ID: 900298706

View in Genome Browser
Species Human (GRCh38)
Location 1:1965804-1965826
Sequence TTTTGCCCTGACAGTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 188}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900298694_900298706 21 Left 900298694 1:1965760-1965782 CCCTGGTCAGCCCGGCATCCCCA 0: 1
1: 0
2: 3
3: 15
4: 154
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298699_900298706 3 Left 900298699 1:1965778-1965800 CCCCAGAACCAGCAGAACCAGGT 0: 1
1: 0
2: 1
3: 24
4: 251
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298697_900298706 10 Left 900298697 1:1965771-1965793 CCGGCATCCCCAGAACCAGCAGA 0: 1
1: 0
2: 6
3: 26
4: 414
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298700_900298706 2 Left 900298700 1:1965779-1965801 CCCAGAACCAGCAGAACCAGGTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298696_900298706 11 Left 900298696 1:1965770-1965792 CCCGGCATCCCCAGAACCAGCAG 0: 1
1: 0
2: 3
3: 46
4: 414
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298693_900298706 24 Left 900298693 1:1965757-1965779 CCACCCTGGTCAGCCCGGCATCC 0: 1
1: 0
2: 1
3: 21
4: 220
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298701_900298706 1 Left 900298701 1:1965780-1965802 CCAGAACCAGCAGAACCAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 200
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298703_900298706 -5 Left 900298703 1:1965786-1965808 CCAGCAGAACCAGGTGGCTTTTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188
900298695_900298706 20 Left 900298695 1:1965761-1965783 CCTGGTCAGCCCGGCATCCCCAG 0: 1
1: 0
2: 3
3: 23
4: 197
Right 900298706 1:1965804-1965826 TTTTGCCCTGACAGTAGAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900298706 Original CRISPR TTTTGCCCTGACAGTAGAGG TGG Intronic