ID: 900298700

View in Genome Browser
Species Human (GRCh38)
Location 1:1965779-1965801
Sequence CACCTGGTTCTGCTGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298700_900298706 2 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298700_900298709 22 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 117
900298700_900298705 -1 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298705 1:1965801-1965823 GGCTTTTGCCCTGACAGTAGAGG 0: 1
1: 0
2: 0
3: 13
4: 106
900298700_900298712 26 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298712 1:1965828-1965850 CAATGCTTACAGAAACCGGGCGG 0: 1
1: 0
2: 3
3: 8
4: 60
900298700_900298713 29 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298713 1:1965831-1965853 TGCTTACAGAAACCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 39
900298700_900298714 30 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298700_900298710 23 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298700 Original CRISPR CACCTGGTTCTGCTGGTTCT GGG (reversed) Intronic