ID: 900298392

View in Genome Browser
Species Human (GRCh38)
Location 1:1964387-1964409
Sequence CGTCCAGCCCTCCATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298377_900298392 29 Left 900298377 1:1964335-1964357 CCCAAGTGGCACAGGGCTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298379_900298392 28 Left 900298379 1:1964336-1964358 CCAAGTGGCACAGGGCTTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298386_900298392 -5 Left 900298386 1:1964369-1964391 CCCCATTGCTCAGACTGGCGTCC 0: 1
1: 0
2: 1
3: 34
4: 490
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298388_900298392 -7 Left 900298388 1:1964371-1964393 CCATTGCTCAGACTGGCGTCCAG 0: 1
1: 0
2: 3
3: 221
4: 2132
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298376_900298392 30 Left 900298376 1:1964334-1964356 CCCCAAGTGGCACAGGGCTTTCG 0: 1
1: 0
2: 0
3: 12
4: 80
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298387_900298392 -6 Left 900298387 1:1964370-1964392 CCCATTGCTCAGACTGGCGTCCA 0: 1
1: 0
2: 1
3: 46
4: 837
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298383_900298392 4 Left 900298383 1:1964360-1964382 CCACGGCACCCCCATTGCTCAGA 0: 1
1: 0
2: 2
3: 9
4: 152
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164
900298385_900298392 -4 Left 900298385 1:1964368-1964390 CCCCCATTGCTCAGACTGGCGTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298392 Original CRISPR CGTCCAGCCCTCCATGGGGA TGG Intronic
900145712 1:1157954-1157976 TGCCCAACCCTCCCTGGGGACGG - Intergenic
900298392 1:1964387-1964409 CGTCCAGCCCTCCATGGGGATGG + Intronic
900389616 1:2428263-2428285 CGGCCAGCACTCCATGGCCAGGG + Intronic
900421026 1:2556010-2556032 CTTCCACCCCTCCCAGGGGACGG + Intronic
900674038 1:3872833-3872855 CCTCCAGTCCTCCCTGTGGATGG + Intronic
901027138 1:6284708-6284730 CATCGAGGCCTCCCTGGGGACGG + Intronic
902038643 1:13476056-13476078 CCTCCTGCTCTCCATGGGCAGGG + Exonic
902207845 1:14882678-14882700 CGTCTAGCCCTCCACGTGCAGGG - Intronic
902535250 1:17115992-17116014 CATCCAGGCCACCATGGGCAGGG - Intronic
903747636 1:25598969-25598991 CATGCAGCCCTCCATGTGGCTGG - Intergenic
905236891 1:36556155-36556177 CTTCCTGCCCAGCATGGGGATGG + Intergenic
907428282 1:54395244-54395266 GGCACAGCCCACCATGGGGACGG - Intronic
907475256 1:54701160-54701182 CCTCCTGCCCTCCATGGTGAAGG + Exonic
912694333 1:111829681-111829703 CGTCCCGCCCTCCATTCTGAAGG + Intronic
913689623 1:121266939-121266961 CCTCCAGGCAGCCATGGGGAAGG - Intronic
914147975 1:145013333-145013355 CCTCCAGGCAGCCATGGGGAAGG + Intronic
920476946 1:206285413-206285435 CCTCCAGGCAGCCATGGGGAAGG - Intronic
920567229 1:206983896-206983918 CATCCAGAGCTTCATGGGGAGGG - Intergenic
1065740144 10:28790263-28790285 CCTGCAGTGCTCCATGGGGAAGG + Intergenic
1065920068 10:30385508-30385530 TGTCCAACCCACTATGGGGATGG + Intergenic
1066650466 10:37650449-37650471 CTTACTGCCCTCCCTGGGGAAGG - Intergenic
