820399 13:24076265-24076287 CACTCATTTCCCAGGAGTTCAGG - Intronic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1108701458 13:52947803-52947825 CGCCCCTGCCCCTGGAGTCAGGG + Intergenic
1112163450 13:96893018-96893040 TGCTCCTGCCTCAGGGCTTCTGG - Intergenic
1114522184 14:23346747-23346769 AGCTCCTGCCCGAGGTGCTCCGG - Exonic
1115645862 14:35368098-35368120 CCCTCTTGCCCCAGCAGCTCAGG + Intergenic
1115755013 14:36520745-36520767 CGCTCCAGCCGCCGGGGTTCAGG - Intronic
1119236777 14:73026692-73026714 CGCTCCTGCCCCTCGGGTTGTGG - Intronic
1120860731 14:89253128-89253150 CCCTCCTGCCCCAGGTTGTCAGG + Intronic
1122659385 14:103284400-103284422 CCCTCCTGCCTTTGGAGTTCAGG + Intergenic
1123033143 14:105460541-105460563 AGCACCTGCCCCAGGTATTCAGG + Intronic
1125510122 15:40288284-40288306 CCCTCCTGCCCCAGGCTTCCAGG - Exonic
1129033710 15:72637275-72637297 AGTTCCTGCCCCAGGAGTCAGGG - Intergenic
1129216171 15:74099941-74099963 AGTTCCTGCCCCAGGAGTCAGGG + Intergenic
1129879608 15:78998120-78998142 CGCTCCTGGGTCAGGAGCTCCGG + Exonic
1131116849 15:89801294-89801316 CCCTCCAGAGCCAGGAGTTCAGG - Intronic
1131175227 15:90205094-90205116 CCCTCCTGCCCCAGAAGTGCCGG + Intronic
1133002345 16:2857682-2857704 TGTTCCTGCCGCAGGAGGTCAGG - Intronic
1135228014 16:20678427-20678449 TACTCCACCCCCAGGAGTTCAGG + Intronic
1137676131 16:50304679-50304701 CTCTCCAGCCCCAGGAGGTGGGG - Intronic
1139205418 16:65023957-65023979 GGCTGCATCCCCAGGAGTTCAGG - Intronic
1139279081 16:65754346-65754368 CGCGCCTGGCCCAGGAATTAGGG - Intergenic
1139573666 16:67828321-67828343 GGCACCTGCCCCTGGAGTACCGG - Exonic
1139779514 16:69339338-69339360 CGCTCCTCCGCCAGGCGCTCGGG + Exonic
1139872181 16:70116485-70116507 TCCTCCTACCTCAGGAGTTCAGG + Intronic
1140363740 16:74365992-74366014 TCCTCCTACCTCAGGAGTTCAGG - Intergenic
1140380004 16:74478471-74478493 CCCTCCTGCCCCAGGTATGCTGG - Intronic
1141030565 16:80584146-80584168 TGCTCCTGCCTTTGGAGTTCAGG + Intergenic
1141592376 16:85077434-85077456 AGCTGCTGCCCCCGGAGTCCCGG + Exonic
1141888365 16:86909122-86909144 CCCTCCAGCCCTAGGAGTTCGGG - Intergenic
1142154830 16:88528182-88528204 AGCTCCTGCCCCAGCAGGCCGGG + Exonic
1142212640 16:88815809-88815831 CTCTGCTGCCCCTGGAGTTTGGG - Intronic
1142296973 16:89230502-89230524 AGCAGCTGCCCCAGGAGTGCCGG - Exonic
1142350114 16:89575882-89575904 CGCTCATGCTCCCGGCGTTCGGG - Exonic
1142395024 16:89827488-89827510 CGCTGGTCTCCCAGGAGTTCTGG - Intronic
1142968783 17:3597327-3597349 GGCTCCTGCCCCCGGAGGTCTGG + Intergenic
1143188451 17:5024216-5024238 CGCTGCTTCCCCAGAAGTGCTGG + Exonic
1144652974 17:17018704-17018726 GGCTCCTGGCCCAGGAGGTCTGG - Intergenic
