ID: 900298701

View in Genome Browser
Species Human (GRCh38)
Location 1:1965780-1965802
Sequence CCACCTGGTTCTGCTGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298701_900298714 29 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298701_900298710 22 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298701_900298706 1 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298701_900298712 25 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298712 1:1965828-1965850 CAATGCTTACAGAAACCGGGCGG 0: 1
1: 0
2: 3
3: 8
4: 60
900298701_900298705 -2 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298705 1:1965801-1965823 GGCTTTTGCCCTGACAGTAGAGG 0: 1
1: 0
2: 0
3: 13
4: 106
900298701_900298709 21 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 117
900298701_900298713 28 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298713 1:1965831-1965853 TGCTTACAGAAACCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298701 Original CRISPR CCACCTGGTTCTGCTGGTTC TGG (reversed) Intronic