1066745915 10:38604206-38604228 CCTCCAGCCCTCCCTGTGGTAGG + Intergenic
1067058911 10:43067804-43067826 CTTCCAGGCCTCCATGTTGATGG - Intergenic
1067525194 10:47034257-47034279 TGTCCAGGCCTCCATGGAGCTGG + Intergenic
1067855052 10:49784800-49784822 GGCCCAGGCCTGCATGGGGAAGG - Intergenic
1069777566 10:70935842-70935864 TGTCCAGCCCTCCAGGGTGCCGG + Intergenic
1069792213 10:71030014-71030036 CACCCACCCCCCCATGGGGATGG - Intergenic
1075646562 10:124100676-124100698 AGACCCGCCCTCCCTGGGGAGGG + Intergenic
1075903874 10:126064288-126064310 GGCCCAGGGCTCCATGGGGAAGG - Intronic
1077281846 11:1749454-1749476 CGTCCAGTCTTCCACGGGGCTGG - Intronic
1078426079 11:11252562-11252584 CAGCCAGCCCTGCCTGGGGAAGG - Intergenic
1079003616 11:16777689-16777711 CTTCCAGCCCCACATGAGGAGGG - Intergenic
1081650119 11:44818268-44818290 CATGCAGCCCTCCCTGGGCAGGG + Intronic
1081846692 11:46245730-46245752 CCTTCAGCCTTCCATGTGGATGG - Intergenic
1083630439 11:64092412-64092434 CCACCAGCCCTCCATAGGCAGGG - Intronic
1083770624 11:64864888-64864910 CCCCCAGCCATCCAGGGGGAGGG - Intronic
1085790250 11:79491635-79491657 AGTCCAGCTCTTGATGGGGAGGG - Intergenic
1089586425 11:119512566-119512588 CCTCCAGGGCTCCCTGGGGATGG + Intergenic
1089699158 11:120234116-120234138 AGTGCAGACCTCCATGGAGAAGG + Intergenic
1090028219 11:123185552-123185574 CGGCCTCCCCTCCCTGGGGATGG + Intronic
1091401351 12:182481-182503 CGTGCAGCCCTGCAGGGGCACGG - Intergenic
1094567896 12:31616561-31616583 CGGCCGGCCCTACAGGGGGAAGG + Intergenic
1095800739 12:46268490-46268512 CGCCCAGCCCTCCCCGGGAACGG + Intronic
1095894222 12:47264405-47264427 CCTCCAGGCCTCCAGAGGGAAGG - Intergenic
1096114355 12:49046617-49046639 CTTCCAGCCGCCCTTGGGGACGG + Exonic
1101606222 12:106248629-106248651 CTCCCAGCCCGCCATGGGGTTGG + Intronic
1101955553 12:109209118-109209140 CCCCCAGCCCTGCATGGGCATGG - Intronic
1102132501 12:110542972-110542994 CTTCCAGGCCTCCCTGGGGAGGG + Intronic
1102531943 12:113553169-113553191 CGCCCAGGCCGCAATGGGGAAGG - Intergenic
1102678083 12:114672077-114672099 CGCCCTGCCCTCCATGGCGGCGG - Exonic
1113448198 13:110386853-110386875 CTAGCAGCCCTTCATGGGGATGG - Intronic
1113808302 13:113122650-113122672 CGCCCAGCTCTGCCTGGGGAAGG + Intergenic
1114233174 14:20801981-20802003 GGTCCAGCCTTCCCTGGGCAAGG - Exonic
1119542886 14:75452213-75452235 AGTCCAGCCCACCGTGTGGAAGG + Intronic
1120712465 14:87807019-87807041 ACACCAGCCCTCCTTGGGGAAGG + Intergenic
1121561263 14:94877734-94877756 AGTCCTGCCTGCCATGGGGAAGG - Intergenic
1122599353 14:102913608-102913630 CGTCCAGACCTCAAGGGGGTTGG + Intergenic
1123493334 15:20799828-20799850 AGTCCAGACCTCCATGGCGGGGG - Intergenic
1123549843 15:21368930-21368952 AGTCCAGACCTCCATGGCGGGGG - Intergenic
1123695245 15:22874271-22874293 TGTCCAGCCCTTCATGAAGAAGG - Intronic
1127384920 15:58459748-58459770 CGTGCAGGCGTCCTTGGGGACGG - Intronic