1147157469 17:38551424-38551446 CTCTCCTGCTCCAGGACCTCTGG + Intronic
1147363267 17:39944483-39944505 AACTCCTGCCCCACGAGGTCCGG - Exonic
1148219325 17:45850782-45850804 ACCTCCTGCCCCAGGGGTTGTGG + Intergenic
1152205816 17:78973925-78973947 CTCTCCTGCCCCAGGAGCTTTGG + Intronic
1152859731 17:82689203-82689225 TCCTCCTGCCCCAGGAGTGCAGG - Intronic
1153273849 18:3349307-3349329 CGCTTGAGCCCCAGGAGCTCGGG + Intergenic
1156371423 18:36474751-36474773 CGCTCCTGCCCCAGGAGCTCAGG - Intronic
1156383299 18:36583411-36583433 TGCCCCTGCCCTAGGAGTACAGG + Intronic
1157307823 18:46529850-46529872 CTCCCCTGCCCCAGCGGTTCAGG + Intronic
1158930952 18:62325064-62325086 CGCCCCTGGCCCAGGTGCTCGGG - Intergenic
1160167610 18:76527961-76527983 AGATCCTGCCACTGGAGTTCTGG - Intergenic
1160817968 19:1044921-1044943 CGCTCCTCCCCCTGGACCTCGGG - Intronic
1161689157 19:5720818-5720840 CACCCCAGCCCCAGGAGTCCTGG - Intronic
1161773120 19:6242043-6242065 CGCTTCTGCGCCAGCAGGTCAGG + Intronic
1162549542 19:11350976-11350998 AGCTGCTGGCCCAGGAGATCCGG + Exonic
1163000422 19:14363478-14363500 TGCTCATGCCGCATGAGTTCAGG - Intergenic
1164265333 19:23610631-23610653 ATCTCCTGCCTCATGAGTTCTGG + Intronic
1164562637 19:29303452-29303474 GGCTCCTGTCCCAGGAGCTATGG - Intergenic
1164853816 19:31505217-31505239 GGCTCCTGACCGAGGAGGTCTGG + Intergenic
1165462842 19:35954190-35954212 TCCTCCTTCCTCAGGAGTTCAGG + Intergenic
1167245557 19:48371052-48371074 GGCTCCTGGCCCTGGTGTTCCGG + Intronic
1167298153 19:48663868-48663890 CGCCCCTGCCCCGGGAATCCAGG + Intronic
925256272 2:2491286-2491308 CACTAGTGCCCCAGGAGTCCTGG - Intergenic
927152184 2:20202616-20202638 CGCTCCTGCCCACGGAGTCGTGG - Exonic
929666569 2:43838493-43838515 TGCTGCTCCCCCAGGAGTGCGGG - Intronic
930027733 2:47039706-47039728 TGATCCTGCCCTAGGAGTGCAGG + Intronic
931365592 2:61615974-61615996 CAGCCCTGCCCCAGGAGTTAGGG - Intergenic
931455927 2:62409844-62409866 CTGTCCAGCCCCAGGAGTGCTGG - Intergenic
931665233 2:64605719-64605741 CGCACCTCACCCAGGAGCTCAGG + Intergenic
932217250 2:69974986-69975008 GACCCCTGCCCCAGGAGCTCTGG - Intergenic
934567523 2:95348749-95348771 CACTCATACCCCTGGAGTTCTGG + Intronic
935133537 2:100279042-100279064 TGCTCCTCCCCCAGGGGTTGAGG - Exonic
936981862 2:118272172-118272194 GGCTGCAGCCCCAGGAGCTCAGG - Intergenic
938667453 2:133553371-133553393 CCTGCCTGCCCCAGGAATTCAGG - Intronic
946031543 2:216708825-216708847 GGCCACTACCCCAGGAGTTCAGG - Intergenic
947745557 2:232505743-232505765 CTCCCCAGCCCCAGGAGTCCAGG + Intergenic
947911207 2:233802154-233802176 CACCCCTACCCCAGGAGTTTTGG + Exonic
