ID: 900298704

View in Genome Browser
Species Human (GRCh38)
Location 1:1965795-1965817
Sequence CTGTCAGGGCAAAAGCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298704_900298709 6 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 117
900298704_900298710 7 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298704_900298712 10 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298712 1:1965828-1965850 CAATGCTTACAGAAACCGGGCGG 0: 1
1: 0
2: 3
3: 8
4: 60
900298704_900298713 13 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298713 1:1965831-1965853 TGCTTACAGAAACCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 39
900298704_900298714 14 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298704 Original CRISPR CTGTCAGGGCAAAAGCCACC TGG (reversed) Intronic
900298704 1:1965795-1965817 CTGTCAGGGCAAAAGCCACCTGG - Intronic
900865791 1:5267821-5267843 TTGGCAGGGCCAAAGCCTCCTGG - Intergenic
900934332 1:5755794-5755816 CTGTCAGGGCAGGACCCACCTGG - Intergenic
901144896 1:7058104-7058126 CTGGCAGGGCCATAGCCATCTGG - Intronic
902292678 1:15445564-15445586 CCGGGAGGGCATAAGCCACCAGG - Intronic
902370680 1:16005067-16005089 TTGCCAGGGCAAATGCCACCAGG + Intronic
905243502 1:36596595-36596617 CAGTCAGGACAGAAGGCACCAGG - Intergenic
905609070 1:39332950-39332972 CTGTCAGAGAAAATGCCAGCAGG + Intronic
905824033 1:41015936-41015958 CTGTCAGGGTTGAAGCCACATGG + Exonic
907158595 1:52355725-52355747 GTGTCCGGGCAAGAGCCTCCTGG + Intronic
908411630 1:63871641-63871663 CTGTCAAGGCAAATGTCTCCTGG - Intronic
914417627 1:147498453-147498475 CTGTCAGGACAGAAACAACCAGG + Intergenic
916614840 1:166429230-166429252 CTCACAGTGTAAAAGCCACCAGG - Intergenic
918043389 1:180926757-180926779 CTGTCAGGGCAGGAGCCCCAGGG + Intronic
918950122 1:191126035-191126057 CTGTCAGACCAAAAGACAGCAGG + Intergenic
919700377 1:200625386-200625408 CTGTCAAGTAAGAAGCCACCTGG + Intronic
919761631 1:201101786-201101808 CTGTCATGGCAAGGGCCATCGGG - Intronic
920100458 1:203514001-203514023 CTCTCAGGGCCACAGTCACCTGG - Intergenic
920199993 1:204253958-204253980 CTGTGAGGGCAAAAGCCCGCAGG + Intronic
924178669 1:241419074-241419096 CAGTCAAGGCAAAAGTCCCCAGG - Intergenic
924300446 1:242632492-242632514 CTGTCAGGGTCAGAGGCACCAGG - Intergenic
924378934 1:243443376-243443398 CTGGCAGAGCAACAACCACCTGG - Intronic
924710606 1:246527534-246527556 CTGTCAGGGCTAAAGTCAGGAGG + Intergenic
1062867845 10:871949-871971 GTGTCAGTACAAAAGCTACCAGG + Intronic
1064968847 10:21042564-21042586 CTGTAAGGGAAAATGCCATCAGG + Intronic
1065368534 10:24957953-24957975 CTTCCAGGACAAAAGCCTCCAGG - Intergenic
1066262035 10:33738382-33738404 CAGCCAGAGCAAAAGCCCCCAGG + Intergenic
1067024566 10:42832701-42832723 CTGTCAGGGCTAGGTCCACCTGG + Exonic
1068955496 10:62816457-62816479 ATGTGACGGCAAAAGCCGCCTGG - Intronic
1070519842 10:77243098-77243120 CTGTCAGGTCAAAAGACAAGGGG + Intronic
1071734699 10:88285556-88285578 CTGTCATGGCAACACCCACCTGG + Intronic
1072959719 10:99918382-99918404 ATTACAGAGCAAAAGCCACCAGG - Intronic
1073257045 10:102159325-102159347 CTGTCAGGGCAGAGGTGACCAGG + Exonic