1127493101 15:59483881-59483903 TGTCCACCCCTCCATGGGGCAGG - Intronic
1132419519 15:101652981-101653003 AGCCCAGCCCTGCCTGGGGAAGG + Intergenic
1202958172 15_KI270727v1_random:96148-96170 AGTCCAGACCTCCATGGCGGGGG - Intergenic
1132671361 16:1103411-1103433 GGTCCAGCCCGCGGTGGGGAGGG - Intergenic
1133215956 16:4292654-4292676 GGGCCAGCTCTCCCTGGGGAGGG + Intergenic
1136407697 16:30058127-30058149 CTTGCAGCCCTCTGTGGGGAAGG - Intronic
1137248596 16:46726858-46726880 CCGCCAGCCCTCCGTGCGGAAGG - Intronic
1138821640 16:60267274-60267296 CATCCAGCCCACCATTGGGTGGG + Intergenic
1139439737 16:66960179-66960201 AGTCCTGCCCTCCCTGGGGGTGG + Intergenic
1139725451 16:68893964-68893986 GGCCCTGCCCTCCATGGGGCAGG + Intronic
1141858445 16:86700790-86700812 CGTCCAGCCCTCCTTGAGTGTGG + Intergenic
1142359976 16:89621337-89621359 CGTCCAGCCCACCCTGAGGCTGG - Intronic
1143204696 17:5133620-5133642 CGTCAAGCCCACCCTGGGGTGGG + Intronic
1144726334 17:17504419-17504441 CCTCCAGCCCTCCAAGGAGAGGG + Intergenic
1144770954 17:17759171-17759193 TGTCCATCCCCACATGGGGAAGG + Intronic
1144782110 17:17813568-17813590 CTTCCGGCCCGCCATGCGGAGGG - Exonic
1146454388 17:32997702-32997724 CCTCCAGGCCTCCCTGAGGATGG - Exonic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1149183450 17:53968466-53968488 CCTCCAGCCCTCTCTGGGGAAGG + Intergenic
1150007219 17:61477229-61477251 GGTCCTGCCTTCAATGGGGAGGG + Intronic
1150220088 17:63491195-63491217 CGTCCAGCCCTGCAAGCAGAGGG - Exonic
1151427871 17:74042936-74042958 CCTCCAGCTCTCCATGGAGAAGG - Intergenic
1151853840 17:76708243-76708265 CGCCCAGGCCTCCCTGGGAAGGG + Intronic
1152559171 17:81069376-81069398 CCTCCAGCACTCCATGGAGATGG - Intronic
1160953111 19:1676875-1676897 CCTCCAGCCCCCCGTGGGCATGG - Intergenic
1161596331 19:5152773-5152795 CCTCCATCCCTCCCTGGGGCAGG - Exonic
1163544509 19:17933125-17933147 CCTCCAGCCTTCCCAGGGGATGG - Intronic
1163777926 19:19228663-19228685 TGTCCAGCTCTCCATGGTCAGGG + Intronic
1163782156 19:19256322-19256344 AGTCCAGCCCTGTCTGGGGAAGG + Exonic
1165448825 19:35870942-35870964 GCACCAGCGCTCCATGGGGATGG - Exonic
1165828637 19:38719698-38719720 CGCCCAGGCCTCCATGGATAAGG - Intronic
1167422558 19:49412780-49412802 CGTGCTGCCCTACATGAGGATGG - Intronic
1167506730 19:49874825-49874847 GGTCCAGCCCACCAGGGTGAAGG + Intronic
925153368 2:1632731-1632753 CGTCGAGGCTTCCATGGGGTGGG - Exonic
925369816 2:3336411-3336433 CATGCTGCCCTCCATGTGGAAGG + Intronic
925718151 2:6803689-6803711 GCTCAAGCCCTCCCTGGGGAAGG - Intergenic
929811758 2:45194707-45194729 CTCCCAGCTCTCCATGGGGCTGG - Intergenic
932799284 2:74725230-74725252 GGTACAGGGCTCCATGGGGAAGG + Intergenic
935571980 2:104671318-104671340 CTTCCAGCCCTCAAAGGTGATGG - Intergenic
945289421 2:208112613-208112635 CGCCCAGCCAGCCATGGGGAAGG - Intergenic
945290714 2:208124464-208124486 CGCCCAGCCAGCCATGGGGAAGG - Exonic