948771184 2:240251942-240251964 CGCTCCTCCCCCAGGGGTGCTGG + Intergenic
949042918 2:241857759-241857781 GGCTCCTGCCCCGGGGGTCCTGG - Intronic
1170953431 20:20956752-20956774 CCCGCCTGCGGCAGGAGTTCAGG - Intergenic
1171359271 20:24575486-24575508 CGCTCCAGCCCTTGGAGGTCAGG - Intronic
1172039086 20:32031266-32031288 CGCTCCCGCCCCTGGAGCCCCGG - Exonic
1172111348 20:32547151-32547173 CACTCCAGCCCCAGGAGGTTGGG + Intronic
1172804066 20:37598546-37598568 CCCTCCCTCCCCAGGAGTTCAGG - Intergenic
1173662895 20:44746223-44746245 CGCTCCAGCCCCAGCCGTCCCGG + Intronic
1173799575 20:45886681-45886703 CGTGCCCGTCCCAGGAGTTCGGG - Exonic
1175116471 20:56686038-56686060 CCCTCGTGCCCCAGGAGTCAGGG + Intergenic
1175392284 20:58635081-58635103 CGCTCCTGGCCCAGGAGTGGGGG + Intergenic
1175443861 20:59007408-59007430 CGCGCCTGGCCCGCGAGTTCAGG - Intergenic
1175712913 20:61235309-61235331 CGCTGCTACCCCAGGGGGTCTGG + Intergenic
1175962141 20:62642596-62642618 CGCTCCTACGCCAGCAGGTCGGG - Intronic
1178244287 21:30936294-30936316 CCCTCCTGCCCCAAGAGGACTGG - Intergenic
1178342705 21:31799924-31799946 AGCTGCTGCCACAGGAGTTGGGG + Intergenic
1179641356 21:42749453-42749475 AGCAGCTGCCCCAGGAGGTCTGG - Intronic
1179799399 21:43803873-43803895 CCCGCCTGGCACAGGAGTTCTGG - Exonic
1181023480 22:20115185-20115207 TGATCCTGCCCCGGGAATTCTGG - Intronic
1181169858 22:21001984-21002006 CGCTCCTCCCCAAGGGGCTCTGG + Exonic
1181479145 22:23186817-23186839 GTCTCCTGCTTCAGGAGTTCAGG + Intronic
1181949904 22:26546341-26546363 CGCCCATGTCCCAGGAGTGCCGG - Intronic
1182459139 22:30471877-30471899 AGCCCCTCCCCCTGGAGTTCCGG - Intronic
1182577526 22:31283081-31283103 GGCTCAGGCCCCAGGAGTCCCGG + Exonic
1182662672 22:31936120-31936142 CCCTGCTGCCCCAGGCCTTCAGG + Intronic
1183342188 22:37287561-37287583 AGCTCCTGCCGGAAGAGTTCCGG + Intronic
1183605546 22:38865258-38865280 CCCTCCTGGCCCAGGTGTGCTGG - Exonic
1185027572 22:48424519-48424541 CACTCCTGCCCCCGGGGTCCCGG - Intergenic
952423202 3:33149411-33149433 GGCTCCTGCCCCAGCAGCACAGG - Intergenic
952744533 3:36764542-36764564 CGCTCCTGGCCCTGGAGGCCGGG + Intergenic
953556720 3:43951972-43951994 TCCTCCTGCCCCAGCAATTCTGG + Intergenic
954446369 3:50549044-50549066 CGCTCCTGAACCAGGACTCCTGG - Intergenic
956486951 3:69733114-69733136 CGCTCCTGCCTTAGTAGCTCTGG + Intergenic
960994075 3:123329639-123329661 CGCCCATGCCCCAGGTGTTAGGG - Intronic
961458685 3:127036851-127036873 CGCGCCTGGCTCAGGAGTGCTGG + Exonic
961824498 3:129592049-129592071 CGTTCCTGCCTCAGGACCTCTGG + Intronic
961965066 3:130894003-130894025 CGCGGCTGGCCCAGGAGTGCGGG + Intronic
967612434 3:191523486-191523508 CCATCCTGCCCCAGGAGACCAGG + Intergenic