1073921213 10:108462148-108462170 GTGTCAGGGCAAAGGGCACAGGG - Intergenic
1076345369 10:129775440-129775462 CGGTCAGGGCTACAGACACCAGG - Intergenic
1076873179 10:133203440-133203462 CAGCAAGGGCAAAAACCACCTGG + Intronic
1083243454 11:61407189-61407211 CTGTCAGGAGCAAAGCCATCAGG + Intronic
1083476818 11:62920646-62920668 GTGTCAGGCCAGAAGCCAGCAGG - Intronic
1083551216 11:63591494-63591516 CTGTCAGGGTCAAGGCCCCCAGG + Intronic
1083718728 11:64593510-64593532 CTGCCACGGCAAAGGCCAACAGG - Exonic
1085712872 11:78845715-78845737 CTGTCAGTGGAAAAGCCAGCTGG + Intronic
1089878925 11:121754511-121754533 CTGACAGGGCAAAGGCCATATGG + Intergenic
1091980087 12:4857707-4857729 CTGTAAGCTCAAAAGCCCCCAGG - Intergenic
1096607427 12:52776843-52776865 CCCCCAGGGCCAAAGCCACCAGG + Exonic
1096610107 12:52795549-52795571 CCCCCAGGGCCAAAGCCACCAGG + Exonic
1098963447 12:76762850-76762872 CTGTTAGGCCAGAAACCACCAGG - Intergenic
1102200279 12:111053258-111053280 CTGCTGGGGCAAGAGCCACCGGG - Intronic
1104203717 12:126616714-126616736 CTAGCCCGGCAAAAGCCACCTGG + Intergenic
1104850623 12:131871873-131871895 CTGTCAGTGCAAAGGCCCCGCGG + Intergenic
1107332623 13:39318346-39318368 CTGTCAGGTGTAAAGCCAGCAGG - Intergenic
1113394800 13:109937224-109937246 CTGTCAGGGTACAGGCCACATGG - Intergenic
1115458353 14:33631537-33631559 CTGTCAGTGTAAAGGCCACTGGG - Intronic
1119260056 14:73232630-73232652 CTGTCAGGAGATAAGCCACCTGG - Intergenic
1119788440 14:77329291-77329313 CTGTCAGGCCCAAAGCAGCCTGG - Intronic
1120109414 14:80535954-80535976 CTGTAGGTGCAAAAGCCACAGGG - Intronic
1122063955 14:99158895-99158917 CTGTCATGCTAAAAGCCACACGG + Intergenic
1124677266 15:31696806-31696828 CTTTCAGGGCAAATGCAGCCAGG + Intronic
1126377269 15:48008812-48008834 TTGTCAAGGCAAGAGCCACATGG + Intergenic
1128107603 15:65056035-65056057 CTTTCAGGTCAGAAGCCTCCAGG - Intronic
1129286664 15:74530995-74531017 CTGTCAGAGCAAAAGGGAGCAGG - Intergenic
1129426763 15:75469103-75469125 CTTTCAGGCCTAAGGCCACCTGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1132249891 15:100327888-100327910 CTGACACGGCAAAGGCCATCTGG - Intronic
1135420169 16:22300460-22300482 CTGGCAGGGCAGAGGCCAACAGG + Intronic
1137383754 16:48022521-48022543 CTGACAGGGCTAAATCCTCCTGG + Intergenic
1141146350 16:81532941-81532963 CAGTCAGGGCAAAGGCCTCGAGG - Intronic
1141989034 16:87599841-87599863 CTGTCATGGGAAGAGGCACCAGG + Intergenic
1143899860 17:10165956-10165978 GTCTCAGAGCAAAAGGCACCAGG + Intronic
1145900283 17:28486504-28486526 GAGGCAGGGCCAAAGCCACCCGG + Intronic
1146159182 17:30550750-30550772 CTGTCAGGGCTAAAGTCAGGAGG - Intergenic
1146395643 17:32463567-32463589 CTGAAAGGGAAAAAGCCAGCTGG + Intronic
1147772622 17:42878354-42878376 AGGTCAGGGCAACAGCCTCCAGG + Intergenic
1148633808 17:49132351-49132373 CTGTCCTGGCAAAAGACCCCAGG - Intergenic
1149010846 17:51854718-51854740 CTGTTAGGTCATAAGCCACGTGG - Intronic
1152724080 17:81936766-81936788 TGGCCAGGGCAAAAGCCAGCTGG + Exonic
1158601783 18:58862847-58862869 CTTTCAGAGAAAAAGCCACTGGG - Exonic
1160062688 18:75547199-75547221 CTCTCAGGGTAAAAGCCATGGGG - Intergenic