947563974 2:231181960-231181982 TGTCCAGGCCACCATGGGGCAGG - Intergenic
948723509 2:239918299-239918321 TGTCCAGTCCTCCTTGGTGAGGG - Intronic
948767821 2:240232699-240232721 AGTCCAGCCCAGCAGGGGGAGGG - Intergenic
1168790628 20:573522-573544 CGTCCAGCCCCCTCTGGGTATGG - Intergenic
1170470559 20:16664183-16664205 TGCCCATCCCTCCATGGGGAAGG - Intergenic
1172060152 20:32181931-32181953 CCTCCAGCCCTCCAGGTGGCTGG - Intergenic
1172099265 20:32475559-32475581 AACCCAGCCCTCCAGGGGGAAGG + Intronic
1172881273 20:38201400-38201422 CATCCAGCTCACCCTGGGGAAGG - Intergenic
1175229070 20:57461969-57461991 CCTCCTGGCCTCCCTGGGGACGG + Intergenic
1175400285 20:58696308-58696330 GGGCCAGGCCTCCCTGGGGAGGG - Intronic
1177403662 21:20638533-20638555 AGTACAGGGCTCCATGGGGAAGG + Intergenic
1178841175 21:36138581-36138603 CCTCCAGCCCTCCAAGGTGATGG + Intronic
1178855264 21:36245420-36245442 CGCCCTGCCCCCCATGGGGATGG - Exonic
1181161721 22:20963714-20963736 CTTCCAGCCCTCCATCTGGGAGG + Intergenic
1183213253 22:36463927-36463949 CATCCTGCCCTCCATGGACACGG + Intergenic
1184573046 22:45339003-45339025 CGTCCTGCCGTCCAGGGGCAGGG + Intronic
1184986064 22:48135856-48135878 CGAAGAGCCCTCCATGGAGATGG - Intergenic
1185235667 22:49711455-49711477 ATTCCAGCCCTGCGTGGGGAAGG + Intergenic
1185329691 22:50246633-50246655 TGTCCAGCCATGCATGTGGACGG - Intronic
954438280 3:50507635-50507657 CGGCCTGCCCTTCTTGGGGATGG - Intergenic
954508206 3:51097532-51097554 CTTCCAGGGCTCCATGGGGGTGG + Intronic
955827340 3:62962359-62962381 TGTCCAGACCTCCAAGGGGAAGG + Intergenic
960496463 3:118381709-118381731 CTACCAGATCTCCATGGGGAGGG - Intergenic
961560032 3:127722367-127722389 CTTCCAGCCTTGCAGGGGGAAGG - Intronic
962437891 3:135383292-135383314 GCTCCAGCCCTACCTGGGGAGGG + Intergenic
962929629 3:140024371-140024393 AGTCCAGGGCTCCCTGGGGAAGG - Intronic
966660683 3:182411218-182411240 GGCCCAGCTCTCCATGAGGATGG - Intergenic
968477803 4:820608-820630 CCCCCAGCCCTCCACGGGGATGG - Intronic
968477925 4:821069-821091 TGTCCAGTCCTACATGGGGAGGG - Intronic
969428703 4:7140638-7140660 CCTACAGCCCTGCATGGTGATGG - Intergenic
969838211 4:9860630-9860652 AGTCCAGCCCTAGATGGGAAAGG - Intronic
974260369 4:59518328-59518350 CTTCCAGCCCTGCAGGGGCAGGG + Intergenic
976207221 4:82634737-82634759 CATCCATCCCTACATGGTGACGG + Intronic
976223692 4:82778566-82778588 TGTCCTCCCCTCCCTGGGGATGG - Intronic
990635877 5:57725692-57725714 GGTCCAGCCCTCCAGAGGAAAGG + Intergenic
992097243 5:73374156-73374178 CGTACAGCCCTCCATGAGGATGG - Intergenic
994692078 5:103032342-103032364 CTTCCAGCCCTCATTGTGGAAGG + Intergenic
997505063 5:134410904-134410926 CTTTCACCCCTCCATGAGGAAGG - Intronic
997816677 5:137026095-137026117 CATCTAGCTCTCCATAGGGATGG + Intronic
998252408 5:140561936-140561958 GGTCCAGCCCTGGTTGGGGAGGG - Intronic
1002538950 5:179893608-179893630 TGTCACGCCCTCCATGTGGAGGG + Intronic