967930748 3:194688272-194688294 CGCTCCCGCCCCAGCACTTTTGG + Exonic
969656186 4:8499852-8499874 AACTCCTGACTCAGGAGTTCAGG - Intergenic
970492385 4:16587574-16587596 CTCTCCTGCTCCATGATTTCTGG - Intronic
971409536 4:26355550-26355572 CCCTTGAGCCCCAGGAGTTCAGG + Intronic
974906796 4:68067944-68067966 CCCTACTGCCCCAAGAGGTCAGG - Intronic
975415476 4:74099416-74099438 CGCTCCCGCTCCAGGGATTCGGG - Intergenic
976281798 4:83333623-83333645 GGCTCCTGCCCCATGAATGCAGG - Intronic
977162175 4:93648656-93648678 GGCTCCAGCCCCAGAGGTTCTGG + Intronic
982180694 4:152746101-152746123 TGCTCCTGCCCCAGGAAAGCGGG + Intronic
986459382 5:7954553-7954575 CATTGCTGCCCTAGGAGTTCTGG + Intergenic
987090218 5:14503595-14503617 CGCTCCTGCTCCTGCTGTTCTGG - Intronic
992039594 5:72816777-72816799 CGTTCCCGCCCCTGCAGTTCGGG - Intronic
992850416 5:80801546-80801568 CACCCCTGCCCCAGGATTTGAGG - Intronic
995045369 5:107640850-107640872 CTCTCCTTCCCCAGGAGACCAGG + Intronic
995454139 5:112334081-112334103 CGCTCCTCCCTTTGGAGTTCAGG + Intronic
996743625 5:126826047-126826069 CGCCAGTGCCCCACGAGTTCTGG - Exonic
1001773337 5:174311712-174311734 CTCTCCTGACCCAGGAGGCCCGG + Intergenic
1002180156 5:177427061-177427083 CGCACCTGCCCCCGGGATTCGGG + Intronic
1002325563 5:178403331-178403353 CAGACCTGACCCAGGAGTTCTGG + Intronic
1002512723 5:179733248-179733270 CGCTCCAGCTCCAGGCGCTCGGG - Exonic
1005379445 6:25218307-25218329 TGCCCCTGCCCCTGGACTTCTGG - Intergenic
1006458354 6:34144482-34144504 CCCTGCAGCCCCAGGACTTCAGG - Intronic
1007790463 6:44305577-44305599 AGCTCCTCCCCCAGGAGCTCAGG + Intronic
1008229243 6:48963972-48963994 CGGTCTTGCCCCAGTAATTCAGG + Intergenic
1011117189 6:83906273-83906295 GGCTACTGCCCCAGGAGTTTAGG - Intronic
1011342773 6:86335938-86335960 TTCTCCTGACCCAGGAGTCCAGG + Intergenic
1013633585 6:112008308-112008330 CCATCCTGCTCCAGGAGGTCAGG - Intergenic
1014202470 6:118621455-118621477 TGGTCCTGCCCCAGGGGTTTAGG + Intronic
1016140731 6:140606701-140606723 CCCACCTGCCCCAGGAGCTTCGG + Intergenic
1016909097 6:149179341-149179363 CTTTCCTGGCCCAGAAGTTCTGG - Intergenic
1016940207 6:149477202-149477224 CAGGCCTGTCCCAGGAGTTCAGG + Intronic
1017526013 6:155241916-155241938 AGCTCTTGCCCCAAGAGTTAAGG + Intronic
1018050915 6:160006663-160006685 CGCCCCTGCCCCAAGACTTCAGG + Intronic
1018765399 6:166929003-166929025 CCCTCCTGCCCTAGGAGATTTGG - Intronic
1019305858 7:335438-335460 TGCTCTTGCCCCAGGAGTCGGGG + Intergenic
1019878923 7:3841385-3841407 AGCTCAGGGCCCAGGAGTTCTGG + Intronic
1019922515 7:4171988-4172010 CGCTCCTGGCCCAGGGGTGTCGG - Intronic
1020007565 7:4790619-4790641 CGCTCCTGACCCAGGAGGCCTGG + Intronic