1160618402 18:80151402-80151424 CTGTAAGGGGAAAAGGCACAAGG + Intronic
1160805205 19:989595-989617 CTGTCAGGGCAGCGGCCAGCAGG - Intronic
1162852002 19:13438223-13438245 AAGTCAGGGCAAAAGGCCCCAGG + Intronic
1163420814 19:17212728-17212750 CTGTCAGAGCAGAAGCCACTAGG + Exonic
1165428942 19:35760982-35761004 CAGTCCAGGCAGAAGCCACCAGG + Intronic
1167675807 19:50884541-50884563 CTTTGAGTGCAAAATCCACCTGG - Intergenic
1168118057 19:54236229-54236251 CTGACAGGTCAAGAACCACCTGG + Intronic
925082875 2:1083625-1083647 CTGTGTGGGCGGAAGCCACCAGG + Exonic
930257788 2:49111570-49111592 CTGTTCAGACAAAAGCCACCAGG - Intronic
931587409 2:63842596-63842618 CAGTCCCGGCAAAACCCACCCGG - Intronic
933989378 2:87622897-87622919 ATGTCAGGGCAGAGGGCACCAGG + Intergenic
936304464 2:111327929-111327951 ATGTCAGGGCAGAGGGCACCAGG - Intergenic
937467719 2:122149321-122149343 TTCTCAGGGCTCAAGCCACCTGG - Intergenic
939023926 2:136989469-136989491 CAGTCAGGGCAAAAGGCAAAGGG - Intronic
939670944 2:145011605-145011627 CTGTTTGGGGAAAACCCACCTGG - Intergenic
939727165 2:145735700-145735722 TTGTCAGGGTAAAAGTCAACAGG + Intergenic
940625822 2:156173610-156173632 GTGTCAGGACAGAAGACACCAGG - Intergenic
942446747 2:176083256-176083278 CTGAGAGGGGAAAAGGCACCGGG + Intronic
946372665 2:219290273-219290295 CTGTCAGGGCAAATTCAAACTGG + Exonic
946610478 2:221452568-221452590 CTGTCATGGGAAAGGCCGCCCGG - Intronic
1169218759 20:3808414-3808436 TTGTCATGGCAAAAGTTACCGGG - Intergenic
1169916226 20:10686582-10686604 CTGTCAGAGCAGGAGCCACCTGG + Intergenic
1170819243 20:19742333-19742355 CTTTCAGAGCAAAAGCAACCCGG + Intergenic
1172045940 20:32080110-32080132 TTTTCAGGGCCTAAGCCACCTGG - Intronic
1175614907 20:60389710-60389732 GGGTCAGGGCAAGAGCCAACTGG + Intergenic
1175878606 20:62243502-62243524 CTGTCAGGGTAGAAGGCTCCTGG + Intronic
1178687461 21:34722912-34722934 CTGTCAAGGTAAAGCCCACCTGG - Intergenic
1180799550 22:18625425-18625447 CAGTCAGGGCAACAGCCAGATGG - Intergenic
1181222166 22:21369841-21369863 CAGTCAGGGCAACAGCCAGATGG + Intergenic
1181637923 22:24182834-24182856 CAGTCAGGGCAACAGCCAGATGG + Intronic
1181769381 22:25114222-25114244 CTGTCAAGGCCAAGGCCAGCTGG - Intronic
1183056665 22:35310964-35310986 GTGTCAGGGCAGACTCCACCAGG + Intronic
1184652857 22:45927058-45927080 CTGTCCGGACAACAGCCCCCAGG + Intronic
1184959560 22:47919236-47919258 CTGTCTGGGCCTCAGCCACCTGG + Intergenic
950370134 3:12522319-12522341 CAGTGAGGGCAAAGGCCTCCAGG - Intronic
952370446 3:32717937-32717959 CTGTCAAGCCAAAAGTCACTTGG - Intronic
953726854 3:45407058-45407080 GTCTCAGGCAAAAAGCCACCAGG + Intronic
954526955 3:51280257-51280279 CTGACAGGGAAAAAGCCCCTGGG - Intronic
954644767 3:52124384-52124406 CAGTCAGGGCACAAGGCACCAGG + Intronic
955936105 3:64104127-64104149 CTGTCAGGGCAATAGCAGCTGGG + Intronic
964418196 3:156472111-156472133 CAGTCAGGGGGAAAGCCAACCGG - Intronic
969495592 4:7524395-7524417 CTGTGAGGGGACAAGCCACGCGG + Intronic
971354011 4:25878169-25878191 CTGTCCGAGCAGAAGACACCGGG + Intronic
975936275 4:79585158-79585180 CTGGAAGGGCAACAGCCATCTGG - Intergenic