1002693981 5:181071679-181071701 TTCCCTGCCCTCCATGGGGATGG - Intergenic
1004031722 6:11876789-11876811 TGTCCAGCTCTCCAGGGTGATGG + Intergenic
1005081033 6:21956777-21956799 GCTCCAGCCCTGCCTGGGGATGG - Intergenic
1007237201 6:40399237-40399259 CTTCCAGCCTTGGATGGGGATGG + Intronic
1007936613 6:45738073-45738095 TGTCCAGCCCTCCGTGTGGAGGG - Intergenic
1010560640 6:77344570-77344592 CTTTCAGCCCTACATCGGGAGGG + Intergenic
1012931593 6:105322968-105322990 GGTCCAGCCCTCCAGGTGGGAGG + Intronic
1013487372 6:110610113-110610135 CGTCCTGCACTCCATGGAGCAGG + Exonic
1015937197 6:138415857-138415879 GTTCCAGCTCTTCATGGGGAAGG - Exonic
1017941419 6:159056585-159056607 GCTCCAGCCCTTCCTGGGGAAGG - Intergenic
1023809511 7:43901282-43901304 CGTTGACCTCTCCATGGGGATGG - Intronic
1024487893 7:49940729-49940751 CTTCCAGAGCTGCATGGGGAAGG - Intronic
1025085431 7:56019649-56019671 CATCCAGCCCTCCAGGGAGCAGG - Exonic
1029014564 7:97302112-97302134 AGTGTAGCCTTCCATGGGGAGGG + Intergenic
1029490623 7:100868131-100868153 CGTCCAGGCTTCCAGGGCGAAGG - Exonic
1030266757 7:107629418-107629440 CTTCCAGCCCTCCAAGGAGCAGG + Intergenic
1031898353 7:127380853-127380875 CATCCAGCCCTCCAAAGGAAAGG + Intronic
1032621590 7:133539203-133539225 TGTCCTGCCCTCCCTGGGAATGG + Intronic
1032884577 7:136123897-136123919 CTTCCAGCCCCTCATGGGCAGGG - Intergenic
1036618127 8:10404406-10404428 CCCCCAACCCTCCGTGGGGAGGG + Intronic
1037426057 8:18755922-18755944 CTGCCAGACCTCCACGGGGAGGG + Intronic
1037878545 8:22561418-22561440 CGTCCGCCCCTCCCTGGGGCTGG + Intronic
1038739232 8:30202281-30202303 GGTCCAGCCCTCTGTGGGGCTGG - Intergenic
1043414639 8:80034230-80034252 CTTCCAGGCCTGCATGGGCAGGG + Intronic
1049080165 8:140436661-140436683 AGTCCAGCGCCGCATGGGGAAGG + Intronic
1049802004 8:144522235-144522257 CCTCCAGCTCTGCATGGGGGGGG - Exonic
1049827568 8:144679279-144679301 CGTACAGCCTCCTATGGGGAAGG - Intergenic
1050069150 9:1792116-1792138 CATCCATCCCTCCAAGGGGCTGG - Intergenic
1052985993 9:34488423-34488445 CTTCCAGCCCTCCAGGGGCAGGG + Intronic
1053364077 9:37510662-37510684 AGTCCAGTGATCCATGGGGACGG + Intergenic
1056845861 9:90037614-90037636 GGCCCAGCCTTCCATGGGGAAGG - Intergenic
1056855868 9:90129201-90129223 AGCCCAGCCCTTCTTGGGGAAGG - Intergenic
1058529204 9:105889236-105889258 CCTCCCAGCCTCCATGGGGATGG - Intergenic
1060103696 9:120860726-120860748 CGTCCAGCACAGCCTGGGGAGGG + Intronic
1062269178 9:135700834-135700856 CGTCCATCCCTCCCTGGCCAGGG - Intergenic
1062601557 9:137320695-137320717 CGCCAAGCCCTGCATGGAGAAGG - Intronic
1203784781 EBV:121564-121586 AGTCCAACTCTCCAAGGGGACGG - Intergenic
1186452983 X:9688594-9688616 CCTCCAGCCTTCCATGTTGAGGG + Intronic
1197146525 X:123178408-123178430 CTCCCAGCCCTACCTGGGGAGGG - Intergenic
1197686360 X:129443360-129443382 CTTCCAGCCTACCATGTGGAGGG + Intergenic
1200125159 X:153810010-153810032 CTTCAAGTCCTCCTTGGGGAAGG + Intronic