1023055976 7:36290413-36290435 CACTCCAGACCCAGGGGTTCAGG + Intronic
1023873379 7:44274512-44274534 CGCTCCTGCCCAAGTCGTCCCGG + Intronic
1024540309 7:50470615-50470637 CACTTCTGCCCCAGATGTTCTGG + Intronic
1024754106 7:52507839-52507861 CTCTCATGCCCCGGGAGTTTAGG - Intergenic
1025802011 7:64795270-64795292 CGCTCCAGTCCCAGGGTTTCTGG - Intronic
1033223955 7:139546227-139546249 TCCTCCTGCCCTGGGAGTTCAGG + Intergenic
1034489731 7:151386844-151386866 CACTGCTGCCCCAGGACCTCTGG + Intronic
1035784183 8:2248997-2249019 CGCTCCTCCTCCTGGAGTTGGGG - Intergenic
1038805862 8:30790660-30790682 AGCTTCTGCCCCAGGAGCTGGGG + Intronic
1039818248 8:41113752-41113774 CACCCCTGCCCCAGCAGTTCAGG + Intergenic
1039875184 8:41578591-41578613 CCCTCCCGCCCCGGGAGTCCGGG + Intronic
1043448987 8:80348027-80348049 CTCTGCTGCCCCAGCAGTGCAGG - Intergenic
1043463894 8:80486696-80486718 CGCCCCCGCCCCCGGCGTTCCGG - Exonic
1044514288 8:93120647-93120669 GGGTCCTGTCCCAGCAGTTCTGG + Intergenic
1046368069 8:113262446-113262468 CACTCCTTCCCCATGAGTGCAGG + Intronic
1048230634 8:132637240-132637262 TGCTCCTCCCCCAGGGTTTCTGG - Intronic
1048977550 8:139681448-139681470 CACTCCTTCCCCTGGAGCTCTGG - Intronic
1049192185 8:141294601-141294623 CGTTCCTGCCACAGGAGTGCTGG - Intronic
1049419230 8:142509697-142509719 AGCCCCTGCCCCCGGACTTCAGG - Intronic
1049684487 8:143933885-143933907 TGCCCCTGCCCCAGGAGCCCAGG + Intronic
1049820888 8:144632570-144632592 GTCCCCTGCCCCAGGGGTTCTGG + Intergenic
1049944540 9:581099-581121 CGCTCGCGGGCCAGGAGTTCTGG - Intronic
1053174168 9:35910300-35910322 CGCTCCTGCTCCAGGCCTTCGGG - Intergenic
1054989969 9:71313885-71313907 CAGTCTTGCCCGAGGAGTTCTGG - Intronic
1055240869 9:74184072-74184094 CGCTGCTGCCCTTGGAGTGCTGG - Intergenic
1058908523 9:109499820-109499842 CGGTCCTGCCCCTGGACTCCGGG - Intergenic
1060430596 9:123548169-123548191 TGCTTCTGCCCCAGGACTTCAGG - Intronic
1060934754 9:127508485-127508507 CCCTCCTGCACCAGGAGCTGGGG - Exonic
1061563401 9:131421182-131421204 CTCTCCTGCTGCAGGAGTGCAGG + Intronic
1062232074 9:135487297-135487319 TGCTCCTGCCCGAGGGGATCCGG + Exonic
1062529727 9:136994524-136994546 CGCTCCTGCCCCTGTGGTTCTGG + Intergenic
1185469287 X:373243-373265 CGCTCCTTTCCCGGGAGTTTTGG - Intronic
1187245850 X:17552328-17552350 CCCTCCTGCTCCGAGAGTTCAGG - Intronic
1192220670 X:69195475-69195497 CCCTCTGGCCCCAGGAGTGCCGG + Intergenic
1195321156 X:103723215-103723237 CTCTCCTGACCCAGGAGATGAGG + Intronic
1200125514 X:153812325-153812347 CTGTCCTGCCCCGGGAGTTCAGG - Intronic
1201175647 Y:11307164-11307186 CGGTCCTGGCCCAGGAGATGCGG + Intergenic