ID: 900298704

View in Genome Browser
Species Human (GRCh38)
Location 1:1965795-1965817
Sequence CTGTCAGGGCAAAAGCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298704_900298710 7 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298710 1:1965825-1965847 GGCCAATGCTTACAGAAACCGGG 0: 1
1: 0
2: 1
3: 8
4: 112
900298704_900298709 6 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG 0: 1
1: 0
2: 1
3: 9
4: 117
900298704_900298712 10 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298712 1:1965828-1965850 CAATGCTTACAGAAACCGGGCGG 0: 1
1: 0
2: 3
3: 8
4: 60
900298704_900298714 14 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
900298704_900298713 13 Left 900298704 1:1965795-1965817 CCAGGTGGCTTTTGCCCTGACAG 0: 1
1: 0
2: 1
3: 14
4: 149
Right 900298713 1:1965831-1965853 TGCTTACAGAAACCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298704 Original CRISPR CTGTCAGGGCAAAAGCCACC TGG (reversed) Intronic