979935398 4:126687768-126687790 TTGTCAGTGCAAAAACGACCTGG + Intergenic
981236322 4:142419874-142419896 CTGTAAAATCAAAAGCCACCAGG - Intronic
981440853 4:144780135-144780157 CCGTCACTGCCAAAGCCACCTGG + Intergenic
982911694 4:161149660-161149682 CTGCCAGGGCAAAATTCTCCAGG + Intergenic
988401434 5:30765999-30766021 CTGTCAGGGAAAAAGTGACTTGG - Intergenic
1000072101 5:157750485-157750507 CTGACAGTGTAAAAGGCACCTGG - Intronic
1002710959 5:181194860-181194882 CAGTCAGGGCAGAAGCCCCCTGG + Exonic
1003709953 6:8578281-8578303 CAGTCAGGCCAAAAGGCCCCAGG + Intergenic
1005340488 6:24839273-24839295 CTGTAAAGGCAGAAGGCACCAGG + Intronic
1006361063 6:33587490-33587512 CTGTCAGGGCAAATGTCCACTGG - Intergenic
1009479698 6:64141307-64141329 CTGCCAGGACAAAAGCCTTCTGG - Intronic
1017218597 6:151939295-151939317 CTCTCAGGGGAAAAGCCAAAAGG - Intronic
1023058134 7:36305837-36305859 CTGTGATGGCAAAAACCATCAGG + Intergenic
1023169886 7:37380234-37380256 CTGTCATTCAAAAAGCCACCAGG - Intronic
1026671198 7:72392115-72392137 CTGTCAGAACACAAGCCACATGG + Intronic
1028837466 7:95390914-95390936 CTGTGGGAGCAAAAGCCCCCAGG + Intronic
1029112027 7:98217462-98217484 CTGTCCGGGCCAATGCCACCAGG - Exonic
1029860763 7:103569333-103569355 CAGTCAGGACAAAAGCCAGGAGG - Intronic
1032951555 7:136920573-136920595 CTGTAAGGGCAAAAGGCAGTAGG - Intronic
1034077493 7:148246393-148246415 CTGTGATTGCAAAAGCAACCGGG + Intronic
1034991123 7:155548728-155548750 CTGTCAGGGCAGAGGCCACCTGG - Intergenic
1035388275 7:158488962-158488984 CTCCCAGGGCAGACGCCACCCGG - Intronic
1036036070 8:5020747-5020769 CTGTGATGGGAAAAACCACCTGG - Intergenic
1040951009 8:52939308-52939330 CTGTCAGGAGAAAAGCCCGCCGG - Exonic
1043232279 8:77818191-77818213 ATTTCAGTCCAAAAGCCACCAGG + Intergenic
1046101457 8:109618949-109618971 CTTCCAGGGCAAAAGCCAATGGG + Exonic
1050704653 9:8383399-8383421 CTGTCAGGGCCAAAGAGACTGGG - Intronic
1053287814 9:36861157-36861179 GTGTCAAGGCAGATGCCACCAGG - Intronic
1053409812 9:37908624-37908646 ATGATAGGGAAAAAGCCACCTGG - Intronic
1053901143 9:42796526-42796548 CTGGGATGGCAAAAGCCAGCAGG - Intergenic
1054260502 9:62861038-62861060 CTGGGATGGCAAAAGCCAGCAGG + Intergenic
1056310319 9:85334246-85334268 CAGTCAGGGAAAAAGCCACTAGG - Intergenic
1057075504 9:92136230-92136252 CTGCCAGGGGAAAAGGCATCAGG - Intergenic
1057083803 9:92190615-92190637 CTGGCAGGGCAGAGGTCACCTGG + Intergenic
1059612390 9:115912779-115912801 CTCTCAGGGAAAAAGGCATCAGG + Intergenic
1059756860 9:117302047-117302069 CTGTCAAGGCAAGAAGCACCTGG + Intronic
1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG + Intronic
1060541309 9:124432309-124432331 CTGTCTCTGCAAAAGCCACATGG - Intergenic
1061819398 9:133217719-133217741 CGGTCAGGGCAGAGGCCAGCAGG - Intergenic
1062241288 9:135540470-135540492 CGGTCAGGGCAGAGGCCAGCAGG + Intergenic
1187362416 X:18641006-18641028 CTTTCAGGGAAAAAGCTACATGG + Exonic
1188211997 X:27438107-27438129 CTGTCATTTCAAAAGCCTCCTGG + Intergenic
1192244880 X:69363723-69363745 ATGCCTGGGCAAAAGCCACAGGG + Intergenic
1198330713 X:135619841-135619863 CTTTCAGGGGAAAAGGCAGCTGG + Intergenic